HELP     Sign In
Search

Relevance to Autism

Rare mutations in the CHD8 gene have been identified in individuals with ASD (Oâ??Roak et al., 2012). A balanced chromosomal abnormality (BCA) that disrupted the CHD8 gene was also recently identified in an ASD case (Talkowski et al., 2012).

Molecular Function

This gene encodes a DNA helicase that functions as a transcription repressor by remodeling chromatin structure. It binds beta-catenin and negatively regulates Wnt signaling pathway, which plays a pivotal role in vertebrate early development and morphogenesis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

External Links

       

References

Type
Title
Type of Disorder
Associated Disorders
Author, Year
Primary
Sporadic autism exomes reveal a highly interconnected protein network of de novo mutations.
ASD
Support
Recurrent ?100 Kb microdeletion in the chromosomal region 14q11.2, involving CHD8 gene, is associated with autism and macrocephaly.
ASD
Support
De novo mutations in schizophrenia implicate chromatin remodeling and support a genetic overlap with autism and intellectual disability.
SCZ
Support
Multiplex targeted sequencing identifies recurrently mutated genes in autism spectrum disorders.
ASD
Support
Sequencing chromosomal abnormalities reveals neurodevelopmental loci that confer risk across diagnostic boundaries.
ASD
Support
CHD8 interacts with CHD7, a protein which is mutated in CHARGE syndrome.
Support
The contribution of de novo coding mutations to autism spectrum disorder.
ASD
Recent recommendation
Synaptic, transcriptional and chromatin genes disrupted in autism.
ASD
Recent recommendation
CHD8 regulates neurodevelopmental pathways associated with autism spectrum disorder in neural progenitors.
Recent recommendation
Disruptive CHD8 mutations define a subtype of autism early in development.
ASD
DD, ID

Rare

Variant ID
Variant Type
Allele Change
Residue Change
Inheritance Pattern
Inheritance Association
Family Type
Author, Year
 GEN334R001 
 Frameshift deletion 
 delCT 
 Leu2120ProfsX13 
 De novo 
  
 Simplex 
 GEN334R002 
 Nonsense 
 G to A 
 Gln959X 
 De novo 
  
 Simplex 
 GEN334R003 
 Translocation 
  
  
 De novo 
  
  
 GEN334R004 
 In-frame deletion 
 del(GGT) 
 His2498del 
 De novo 
  
 Simplex 
 GEN334R005 
 Frameshift insertion 
 ins(T) 
 Asn2371LysfsX2 
 De novo 
  
 Simplex 
 GEN334R006 
 Frameshift deletion 
 del(CTTC) 
 Glu2103ArgfsX3 
 De novo 
  
 Simplex 
 GEN334R007 
 Nonsense 
 G>A 
 Arg1337X 
 De novo 
  
 Simplex 
 GEN334R008 
 Splice-site 
 c.3519-2A>G 
  
 De novo 
  
 Simplex 
 GEN334R009 
 Frameshift insertion 
 ins(T) 
 Tyr747X 
 De novo 
  
 Simplex 
 GEN334R010 
 Nonsense 
 G>C 
 Ser62X 
 De novo 
  
 Simplex 
 GEN334R011 
 Nonsense 
 C>A 
 S2173X 
 De novo 
  
 Simplex 
 GEN334R012 
 Frameshift 
  
 Val984X 
 Familial 
 Maternal 
 Possible multi-generational 
 GEN334R013 
 Nonsense 
  
 Glu1114X 
 De novo 
  
  
 GEN334R014 
 Frameshift 
  
 Glu1932SerfsX3 
 De novo 
  
  
 GEN334R015 
 Frameshift 
  
 Glu2136ArgfsX6 
 De novo 
  
  
 GEN334R016 
 In-frame deletion 
  
 Lys2287del 
 Unknown 
  
  
 GEN334R017 
 Missense 
  
 Arg910Gln 
 Unknown 
  
 Unknown 
 GEN334R018 
 Missense 
  
 Gly1710Val 
 Familial 
 Maternal 
  
 GEN334R019 
 Missense 
  
 Arg1797Gln 
 Familial 
 Paternal 
 Possible multi-generational 
 GEN334R020 
 Duplication 
  
  
 Familial 
 Paternal 
 Possible multiplex 
 GEN334R021 
 Duplication 
  
  
 Unknown 
  
 Unknown 
 GEN334R022 
 Duplication 
  
  
 Unknown 
  
 Unknown 
 GEN334R023 
 Deletion 
  
  
 De novo 
  
  
 GEN334R024 
 Missense 
 C/T 
 R1242Q 
 De novo 
  
 Simplex 
 GEN334R025 
 Missense 
 A/G 
 L834P 
 De novo 
  
 Simplex 
 GEN334R026 
 Missense 
 G/A 
 R1178C 
 Familial 
 Paternal 
 Simplex 
 GEN334R027 
 Missense 
 A/C 
 F1358C 
 Familial 
 Maternal 
 Simplex 
 GEN334R028 
 Missense 
 C/G 
 R213P 
 Familial 
 Maternal 
 Simplex 
 GEN334R029 
 Missense 
 C/T 
 R1609H 
 Familial 
 Paternal 
 Simplex 
 GEN334R030 
 Frameshift deletion 
 del(T) 
  
 Unknown 
  
 Unknown 
 GEN334R031 
 Splice-site 
 A/T 
  
 De novo 
  
 Simplex 
 GEN334R032 
 Splice-site 
 T/G 
  
 De novo 
  
 Simplex 
 GEN334R033 
 Nonsense 
 C/T 
  
 Unknown 
  
 Unknown 
 GEN334R034 
 Missense 
 C/T 
 R1699H 
 Unknown 
  
 Unknown 
 GEN334R035 
 Missense 
 G/A 
 L1072F 
 Unknown 
  
 Unknown 
 GEN334R036 
 Missense 
 G/A 
 R1609C 
 Unknown 
  
 Unknown 
 GEN334R037 
 Missense 
 G/A 
 R1615C 
 Unknown 
  
 Unknown 
 GEN334R038 
 Missense 
 C/T 
  
 Unknown 
  
 Unknown 
 GEN334R039 
 Missense 
 G/A 
  
 Unknown 
  
 Unknown 
 GEN334R040 
 Missense 
 C/A 
  
 Unknown 
  
 Unknown 
 GEN334R041 
 Splice-site 
 del(CTCTTGCACGTCCCATCACAGTAGCAAGGAGTACTCACTTGAGCTT 
  
 De novo 
  
 Simplex 

Common

No Common Variants Available



Model Summary

Mode of p53 regulation mediated by CHD8, which may set a threshold for induction of apoptosis during early embryogenesis by counteracting p53 function through recruitment of histone H1

External Links

AllenBrainAtlas   MGI Logo  Entrez Gene

References

Type
Title
Author, Year
Additional
CHD8 suppresses p53-mediated apoptosis through histone H1 recruitment during early embryogenesis.

CHD8_1_KO_HM

Model Type: Genetic
Model Genotype: Homozygous
Mutation: Targeted deletion of all the exons of the Chd8 gene
Allele Type: Targeted (Knock Out)
Strain of Origin: Not specified
Genetic Background: C57BL/6
ES Cell Line: Not specified
Mutant ES Cell Line: Not specified
Model Source: Not specified

CHD8_1_KO_HM

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
Developmental trajectory1
Abnormal
Description: Abnormal developmental trajectory indicated by growth retardation
Exp Paradigm: Histopathological examination
 Histology
 
Mortality/lethality1
Increased
Description: Increased early embryonic death
Exp Paradigm: General observations
 General observations
 E5.5 - E10.5
 Not Reported: Circadian sleep/wake cycle ,   Communications ,   Emotion ,   Homeostasis ,   Immune response ,   Learning & memory ,   Maternal behavior ,   Molecular profile ,   Motor phenotype ,   Neuroanatomy / Ultrastructure / Cytoarchitecture ,   Neurophysiology ,   Repetitive behavior ,   Seizure ,   Sensory ,   Social behavior ,  



Interactor Symbol Interactor Name Interactor Organism Entrez ID Uniprot ID Interaction Type Evidence Reference
41703 membrane-associated ring finger (C3HC4) 5 NM_017824 Q9NX47 ChIP-chip
Subtil-Rodríguez A 2014
41704 membrane-associated ring finger (C3HC4) 6, E3 ubiquitin protein ligase NM_005885 O60337 ChIP-chip
Subtil-Rodríguez A 2014
41707 membrane-associated ring finger (C3HC4) 9 NM_138396 Q86YJ5 ChIP-chip
Subtil-Rodríguez A 2014
41884 septin 2 NM_004404 Q15019 ChIP-chip
Subtil-Rodríguez A 2014
41886 septin 4 NM_004574 O43236 ChIP-chip
Subtil-Rodríguez A 2014
41889 membrane-associated ring finger (C3HC4) 7, E3 ubiquitin protein ligase NM_022826 B7ZAR7 ChIP-chip
Subtil-Rodríguez A 2014
41893 15 kDa selenoprotein NM_004261 O60613 ChIP-chip
Subtil-Rodríguez A 2014
AAGAB alpha- and gamma-adaptin binding protein 79719 Q6PD74 ChIP-chip
Subtil-Rodríguez A 2014
AAK1 AP2 associated kinase 1 22848 Q2M2I8 ChIP-chip
Subtil-Rodríguez A 2014
AASDH aminoadipate-semialdehyde dehydrogenase 132949 Q4L235 ChIP-chip
Subtil-Rodríguez A 2014
AASDHPPT aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase 60496 Q9NRN7 ChIP-chip
Subtil-Rodríguez A 2014
ABCC5 ATP-binding cassette, sub-family C (CFTR/MRP), member 5 10057 O15440 ChIP-chip
Subtil-Rodríguez A 2014
ABCD3 ATP-binding cassette, sub-family D (ALD), member 3 5825 P28288 ChIP-chip
Subtil-Rodríguez A 2014
ABCE1 ATP-binding cassette, sub-family E (OABP), member 1 6059 P61221 ChIP-chip
Subtil-Rodríguez A 2014
ABHD10 abhydrolase domain containing 10 55347 Q9NUJ1 ChIP-chip
Subtil-Rodríguez A 2014
ABHD12 abhydrolase domain containing 12 26090 Q8N2K0 ChIP-chip
Subtil-Rodríguez A 2014
ABHD14A abhydrolase domain containing 14A NM_015407 Q9BUJ0 ChIP-chip
Subtil-Rodríguez A 2014
ABHD3 abhydrolase domain containing 3 NM_138340 Q8WU67 ChIP-chip
Subtil-Rodríguez A 2014
ABI1 abl-interactor 1 10006 Q8IZP0 ChIP-chip
Subtil-Rodríguez A 2014
ABI2 abl-interactor 2 10152 Q9NYB9 ChIP-chip
Subtil-Rodríguez A 2014
ABL1 c-abl oncogene 1, non-receptor tyrosine kinase 25 P00519 ChIP-chip
Subtil-Rodríguez A 2014
ABT1 activator of basal transcription 1 29777 Q9ULW3 ChIP-chip
Subtil-Rodríguez A 2014
ABTB2 ankyrin repeat and BTB (POZ) domain containing 2 25841 Q8N961 ChIP-chip
Subtil-Rodríguez A 2014
ACACA acetyl-CoA carboxylase alpha 31 Q13085 ChIP-chip
Subtil-Rodríguez A 2014
ACAD9 acyl-CoA dehydrogenase family, member 9 28976 Q9H845 ChIP-chip
Subtil-Rodríguez A 2014
ACADM acyl-CoA dehydrogenase, C-4 to C-12 straight chain 34 P11310 ChIP-chip
Subtil-Rodríguez A 2014
ACAT1 acetyl-CoA acetyltransferase 1 38 P24752 ChIP-chip
Subtil-Rodríguez A 2014
ACBD6 acyl-CoA binding domain containing 6 84320 B2RAA8 ChIP-chip
Subtil-Rodríguez A 2014
ACIN1 apoptotic chromatin condensation inducer 1 22985 Q9UKV3 ChIP-chip
Subtil-Rodríguez A 2014
ACLY ATP citrate lyase 47 P53396 ChIP-chip
Subtil-Rodríguez A 2014
ACO1 aconitase 1, soluble 48 P21399 ChIP-chip
Subtil-Rodríguez A 2014
ACOX3 acyl-CoA oxidase 3, pristanoyl NM_003501 O15254 ChIP-chip
Subtil-Rodríguez A 2014
ACP1 acid phosphatase 1, soluble 52 B5MCC7 ChIP-chip
Subtil-Rodríguez A 2014
ACP2 acid phosphatase 2, lysosomal 53 P11117 ChIP-chip
Subtil-Rodríguez A 2014
ACTB actin, beta 60 P60709 ChIP-chip
Subtil-Rodríguez A 2014
ACTL6A actin-like 6A 86 O96019 ChIP-chip
Subtil-Rodríguez A 2014
ACTR1A ARP1 actin-related protein 1 homolog A, centractin alpha (yeast) 10121 P61163 ChIP-chip
Subtil-Rodríguez A 2014
ACTR2 ARP2 actin-related protein 2 homolog (yeast) 10097 E9PF41 ChIP-chip
Subtil-Rodríguez A 2014
ACTR3 ARP3 actin-related protein 3 homolog (yeast) 10096 P61158 ChIP-chip
Subtil-Rodríguez A 2014
ACTR6 ARP6 actin-related protein 6 homolog (yeast) NM_022496 Q9GZN1 ChIP-chip
Subtil-Rodríguez A 2014
ACVR1B activin A receptor, type IB 91 P36896 ChIP-chip
Subtil-Rodríguez A 2014
ACVR2A activin A receptor, type IIA 92 P27037 ChIP-chip
Subtil-Rodríguez A 2014
ACYP1 acylphosphatase 1, erythrocyte (common) type NM_001107 P07311 ChIP-chip
Subtil-Rodríguez A 2014
ADAL adenosine deaminase-like 161823 Q6DHV7 ChIP-chip
Subtil-Rodríguez A 2014
ADAM17 ADAM metallopeptidase domain 17 6868 B2RNB2 ChIP-chip
Subtil-Rodríguez A 2014
ADAM8 ADAM metallopeptidase domain 8 NM_001109 P78325 ChIP-chip
Subtil-Rodríguez A 2014
ADAM9 ADAM metallopeptidase domain 9 8754 Q13443 ChIP-chip
Subtil-Rodríguez A 2014
ADAMTS8 ADAM metallopeptidase with thrombospondin type 1 motif, 8 11095 Q5FWF1 ChIP-chip
Subtil-Rodríguez A 2014
ADAR adenosine deaminase, RNA-specific 103 P55265 ChIP-chip
Subtil-Rodríguez A 2014
ADD1 adducin 1 (alpha) 118 P35611 ChIP-chip
Subtil-Rodríguez A 2014
ADK adenosine kinase 132 P55263 ChIP-chip
Subtil-Rodríguez A 2014
ADM adrenomedullin NM_001124 P35318 ChIP-chip
Subtil-Rodríguez A 2014
ADNP activity-dependent neuroprotector homeobox 23394 Q9H2P0 ChIP-chip
Subtil-Rodríguez A 2014
ADRM1 adhesion regulating molecule 1 11047 Q16186 ChIP-chip
Subtil-Rodríguez A 2014
ADSL adenylosuccinate lyase 158 P30566 ChIP-chip
Subtil-Rodríguez A 2014
ADSS adenylosuccinate synthase 159 P30520 ChIP-chip
Subtil-Rodríguez A 2014
AFTPH aftiphilin 54812 Q6ULP2 ChIP-chip
Subtil-Rodríguez A 2014
AGA aspartylglucosaminidase NM_000027 P20933 ChIP-chip
Subtil-Rodríguez A 2014
AGAP3 ArfGAP with GTPase domain, ankyrin repeat and PH domain 3 NM_001042535 Q86ST5 ChIP-chip
Subtil-Rodríguez A 2014
AGPAT1 1-acylglycerol-3-phosphate O-acyltransferase 1 10554 Q99943 ChIP-chip
Subtil-Rodríguez A 2014
AHSA1 AHA1, activator of heat shock 90kDa protein ATPase homolog 1 (yeast) 10598 O95433 ChIP-chip
Subtil-Rodríguez A 2014
AIFM1 apoptosis-inducing factor, mitochondrion-associated, 1 9131 O95831 ChIP-chip
Subtil-Rodríguez A 2014
AK3 adenylate kinase 3 50808 Q7Z4Y4 ChIP-chip
Subtil-Rodríguez A 2014
AKAP11 A kinase (PRKA) anchor protein 11 11215 Q9UKA4 ChIP-chip
Subtil-Rodríguez A 2014
AKAP4 A kinase (PRKA) anchor protein 4 8852 Q5JQC9 ChIP-chip
Subtil-Rodríguez A 2014
AKAP8 A kinase (PRKA) anchor protein 8 10270 O43823 ChIP-chip
Subtil-Rodríguez A 2014
AKAP8L A kinase (PRKA) anchor protein 8-like 26993 Q9ULX6 ChIP-chip
Subtil-Rodríguez A 2014
AKIRIN2 akirin 2 55122 Q53H80 ChIP-chip
Subtil-Rodríguez A 2014
AKT1S1 AKT1 substrate 1 (proline-rich) 84335 Q96B36 ChIP-chip
Subtil-Rodríguez A 2014
ALDH18A1 aldehyde dehydrogenase 18 family, member A1 5832 P54886 ChIP-chip
Subtil-Rodríguez A 2014
ALG10 ALG10, alpha-1,2-glucosyltransferase 84920 Q5BKT4 ChIP-chip
Subtil-Rodríguez A 2014
ALG10B ALG10B, alpha-1,2-glucosyltransferase 144245 Q5I7T1 ChIP-chip
Subtil-Rodríguez A 2014
ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit NM_144988 Q96F25 ChIP-chip
Subtil-Rodríguez A 2014
ALG2 ALG2, alpha-1,3/1,6-mannosyltransferase 85365 Q9H553 ChIP-chip
Subtil-Rodríguez A 2014
ALG5 ALG5, dolichyl-phosphate beta-glucosyltransferase 29880 Q9Y673 ChIP-chip
Subtil-Rodríguez A 2014
ALG8 ALG8, alpha-1,3-glucosyltransferase 79053 A6NDW6 ChIP-chip
Subtil-Rodríguez A 2014
ALKBH5 alkB, alkylation repair homolog 5 (E. coli) 54890 Q6P6C2 ChIP-chip
Subtil-Rodríguez A 2014
ALKBH8 alkB, alkylation repair homolog 8 (E. coli) 91801 Q96BT7 ChIP-chip
Subtil-Rodríguez A 2014
ALMS1 Alstrom syndrome 1 7840 Q8TCU4 ChIP-chip
Subtil-Rodríguez A 2014
ALS2 amyotrophic lateral sclerosis 2 (juvenile) NM_001135745 Q96Q42 ChIP-chip
Subtil-Rodríguez A 2014
AMBRA1 autophagy/beclin-1 regulator 1 55626 Q9C0C7 ChIP-chip
Subtil-Rodríguez A 2014
AMHR2 anti-Mullerian hormone receptor, type II 269 Q16671 ChIP-chip
Subtil-Rodríguez A 2014
AMMECR1L AMMECR1-like 83607 Q6DCA0 ChIP-chip
Subtil-Rodríguez A 2014
ANAPC10 anaphase promoting complex subunit 10 10393 Q9UM13 ChIP-chip
Subtil-Rodríguez A 2014
ANAPC13 anaphase promoting complex subunit 13 25847 A8K3Z6 ChIP-chip
Subtil-Rodríguez A 2014
ANAPC5 anaphase promoting complex subunit 5 51433 Q9UJX4 ChIP-chip
Subtil-Rodríguez A 2014
ANAPC7 anaphase promoting complex subunit 7 51434 Q9UJX3 ChIP-chip
Subtil-Rodríguez A 2014
ANG angiogenin, ribonuclease, RNase A family, 5 283 P03950 ChIP-chip
Subtil-Rodríguez A 2014
ANKRD12 ankyrin repeat domain 12 23253 Q6UB98 ChIP-chip
Subtil-Rodríguez A 2014
ANKRD13A ankyrin repeat domain 13A 88455 Q3ZTS7 ChIP-chip
Subtil-Rodríguez A 2014
ANKRD13C ankyrin repeat domain 13C 81573 Q8N6S4 ChIP-chip
Subtil-Rodríguez A 2014
ANKRD17 ankyrin repeat domain 17 26057 O75179 ChIP-chip
Subtil-Rodríguez A 2014
ANKRD32 ankyrin repeat domain 32 84250 I6L9F1 ChIP-chip
Subtil-Rodríguez A 2014
ANKRD34A ankyrin repeat domain 34A NM_001039888 Q69YU3 ChIP-chip
Subtil-Rodríguez A 2014
ANKRD40 ankyrin repeat domain 40 91369 A8IK34 ChIP-chip
Subtil-Rodríguez A 2014
ANKRD42 ankyrin repeat domain 42 NM_182603 Q8N9B4 ChIP-chip
Subtil-Rodríguez A 2014
ANKRD50 ankyrin repeat domain 50 57182 Q8TB46 ChIP-chip
Subtil-Rodríguez A 2014
ANLN anillin, actin binding protein 54443 Q9NQW6 ChIP-chip
Subtil-Rodríguez A 2014
ANP32A acidic (leucine-rich) nuclear phosphoprotein 32 family, member A 8125 P39687 ChIP-chip
Subtil-Rodríguez A 2014
ANP32E acidic (leucine-rich) nuclear phosphoprotein 32 family, member E 81611 Q9BTT0 ChIP-chip
Subtil-Rodríguez A 2014
ANXA2 annexin A2 302 P07355 ChIP-chip
Subtil-Rodríguez A 2014
ANXA7 annexin A7 310 P20073 ChIP-chip
Subtil-Rodríguez A 2014
AP1G1 adaptor-related protein complex 1, gamma 1 subunit 164 O43747 ChIP-chip
Subtil-Rodríguez A 2014
AP1M1 adaptor-related protein complex 1, mu 1 subunit 8907 Q59EK3 ChIP-chip
Subtil-Rodríguez A 2014
AP1S3 adaptor-related protein complex 1, sigma 3 subunit 130340 Q96PC3 ChIP-chip
Subtil-Rodríguez A 2014
AP3B1 adaptor-related protein complex 3, beta 1 subunit 8546 E5RJ68 ChIP-chip
Subtil-Rodríguez A 2014
APBB2 amyloid beta (A4) precursor protein-binding, family B, member 2 323 Q92870 ChIP-chip
Subtil-Rodríguez A 2014
APEH N-acylaminoacyl-peptide hydrolase 327 P13798 ChIP-chip
Subtil-Rodríguez A 2014
APEX1 APEX nuclease (multifunctional DNA repair enzyme) 1 328 P27695 ChIP-chip
Subtil-Rodríguez A 2014
APIP APAF1 interacting protein 51074 Q96GX9 ChIP-chip
Subtil-Rodríguez A 2014
APLP2 amyloid beta (A4) precursor-like protein 2 334 Q06481 ChIP-chip
Subtil-Rodríguez A 2014
APOLD1 apolipoprotein L domain containing 1 81575 Q96LR9 ChIP-chip
Subtil-Rodríguez A 2014
APOO apolipoprotein O NM_024122 Q9BUR5 ChIP-chip
Subtil-Rodríguez A 2014
APP amyloid beta (A4) precursor protein 351 P05067 ChIP-chip
Subtil-Rodríguez A 2014
APPBP2 amyloid beta precursor protein (cytoplasmic tail) binding protein 2 10513 Q92624 ChIP-chip
Subtil-Rodríguez A 2014
APPL1 adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1 26060 Q9UKG1 ChIP-chip
Subtil-Rodríguez A 2014
APTX aprataxin 54840 Q7Z2E3 ChIP-chip
Subtil-Rodríguez A 2014
AR androgen receptor 367 P10275 IP/WB
Menon T 2010
ARAF v-raf murine sarcoma 3611 viral oncogene homolog 369 P10398 ChIP-chip
Subtil-Rodríguez A 2014
ARF4 ADP-ribosylation factor 4 378 P18085 ChIP-chip
Subtil-Rodríguez A 2014
ARF6 ADP-ribosylation factor 6 382 P62330 ChIP-chip
Subtil-Rodríguez A 2014
ARFGAP1 ADP-ribosylation factor GTPase activating protein 1 55738 Q8N6T3 ChIP-chip
Subtil-Rodríguez A 2014
ARFRP1 ADP-ribosylation factor related protein 1 NM_003224 Q13795 ChIP-chip
Subtil-Rodríguez A 2014
ARHGAP11A Rho GTPase activating protein 11A 9824 Q6P4F7 ChIP-chip
Subtil-Rodríguez A 2014
ARHGAP11B Rho GTPase activating protein 11B NM_001039841 Q3KRB8 ChIP-chip
Subtil-Rodríguez A 2014
ARHGAP21 Rho GTPase activating protein 21 57584 Q5T5U3 ChIP-chip
Subtil-Rodríguez A 2014
ARHGAP5 Rho GTPase activating protein 5 394 Q13017 ChIP-chip
Subtil-Rodríguez A 2014
ARHGEF12 Rho guanine nucleotide exchange factor (GEF) 12 23365 B4E2K6 ChIP-chip
Subtil-Rodríguez A 2014
ARID1A AT rich interactive domain 1A (SWI-like) 8289 O14497 ChIP-chip
Subtil-Rodríguez A 2014
ARIH1 ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 (Drosophila) 25820 Q9Y4X5 ChIP-chip
Subtil-Rodríguez A 2014
ARL13B ADP-ribosylation factor-like 13B 200894 Q3SXY8 ChIP-chip
Subtil-Rodríguez A 2014
ARL17P1 ADP-ribosylation factor-like 17A NM_001113738 A8K0M5 ChIP-chip
Subtil-Rodríguez A 2014
ARL3 ADP-ribosylation factor-like 3 NM_004311 P36405 ChIP-chip
Subtil-Rodríguez A 2014
ARL4A ADP-ribosylation factor-like 4A NM_001037164 A0A024R9Z2 ChIP-chip
Subtil-Rodríguez A 2014
ARL5B ADP-ribosylation factor-like 5B 221079 B0YIW9 ChIP-chip
Subtil-Rodríguez A 2014
ARL6 ADP-ribosylation factor-like 6 NM_177976 Q9H0F7 ChIP-chip
Subtil-Rodríguez A 2014
ARL6IP1 ADP-ribosylation factor-like 6 interacting protein 1 23204 Q15041 ChIP-chip
Subtil-Rodríguez A 2014
ARL6IP6 ADP-ribosylation-like factor 6 interacting protein 6 151188 B3KMZ5 ChIP-chip
Subtil-Rodríguez A 2014
ARMC1 armadillo repeat containing 1 55156 Q9NVT9 ChIP-chip
Subtil-Rodríguez A 2014
ARMCX5 armadillo repeat containing, X-linked 5 NM_022838 Q6P1M9 ChIP-chip
Subtil-Rodríguez A 2014
ARPC4 actin related protein 2/3 complex, subunit 4, 20kDa 10093 F6TTL5 ChIP-chip
Subtil-Rodríguez A 2014
ARPC5 actin related protein 2/3 complex, subunit 5, 16kDa 10092 O15511 ChIP-chip
Subtil-Rodríguez A 2014
ARPP19 cAMP-regulated phosphoprotein, 19kDa 10776 P56211 ChIP-chip
Subtil-Rodríguez A 2014
ARRDC3 arrestin domain containing 3 57561 Q96B67 ChIP-chip
Subtil-Rodríguez A 2014
ARSB arylsulfatase B 411 P15848 ChIP-chip
Subtil-Rodríguez A 2014
ARSK arylsulfatase family, member K NM_198150 Q6UWY0 ChIP-chip
Subtil-Rodríguez A 2014
ARV1 ARV1 homolog (S. cerevisiae) 64801 Q9H2C2 ChIP-chip
Subtil-Rodríguez A 2014
ASCC3 activating signal cointegrator 1 complex subunit 3 10973 Q8N3C0 ChIP-chip
Subtil-Rodríguez A 2014
ASF1B ASF1 anti-silencing function 1 homolog B (S. cerevisiae) 55723 Q9NVP2 ChIP-chip
Subtil-Rodríguez A 2014
ASH2L ash2 (absent, small, or homeotic)-like (Drosophila) 9070 Q9UBL3 IP; Bimolecular fluorescence complementation assay; IP/WB; Y2H
Yates JA 2010
ASNA1 arsA arsenite transporter, ATP-binding, homolog 1 (bacterial) NM_004317 O43681 ChIP-chip
Subtil-Rodríguez A 2014
ASPM asp (abnormal spindle) homolog, microcephaly associated (Drosophila) 259266 B3KWI2 ChIP-chip
Subtil-Rodríguez A 2014
ASXL1 additional sex combs like 1 (Drosophila) 171023 Q498B9 ChIP-chip
Subtil-Rodríguez A 2014
ATAD5 ATPase family, AAA domain containing 5 79915 Q96QE3 ChIP-chip
Subtil-Rodríguez A 2014
ATE1 arginyltransferase 1 11101 O95260 ChIP-chip
Subtil-Rodríguez A 2014
ATF1 activating transcription factor 1 466 P18846 ChIP-chip
Subtil-Rodríguez A 2014
ATF6 activating transcription factor 6 22926 A8K383 ChIP-chip
Subtil-Rodríguez A 2014
ATF7 activating transcription factor 7 NM_006856 P17544 ChIP-chip
Subtil-Rodríguez A 2014
ATF7IP activating transcription factor 7 interacting protein 55729 Q6VMQ6 ChIP-chip
Subtil-Rodríguez A 2014
ATG16L1 autophagy related 16-like 1 (S. cerevisiae) 55054 Q53SV2 ChIP-chip
Subtil-Rodríguez A 2014
ATG16L2 autophagy related 16-like 2 (S. cerevisiae) NM_033388 Q8NAA4 ChIP-chip
Subtil-Rodríguez A 2014
ATG4C autophagy related 4C, cysteine peptidase 84938 Q96DT6 ChIP-chip
Subtil-Rodríguez A 2014
ATG5 autophagy related 5 9474 A9UGY9 ChIP-chip
Subtil-Rodríguez A 2014
ATL2 atlastin GTPase 2 64225 Q8NHH9 ChIP-chip
Subtil-Rodríguez A 2014
ATL3 atlastin GTPase 3 25923 Q6DD88 ChIP-chip
Subtil-Rodríguez A 2014
ATM ataxia telangiectasia mutated 472 Q13315 ChIP-chip
Subtil-Rodríguez A 2014
ATN1 atrophin 1 1822 P54259 ChIP-chip
Subtil-Rodríguez A 2014
ATP10D CYFIP1 57205 Q9P241 ChIP-chip
Subtil-Rodríguez A 2014
ATP11A ATPase, class VI, type 11A 23250 P98196 ChIP-chip
Subtil-Rodríguez A 2014
ATP11B ATPase, class VI, type 11B 23200 B4DKX1 ChIP-chip
Subtil-Rodríguez A 2014
ATP1A1 ATPase, Na+/K+ transporting, alpha 1 polypeptide 476 P05023 ChIP-chip
Subtil-Rodríguez A 2014
ATP2A1 ATPase, Ca++ transporting, cardiac muscle, fast twitch 1 487 O14983 ChIP-chip
Subtil-Rodríguez A 2014
ATP5A1 ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle 498 P25705 ChIP-chip
Subtil-Rodríguez A 2014
ATP5B ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide 506 P06576 ChIP-chip
Subtil-Rodríguez A 2014
ATP5E ATP synthase, H+ transporting, mitochondrial F1 complex, epsilon subunit NM_006886 P56381 ChIP-chip
Subtil-Rodríguez A 2014
ATP5F1 ATP synthase, H+ transporting, mitochondrial Fo complex, subunit B1 515 P24539 ChIP-chip
Subtil-Rodríguez A 2014
ATP5G1 ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C1 (subunit 9) 516 P05496 ChIP-chip
Subtil-Rodríguez A 2014
ATP5G2 ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C2 (subunit 9) 517 Q06055 ChIP-chip
Subtil-Rodríguez A 2014
ATP5I ATP synthase, H+ transporting, mitochondrial Fo complex, subunit E 521 P56385 ChIP-chip
Subtil-Rodríguez A 2014
ATP5J ATP synthase, H+ transporting, mitochondrial Fo complex, subunit F6 522 P18859 ChIP-chip
Subtil-Rodríguez A 2014
ATP6V0D1 ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d1 NM_004691 P61421 ChIP-chip
Subtil-Rodríguez A 2014
ATP6V1A ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A 523 P38606 ChIP-chip
Subtil-Rodríguez A 2014
ATP6V1G1 ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G1 9550 O75348 ChIP-chip
Subtil-Rodríguez A 2014
ATPAF2 ATP synthase mitochondrial F1 complex assembly factor 2 NM_145691 Q8N5M1 ChIP-chip
Subtil-Rodríguez A 2014
ATPBD4 diphthamine biosynthesis 6 NM_001141972 Q7L8W6 ChIP-chip
Subtil-Rodríguez A 2014
ATR ataxia telangiectasia and Rad3 related 545 Q13535 ChIP-chip
Subtil-Rodríguez A 2014
ATXN2L ataxin 2-like 11273 Q8WWM7 ChIP-chip
Subtil-Rodríguez A 2014
AUP1 ancient ubiquitous protein 1 550 Q9Y679 ChIP-chip
Subtil-Rodríguez A 2014
AXIN2 axin 2 8313 Q9Y2T1 ChIP-qPCR; Bimolecular fluorescence complementation assay; IP/WB; Y2H
Thompson BA 2008
AZIN1 antizyme inhibitor 1 51582 O14977 ChIP-chip
Subtil-Rodríguez A 2014
B2M beta-2-microglobulin NM_004048 P61769 ChIP-chip
Subtil-Rodríguez A 2014
B3GALNT2 beta-1,3-N-acetylgalactosaminyltransferase 2 148789 Q8NCR0 ChIP-chip
Subtil-Rodríguez A 2014
B4GALT7 DNM1L 11285 Q9UBV7 ChIP-chip
Subtil-Rodríguez A 2014
B9D1 B9 protein domain 1 NM_015681 B4DN64 ChIP-chip
Subtil-Rodríguez A 2014
BACH2 BTB and CNC homology 1, basic leucine zipper transcription factor 2 60468 Q9BYV9 ChIP-chip
Subtil-Rodríguez A 2014
BAG2 BCL2-associated athanogene 2 9532 O95816 ChIP-chip
Subtil-Rodríguez A 2014
BAHCC1 DPP6 57597 Q9P281 ChIP-chip
Subtil-Rodríguez A 2014
BANP BTG3 associated nuclear protein 54971 B3KM38 ChIP-chip
Subtil-Rodríguez A 2014
BAP1 BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase) 8314 Q92560 ChIP-chip
Subtil-Rodríguez A 2014
BAT1 DEAD (Asp-Glu-Ala-Asp) box polypeptide 39B NM_080598 A0A024RCM3 ChIP-chip
Subtil-Rodríguez A 2014
BAT2 proline-rich coiled-coil 2A 7916 P48634 ChIP-chip
Subtil-Rodríguez A 2014
BAT2L proline-rich coiled-coil 2B NM_013318 Q5JSZ5 ChIP-chip
Subtil-Rodríguez A 2014
BAT3 BCL2-associated athanogene 6 7917 P46379 ChIP-chip
Subtil-Rodríguez A 2014
BAT4 G patch domain and ankyrin repeats 1 NM_033177 A0A024RCU2 ChIP-chip
Subtil-Rodríguez A 2014
BAT5 DUSP22 7920 B3KNX9 ChIP-chip
Subtil-Rodríguez A 2014
BBS10 Bardet-Biedl syndrome 10 79738 Q8TAM1 ChIP-chip
Subtil-Rodríguez A 2014
BBS4 Bardet-Biedl syndrome 4 585 Q96RK4 ChIP-chip
Subtil-Rodríguez A 2014
BBS5 Bardet-Biedl syndrome 5 129880 Q8N3I7 ChIP-chip
Subtil-Rodríguez A 2014
BBX bobby sox homolog (Drosophila) 56987 A8K6U2 ChIP-chip
Subtil-Rodríguez A 2014
BCAS2 breast carcinoma amplified sequence 2 10286 B2R7W3 ChIP-chip
Subtil-Rodríguez A 2014
BCAS4 breast carcinoma amplified sequence 4 NM_017843 H7BXG3 ChIP-chip
Subtil-Rodríguez A 2014
BCAT1 branched chain amino-acid transaminase 1, cytosolic 586 P54687 ChIP-chip
Subtil-Rodríguez A 2014
BCCIP BRCA2 and CDKN1A interacting protein 56647 Q9P287 ChIP-chip
Subtil-Rodríguez A 2014
BCL2 B-cell CLL/lymphoma 2 596 P10415 ChIP-chip
Subtil-Rodríguez A 2014
BCL2L1 BCL2-like 1 598 Q07817 ChIP-chip
Subtil-Rodríguez A 2014
BCL2L12 BCL2-like 12 (proline rich) 83596 Q9HB09 ChIP-chip
Subtil-Rodríguez A 2014
BCL2L13 BCL2-like 13 (apoptosis facilitator) 23786 Q9BXK5 ChIP-chip
Subtil-Rodríguez A 2014
BCR breakpoint cluster region 613 P11274 ChIP-chip
Subtil-Rodríguez A 2014
BFAR bifunctional apoptosis regulator 51283 Q9NZS9 ChIP-chip
Subtil-Rodríguez A 2014
BHLHE41 basic helix-loop-helix family, member e41 79365 Q8TAT1 ChIP-chip
Subtil-Rodríguez A 2014
BLK Tyrosine-protein kinase Blk 640 P51451 ChIP-chip
Subtil-Rodríguez A 2014
BLZF1 basic leucine zipper nuclear factor 1 8548 Q9H2G9 ChIP-chip
Subtil-Rodríguez A 2014
BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) 659 Q13873 ChIP-chip
Subtil-Rodríguez A 2014
BMS1 BMS1 homolog, ribosome assembly protein (yeast) 9790 Q14692 ChIP-chip
Subtil-Rodríguez A 2014
BMS1P4 BMS1 pseudogene 4 NR_026592 ChIP-chip
Subtil-Rodríguez A 2014
BMS1P5 BMS1 pseudogene 5 NR_003611 ChIP-chip
Subtil-Rodríguez A 2014
BNC2 basonuclin 2 54796 Q6ZN30 ChIP-chip
Subtil-Rodríguez A 2014
BNIP1 BCL2/adenovirus E1B 19kDa interacting protein 1 NM_013980 Q12981 ChIP-chip
Subtil-Rodríguez A 2014
BNIP2 BCL2/adenovirus E1B 19kDa interacting protein 2 663 J3KN59 ChIP-chip
Subtil-Rodríguez A 2014
BOD1 biorientation of chromosomes in cell division 1 91272 Q96IK1 ChIP-chip
Subtil-Rodríguez A 2014
BOD1L biorientation of chromosomes in cell division 1-like 1 259282 Q8NFC6 ChIP-chip
Subtil-Rodríguez A 2014
BOLA3 bolA homolog 3 (E. coli) 388962 Q53S33 ChIP-chip
Subtil-Rodríguez A 2014
BPGM 2,3-bisphosphoglycerate mutase 669 P07738 ChIP-chip
Subtil-Rodríguez A 2014
BPNT1 3'(2'), 5'-bisphosphate nucleotidase 1 NM_006085 O95861 ChIP-chip
Subtil-Rodríguez A 2014
BRAF Serine/threonine-protein kinase B-raf 673 P15056 ChIP-chip
Subtil-Rodríguez A 2014
BRCA1 breast cancer 1, early onset 672 P38398 ChIP; Bimolecular fluorescence complementation assay; IP/WB; Y2H
Ishihara K 2006
BRD2 bromodomain containing 2 6046 P25440 ChIP-chip
Subtil-Rodríguez A 2014
BRD8 bromodomain containing 8 10902 Q9H0E9 ChIP-chip
Subtil-Rodríguez A 2014
BRF2 BRF2, subunit of RNA polymerase III transcription initiation factor, BRF1-like 55290 Q9HAW0 ChIP-chip
Subtil-Rodríguez A 2014
BRIX1 BRX1, biogenesis of ribosomes, homolog (S. cerevisiae) 55299 Q8TDN6 ChIP-chip
Subtil-Rodríguez A 2014
BRMS1 breast cancer metastasis suppressor 1 25855 G5E9I4 ChIP-chip
Subtil-Rodríguez A 2014
BRP44 mitochondrial pyruvate carrier 2 NM_015415 A0A024R8Z5 ChIP-chip
Subtil-Rodríguez A 2014
BSCL2 Berardinelli-Seip congenital lipodystrophy 2 (seipin) NM_001130702 A0A024R540 ChIP-chip
Subtil-Rodríguez A 2014
BTAF1 BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa (Mot1 homolog, S. cerevisiae) 9044 O14981 ChIP-chip
Subtil-Rodríguez A 2014
BTBD1 BTB (POZ) domain containing 1 53339 Q9H0C5 ChIP-chip
Subtil-Rodríguez A 2014
BTBD2 BTB (POZ) domain containing 2 55643 Q9BX70 ChIP-chip
Subtil-Rodríguez A 2014
BTF3 basic transcription factor 3 689 P20290 ChIP-chip
Subtil-Rodríguez A 2014
BTF3L4 basic transcription factor 3-like 4 91408 Q96K17 ChIP-chip
Subtil-Rodríguez A 2014
BTG3 BTG family, member 3 10950 Q14201 ChIP-chip
Subtil-Rodríguez A 2014
BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 8945 B2R8L3 ChIP-chip
Subtil-Rodríguez A 2014
C10orf104 anaphase promoting complex subunit 16 NM_173473 C5H3H2 ChIP-chip
Subtil-Rodríguez A 2014
C10orf114 cancer susceptibility candidate 10 NM_001010911 Q5T4H9 ChIP-chip
Subtil-Rodríguez A 2014
C10orf119 minichromosome maintenance complex binding protein NM_024834 Q9BTE3 ChIP-chip
Subtil-Rodríguez A 2014
C10orf137 chromosome 10 open reading frame 137 26098 Q3B7T1 ChIP-chip
Subtil-Rodríguez A 2014
C10orf140 chromosome 10 open reading frame 140 387640 Q1XH10 ChIP-chip
Subtil-Rodríguez A 2014
C10orf2 chromosome 10 open reading frame 2 56652 Q96RR1 ChIP-chip
Subtil-Rodríguez A 2014
C10orf28 R3H domain and coiled-coil containing 1-like 27291 D3DR60 ChIP-chip
Subtil-Rodríguez A 2014
C10orf4 fragile site, folic acid type, rare, fra(10)(q23.3) or fra(10)(q24.2) candidate 1 NM_145246 Q70Z53 ChIP-chip
Subtil-Rodríguez A 2014
C10orf57 transmembrane protein 254 NM_025125 B4DU43 ChIP-chip
Subtil-Rodríguez A 2014
C10orf78 SWI5-dependent recombination repair 1 NM_145247 Q86XK3 ChIP-chip
Subtil-Rodríguez A 2014
C11orf10 transmembrane protein 258 NM_014206 P61165 ChIP-chip
Subtil-Rodríguez A 2014
C11orf30 chromosome 11 open reading frame 30 56946 Q7Z589 ChIP-chip
Subtil-Rodríguez A 2014
C11orf46 ADP-ribosylation factor-like 14 effector protein 120534 Q8N8R7 ChIP-chip
Subtil-Rodríguez A 2014
C11orf48 chromosome 11 open reading frame 48 79081 Q9BQE6 ChIP-chip
Subtil-Rodríguez A 2014
C11orf58 chromosome 11 open reading frame 58 10944 O00193 ChIP-chip
Subtil-Rodríguez A 2014
C11orf59 late endosomal/lysosomal adaptor, MAPK and MTOR activator 1 NM_017907 Q6IAA8 ChIP-chip
Subtil-Rodríguez A 2014
C11orf82 chromosome 11 open reading frame 82 220042 Q8IXT1 ChIP-chip
Subtil-Rodríguez A 2014
C12orf10 chromosome 12 open reading frame 10 60314 Q86UA3 ChIP-chip
Subtil-Rodríguez A 2014
C12orf30 N(alpha)-acetyltransferase 25, NatB auxiliary subunit NM_024953 Q14CX7 ChIP-chip
Subtil-Rodríguez A 2014
C12orf57 chromosome 12 open reading frame 57 113246 Q99622 ChIP-chip
Subtil-Rodríguez A 2014
C12orf65 chromosome 12 open reading frame 65 91574 Q9H3J6 ChIP-chip
Subtil-Rodríguez A 2014
C12orf72 methyltransferase like 20 NM_173802 Q8IXQ9 ChIP-chip
Subtil-Rodríguez A 2014
C13orf23 proline and serine rich 1 NM_025138 Q86XN7 ChIP-chip
Subtil-Rodríguez A 2014
C14orf101 transmembrane protein 260 NM_017799 B3KN73 ChIP-chip
Subtil-Rodríguez A 2014
C14orf106 MIS18 binding protein 1 NM_018353 Q6P0N0 ChIP-chip
Subtil-Rodríguez A 2014
C14orf119 chromosome 14 open reading frame 119 NM_017924 Q9NWQ9 ChIP-chip
Subtil-Rodríguez A 2014
C14orf135 chromosome 14 open reading frame 135 64430 Q63HM2 ChIP-chip
Subtil-Rodríguez A 2014
C14orf178 chromosome 14 open reading frame 178 NM_174943 F8WAD5 ChIP-chip
Subtil-Rodríguez A 2014
C14orf181 NM_207442 ChIP-chip
Subtil-Rodríguez A 2014
C14orf33 KTN1 antisense RNA 1 NR_027123 Q86SY8 ChIP-chip
Subtil-Rodríguez A 2014
C14orf93 chromosome 14 open reading frame 93 NM_001130706 Q9H972 ChIP-chip
Subtil-Rodríguez A 2014
C15orf23 kinetochore-localized astrin/SPAG5 binding protein 90417 Q9Y448 ChIP-chip
Subtil-Rodríguez A 2014
C15orf33 family with sequence similarity 227, member B NM_152647 Q96M60 ChIP-chip
Subtil-Rodríguez A 2014
C16orf45 chromosome 16 open reading frame 45 NM_033201 Q96MC5 ChIP-chip
Subtil-Rodríguez A 2014
C16orf58 chromosome 16 open reading frame 58 64755 Q96GQ5 ChIP-chip
Subtil-Rodríguez A 2014
C16orf61 C-x(9)-C motif containing 2 NM_020188 Q9NRP2 ChIP-chip
Subtil-Rodríguez A 2014
C16orf62 chromosome 16 open reading frame 62 57020 E7EWW0 ChIP-chip
Subtil-Rodríguez A 2014
C16orf7 VPS9 domain containing 1 NM_004913 Q9Y2B5 ChIP-chip
Subtil-Rodríguez A 2014
C16orf72 chromosome 16 open reading frame 72 29035 Q14CZ0 ChIP-chip
Subtil-Rodríguez A 2014
C16orf80 chromosome 16 open reading frame 80 29105 Q9Y6A4 ChIP-chip
Subtil-Rodríguez A 2014
C16orf88 chromosome 16 open reading frame 88 400506 Q1ED39 ChIP-chip
Subtil-Rodríguez A 2014
C17orf59 chromosome 17 open reading frame 59 NM_017622 Q96GS4 ChIP-chip
Subtil-Rodríguez A 2014
C17orf70 chromosome 17 open reading frame 70 80233 A4ZI32 ChIP-chip
Subtil-Rodríguez A 2014
C17orf90 oxidoreductase-like domain containing 1 339229 Q5BKU9 ChIP-chip
Subtil-Rodríguez A 2014
C18orf25 chromosome 18 open reading frame 25 147339 Q96B23 ChIP-chip
Subtil-Rodríguez A 2014
C18orf32 chromosome 18 open reading frame 32 497661 Q8TCD1 ChIP-chip
Subtil-Rodríguez A 2014
C18orf54 chromosome 18 open reading frame 54 162681 I7GY12 ChIP-chip
Subtil-Rodríguez A 2014
C18orf55 translocase of inner mitochondrial membrane 21 homolog (yeast) 29090 A8K1K8 ChIP-chip
Subtil-Rodríguez A 2014
C19orf12 chromosome 19 open reading frame 12 83636 Q9NSK7 ChIP-chip
Subtil-Rodríguez A 2014
C19orf2 URI1, prefoldin-like chaperone 8725 O94763 ChIP-chip
Subtil-Rodríguez A 2014
C19orf39 SWIM-type zinc finger 7 associated protein 1 NM_175871 Q6NVH7 ChIP-chip
Subtil-Rodríguez A 2014
C19orf48 chromosome 19 open reading frame 48 84798 Q6RUI8 ChIP-chip
Subtil-Rodríguez A 2014
C19orf54 chromosome 19 open reading frame 54 284325 Q5BKX5 ChIP-chip
Subtil-Rodríguez A 2014
C19orf55 chromosome 19 open reading frame 55 148137 Q2NL68 ChIP-chip
Subtil-Rodríguez A 2014
C19orf61 SMG9 nonsense mediated mRNA decay factor NM_019108 A0A024R0Q0 ChIP-chip
Subtil-Rodríguez A 2014
C19orf62 BRISC and BRCA1 A complex member 1 NM_014173 A0A024R7L2 ChIP-chip
Subtil-Rodríguez A 2014
C19orf76 adrenomedullin 5 (putative) NM_001101340 C9JUS6 ChIP-chip
Subtil-Rodríguez A 2014
C1orf107 digestive organ expansion factor homolog (zebrafish) NM_014388 Q68CQ4 ChIP-chip
Subtil-Rodríguez A 2014
C1orf109 chromosome 1 open reading frame 109 54955 Q9NX04 ChIP-chip
Subtil-Rodríguez A 2014
C1orf112 chromosome 1 open reading frame 112 55732 Q9NSG2 ChIP-chip
Subtil-Rodríguez A 2014
C1orf151 mitochondrial inner membrane organizing system 1 NM_001032363 Q5TGZ0 ChIP-chip
Subtil-Rodríguez A 2014
C1orf156 methyltransferase like 18 NM_033418 A0A024R8Y7 ChIP-chip
Subtil-Rodríguez A 2014
C1orf182 TSSK6 activating co-chaperone NM_144627 Q96A04 ChIP-chip
Subtil-Rodríguez A 2014
C1orf213 chromosome 1 open reading frame 213 148898 Q8NC38 ChIP-chip
Subtil-Rodríguez A 2014
C1orf231 coiled-coil domain containing 163, pseudogene NM_001102601 ChIP-chip
Subtil-Rodríguez A 2014
C1orf27 chromosome 1 open reading frame 27 54953 Q5SWX8 ChIP-chip
Subtil-Rodríguez A 2014
C1orf43 chromosome 1 open reading frame 43 25912 Q9BWL3 ChIP-chip
Subtil-Rodríguez A 2014
C1orf52 chromosome 1 open reading frame 52 148423 Q8N6N3 ChIP-chip
Subtil-Rodríguez A 2014
C1orf55 SDE2 telomere maintenance homolog (S. pombe) NM_152608 Q6IQ49 ChIP-chip
Subtil-Rodríguez A 2014
C1orf71 consortin, connexin sorting protein NM_001139459 Q6PJW8 ChIP-chip
Subtil-Rodríguez A 2014
C1orf83 transcription elongation factor A (SII) N-terminal and central domain containing 2 NM_153035 Q96MN5 ChIP-chip
Subtil-Rodríguez A 2014
C1orf9 SUN domain containing ossification factor 51430 Q9UBS9 ChIP-chip
Subtil-Rodríguez A 2014
C1orf96 centriole, cilia and spindle-associated protein 126731 Q6IQ19 ChIP-chip
Subtil-Rodríguez A 2014
C1orf97 long intergenic non-protein coding RNA 467 NR_026761 Q9BRT7 ChIP-chip
Subtil-Rodríguez A 2014
C1QBP complement component 1, q subcomponent binding protein 708 Q07021 ChIP-chip
Subtil-Rodríguez A 2014
C20orf199 ZNFX1 antisense RNA 1 NR_003604 ChIP-chip
Subtil-Rodríguez A 2014
C20orf24 chromosome 20 open reading frame 24 55969 Q9BUV8 ChIP-chip
Subtil-Rodríguez A 2014
C20orf29 adaptor-related protein complex 5, sigma 1 subunit 55317 Q9NUS5 ChIP-chip
Subtil-Rodríguez A 2014
C20orf3 adipocyte plasma membrane associated protein 57136 Q9HDC9 ChIP-chip
Subtil-Rodríguez A 2014
C20orf30 transmembrane protein 230 NM_014145 Q96A57 ChIP-chip
Subtil-Rodríguez A 2014
C20orf4 AAR2 splicing factor homolog (S. cerevisiae) 25980 Q9Y312 ChIP-chip
Subtil-Rodríguez A 2014
C20orf72 mitochondrial genome maintenance exonuclease 1 92667 Q9BQP7 ChIP-chip
Subtil-Rodríguez A 2014
C20orf94 SLX4 interacting protein 128710 Q5VYV7 ChIP-chip
Subtil-Rodríguez A 2014
C21orf2 chromosome 21 open reading frame 2 NM_004928 O43822 ChIP-chip
Subtil-Rodríguez A 2014
C21orf34 mir-99a-let-7c cluster host gene (non-protein coding) NR_027790 A1L4M7 ChIP-chip
Subtil-Rodríguez A 2014
C21orf45 MIS18 kinetochore protein A NM_018944 Q9NYP9 ChIP-chip
Subtil-Rodríguez A 2014
C21orf57 ybeY metallopeptidase (putative) NM_001006114 Q8TBC8 ChIP-chip
Subtil-Rodríguez A 2014
C21orf91 chromosome 21 open reading frame 91 54149 Q68DA1 ChIP-chip
Subtil-Rodríguez A 2014
C22orf28 chromosome 22 open reading frame 28 51493 Q9Y3I0 ChIP-chip
Subtil-Rodríguez A 2014
C22orf32 single-pass membrane protein with aspartate-rich tail 1 NM_033318 Q9H4I9 ChIP-chip
Subtil-Rodríguez A 2014
C2orf28 all-trans retinoic acid-induced differentiation factor 51374 Q6UW56 ChIP-chip
Subtil-Rodríguez A 2014
C2orf29 CCR4-NOT transcription complex, subunit 11 55571 Q9UKZ1 ChIP-chip
Subtil-Rodríguez A 2014
C2orf3 GC-rich sequence DNA-binding factor 2 6936 A4UHR0 ChIP-chip
Subtil-Rodríguez A 2014
C2orf34 calmodulin-lysine N-methyltransferase NM_024766 Q7Z624 ChIP-chip
Subtil-Rodríguez A 2014
C2orf42 chromosome 2 open reading frame 42 NM_017880 Q9NWW7 ChIP-chip
Subtil-Rodríguez A 2014
C2orf43 chromosome 2 open reading frame 43 60526 Q9H6V9 ChIP-chip
Subtil-Rodríguez A 2014
C2orf52 long intergenic non-protein coding RNA 471 NR_024079 ChIP-chip
Subtil-Rodríguez A 2014
C2orf64 cytochrome c oxidase assembly factor 5 NM_001008215 Q86WW8 ChIP-chip
Subtil-Rodríguez A 2014
C2orf69 chromosome 2 open reading frame 69 205327 Q8N8R5 ChIP-chip
Subtil-Rodríguez A 2014
C2orf79 peptidyl-tRNA hydrolase domain containing 1 NM_001013663 Q6GMV3 ChIP-chip
Subtil-Rodríguez A 2014
C2orf86 WD repeat containing planar cell polarity effector NM_015910 O95876 ChIP-chip
Subtil-Rodríguez A 2014
C3orf1 translocase of inner mitochondrial membrane domain containing 1 NM_016589 Q9NPL8 ChIP-chip
Subtil-Rodríguez A 2014
C3orf19 coiled-coil domain containing 174 51244 Q6PII3 ChIP-chip
Subtil-Rodríguez A 2014
C4orf21 chromosome 4 open reading frame 21 55345 B4DSN6 ChIP-chip
Subtil-Rodríguez A 2014
C4orf34 small integral membrane protein 14 201895 Q96QK8 ChIP-chip
Subtil-Rodríguez A 2014
C4orf41 trafficking protein particle complex 11 60684 Q7Z392 ChIP-chip
Subtil-Rodríguez A 2014
C4orf43 translation machinery associated 16 homolog (S. cerevisiae) 55319 Q96EY4 ChIP-chip
Subtil-Rodríguez A 2014
C4orf46 chromosome 4 open reading frame 46 NM_001008393 Q504U0 ChIP-chip
Subtil-Rodríguez A 2014
C5orf15 chromosome 5 open reading frame 15 56951 Q8NC54 ChIP-chip
Subtil-Rodríguez A 2014
C5orf24 chromosome 5 open reading frame 24 134553 Q7Z6I8 ChIP-chip
Subtil-Rodríguez A 2014
C5orf34 chromosome 5 open reading frame 34 375444 Q96MH7 ChIP-chip
Subtil-Rodríguez A 2014
C5orf35 SET domain containing 9 NM_153706 Q8NE22 ChIP-chip
Subtil-Rodríguez A 2014
C5orf36 KIAA0825 NM_173665 Q8IV33 ChIP-chip
Subtil-Rodríguez A 2014
C5orf37 POC5 centriolar protein NM_001099271 Q8NA72 ChIP-chip
Subtil-Rodríguez A 2014
C5orf39 annexin A2 receptor NM_001014279 Q3ZCQ2 ChIP-chip
Subtil-Rodríguez A 2014
C5orf41 CREB3 regulatory factor 153222 Q8IUR6 ChIP-chip
Subtil-Rodríguez A 2014
C5orf44 trafficking protein particle complex 13 NR_003545 A5PLN9 ChIP-chip
Subtil-Rodríguez A 2014
C5orf51 chromosome 5 open reading frame 51 285636 A6NDU8 ChIP-chip
Subtil-Rodríguez A 2014
C6orf115 ABRA C-terminal like NM_021243 Q9P1F3 ChIP-chip
Subtil-Rodríguez A 2014
C6orf120 chromosome 6 open reading frame 120 387263 Q7Z4R8 ChIP-chip
Subtil-Rodríguez A 2014
C6orf129 coiled-coil domain containing 167 NM_138493 Q9P0B6 ChIP-chip
Subtil-Rodríguez A 2014
C6orf142 muscular LMNA-interacting protein NM_138569 Q5VWP3 ChIP-chip
Subtil-Rodríguez A 2014
C6orf145 PX domain containing 1 221749 Q5TGL8 ChIP-chip
Subtil-Rodríguez A 2014
C6orf162 small integral membrane protein 8 57150 Q96KF7 ChIP-chip
Subtil-Rodríguez A 2014
C6orf217 long intergenic non-protein coding RNA 271 NR_026805 P0C7V0 ChIP-chip
Subtil-Rodríguez A 2014
C6orf57 chromosome 6 open reading frame 57 NM_145267 Q5VUM1 ChIP-chip
Subtil-Rodríguez A 2014
C6orf62 chromosome 6 open reading frame 62 81688 Q9GZU0 ChIP-chip
Subtil-Rodríguez A 2014
C7orf30 mitochondrial assembly of ribosomal large subunit 1 115416 Q96EH3 ChIP-chip
Subtil-Rodríguez A 2014
C7orf36 Yae1 domain containing 1 57002 B2RC46 ChIP-chip
Subtil-Rodríguez A 2014
C7orf38 family with sequence similarity 200, member A NM_145111 Q8TCP9 ChIP-chip
Subtil-Rodríguez A 2014
C7orf55 chromosome 7 open reading frame 55 NM_197964 Q96HJ9 ChIP-chip
Subtil-Rodríguez A 2014
C7orf60 chromosome 7 open reading frame 60 154743 Q1RMZ1 ChIP-chip
Subtil-Rodríguez A 2014
C8orf37 chromosome 8 open reading frame 37 NM_177965 F4Y588 ChIP-chip
Subtil-Rodríguez A 2014
C8orf39 RBM12B antisense RNA 1 NR_027259 Q9P1G2 ChIP-chip
Subtil-Rodríguez A 2014
C8orf40 small integral membrane protein 19 114926 Q96E16 ChIP-chip
Subtil-Rodríguez A 2014
C8orf41 TELO2 interacting protein 2 80185 Q6NXR4 ChIP-chip
Subtil-Rodríguez A 2014
C8orf59 chromosome 8 open reading frame 59 NM_001099670 A0A024R838 ChIP-chip
Subtil-Rodríguez A 2014
C9orf130 long intergenic non-protein coding RNA 476 NR_023389 Q8WZB0 ChIP-chip
Subtil-Rodríguez A 2014
C9orf156 chromosome 9 open reading frame 156 51531 Q9BU70 ChIP-chip
Subtil-Rodríguez A 2014
C9orf30 chromosome 9 open reading frame 30 91283 Q96H12 ChIP-chip
Subtil-Rodríguez A 2014
C9orf40 chromosome 9 open reading frame 40 55071 Q8IXQ3 ChIP-chip
Subtil-Rodríguez A 2014
C9orf41 chromosome 9 open reading frame 41 138199 Q8N4J0 ChIP-chip
Subtil-Rodríguez A 2014
C9orf5 transmembrane protein 245 23731 Q9H330 ChIP-chip
Subtil-Rodríguez A 2014
C9orf78 chromosome 9 open reading frame 78 51759 Q9NZ63 ChIP-chip
Subtil-Rodríguez A 2014
C9orf82 caspase activity and apoptosis inhibitor 1 79886 Q9H8G2 ChIP-chip
Subtil-Rodríguez A 2014
C9orf86 RAB, member RAS oncogene family-like 6 55684 Q3YEC7 ChIP-chip
Subtil-Rodríguez A 2014
CA11 carbonic anhydrase XI NM_001217 O75493 ChIP-chip
Subtil-Rodríguez A 2014
CACYBP calcyclin binding protein 27101 B3KSF1 ChIP-chip
Subtil-Rodríguez A 2014
CALM1 calmodulin 1 (phosphorylase kinase, delta) 801 P62158 ChIP-chip
Subtil-Rodríguez A 2014
CALM2 calmodulin 2 (phosphorylase kinase, delta) 805 B4DJ51 ChIP-chip
Subtil-Rodríguez A 2014
CALR calreticulin 811 P27797 ChIP-chip
Subtil-Rodríguez A 2014
CALU calumenin 813 D6QS54 ChIP-chip
Subtil-Rodríguez A 2014
CAMSAP1L1 calmodulin regulated spectrin-associated protein family, member 2 23271 B3KTI4 ChIP-chip
Subtil-Rodríguez A 2014
CAND1 cullin-associated and neddylation-dissociated 1 55832 Q86VP6 ChIP-chip
Subtil-Rodríguez A 2014
CANX calnexin 821 P27824 ChIP-chip
Subtil-Rodríguez A 2014
CAPRIN2 caprin family member 2 65981 Q6IMN6 ChIP-chip
Subtil-Rodríguez A 2014
CAPZA1 capping protein (actin filament) muscle Z-line, alpha 1 829 P52907 ChIP-chip
Subtil-Rodríguez A 2014
CAPZA2 capping protein (actin filament) muscle Z-line, alpha 2 830 A4D0V4 ChIP-chip
Subtil-Rodríguez A 2014
CARD8 caspase recruitment domain family, member 8 22900 B5KVR6 ChIP-chip
Subtil-Rodríguez A 2014
CARS2 cysteinyl-tRNA synthetase 2, mitochondrial (putative) 79587 B7Z7E6 ChIP-chip
Subtil-Rodríguez A 2014
CASC3 cancer susceptibility candidate 3 22794 O15234 ChIP-chip
Subtil-Rodríguez A 2014
CASC4 cancer susceptibility candidate 4 113201 Q6P4E1 ChIP-chip
Subtil-Rodríguez A 2014
CASC5 cancer susceptibility candidate 5 57082 Q8NG31 ChIP-chip
Subtil-Rodríguez A 2014
CASD1 CAS1 domain containing 1 NM_022900 Q8WZ77 ChIP-chip
Subtil-Rodríguez A 2014
CASP2 caspase 2, apoptosis-related cysteine peptidase 835 D3DXD9 ChIP-chip
Subtil-Rodríguez A 2014
CASP8AP2 caspase 8 associated protein 2 NM_012115 Q9UKL3 ChIP-chip
Subtil-Rodríguez A 2014
CBLL1 Cbl proto-oncogene, E3 ubiquitin protein ligase-like 1 79872 B4DDV7 ChIP-chip
Subtil-Rodríguez A 2014
CBWD2 COBW domain containing 2 150472 Q8IUF1 ChIP-chip
Subtil-Rodríguez A 2014
CBX4 chromobox homolog 4 8535 O00257 ChIP-chip
Subtil-Rodríguez A 2014
CBX5 chromobox homolog 5 23468 P45973 ChIP-chip
Subtil-Rodríguez A 2014
CBX6 chromobox homolog 6 23466 O95503 ChIP-chip
Subtil-Rodríguez A 2014
CBX8 chromobox homolog 8 57332 Q9HC52 ChIP-chip
Subtil-Rodríguez A 2014
CCAR1 cell division cycle and apoptosis regulator 1 55749 Q8IX12 ChIP-chip
Subtil-Rodríguez A 2014
CCDC102B coiled-coil domain containing 102B NM_001093729 A1A4H1 ChIP-chip
Subtil-Rodríguez A 2014
CCDC106 coiled-coil domain containing 106 29903 Q9BWC9 ChIP-chip
Subtil-Rodríguez A 2014
CCDC109A mitochondrial calcium uniporter NM_138357 Q8NE86 ChIP-chip
Subtil-Rodríguez A 2014
CCDC137 coiled-coil domain containing 137 339230 Q6PK04 ChIP-chip
Subtil-Rodríguez A 2014
CCDC18 coiled-coil domain containing 18 343099 E9PFB9 ChIP-chip
Subtil-Rodríguez A 2014
CCDC21 centrosomal protein 85kDa NM_022778 Q6P2H3 ChIP-chip
Subtil-Rodríguez A 2014
CCDC45 centrosomal protein 95kDa NM_138363 Q96GE4 ChIP-chip
Subtil-Rodríguez A 2014
CCDC47 coiled-coil domain containing 47 57003 Q96A33 ChIP-chip
Subtil-Rodríguez A 2014
CCDC49 CWC25 spliceosome-associated protein homolog (S. cerevisiae) NM_017748 Q9NXE8 ChIP-chip
Subtil-Rodríguez A 2014
CCDC55 nuclear speckle splicing regulatory protein 1 NM_032141 A0A024QZ33 ChIP-chip
Subtil-Rodríguez A 2014
CCDC56 coiled-coil domain containing 56 28958 Q9Y2R0 ChIP-chip
Subtil-Rodríguez A 2014
CCDC58 coiled-coil domain containing 58 NM_001017928 Q4VC31 ChIP-chip
Subtil-Rodríguez A 2014
CCDC6 coiled-coil domain containing 6 8030 Q05CP8 ChIP-chip
Subtil-Rodríguez A 2014
CCDC66 coiled-coil domain containing 66 285331 A2RUB6 ChIP-chip
Subtil-Rodríguez A 2014
CCDC76 tRNA methyltransferase 13 homolog (S. cerevisiae) NM_019083 Q9NUP7 ChIP-chip
Subtil-Rodríguez A 2014
CCDC83 coiled-coil domain containing 83 NM_173556 Q8IWF9 ChIP-chip
Subtil-Rodríguez A 2014
CCDC84 coiled-coil domain containing 84 NM_198489 Q86UT8 ChIP-chip
Subtil-Rodríguez A 2014
CCDC88A coiled-coil domain containing 88A 55704 Q3V6T2 ChIP-chip
Subtil-Rodríguez A 2014
CCDC90B coiled-coil domain containing 90B 60492 Q9GZT6 ChIP-chip
Subtil-Rodríguez A 2014
CCDC97 coiled-coil domain containing 97 90324 Q96F63 ChIP-chip
Subtil-Rodríguez A 2014
CCM2 cerebral cavernous malformation 2 83605 Q9BSQ5 ChIP-chip
Subtil-Rodríguez A 2014
CCNA2 cyclin A2 890 P20248 ChIP-chip
Subtil-Rodríguez A 2014
CCNI cyclin I 10983 Q14094 ChIP-chip
Subtil-Rodríguez A 2014
CCNL1 cyclin L1 57018 Q9UK58 ChIP-chip
Subtil-Rodríguez A 2014
CCNT1 cyclin T1 904 O60563 ChIP-chip
Subtil-Rodríguez A 2014
CCNT2 cyclin T2 905 B4DH21 ChIP-chip
Subtil-Rodríguez A 2014
CCPG1 HUWE1 9236 Q9ULG6 ChIP-chip
Subtil-Rodríguez A 2014
CCT2 chaperonin containing TCP1, subunit 2 (beta) 10576 P78371 ChIP-chip
Subtil-Rodríguez A 2014
CCT4 chaperonin containing TCP1, subunit 4 (delta) 10575 P50991 ChIP-chip
Subtil-Rodríguez A 2014
CCT7 chaperonin containing TCP1, subunit 7 (eta) 10574 Q99832 ChIP-chip
Subtil-Rodríguez A 2014
CD164 CD164 molecule, sialomucin 8763 Q04900 ChIP-chip
Subtil-Rodríguez A 2014
CD3EAP CD3e molecule, epsilon associated protein 10849 O15446 ChIP-chip
Subtil-Rodríguez A 2014
CD47 CD47 molecule 961 Q08722 ChIP-chip
Subtil-Rodríguez A 2014
CDC14A cell division cycle 14A NM_033313 Q59EF4 ChIP-chip
Subtil-Rodríguez A 2014
CDC20 cell division cycle 20 991 Q12834 ChIP-chip
Subtil-Rodríguez A 2014
CDC27 cell division cycle 27 996 G3V1C4 ChIP-chip
Subtil-Rodríguez A 2014
CDC2L5 cyclin-dependent kinase 13 NM_003718 A0A024RA85 ChIP-chip
Subtil-Rodríguez A 2014
CDC45L cell division cycle 45 NM_003504 O75419 ChIP-chip
Subtil-Rodríguez A 2014
CDC6 cell division cycle 6 homolog (S. cerevisiae) 990 Q99741 ChIP-chip
Subtil-Rodríguez A 2014
CDC7 cell division cycle 7 8317 O00311 ChIP-chip
Subtil-Rodríguez A 2014
CDC73 cell division cycle 73 79577 Q6P1J9 ChIP-chip
Subtil-Rodríguez A 2014
CDK5RAP2 CDK5 regulatory subunit associated protein 2 55755 B3KVI2 ChIP-chip
Subtil-Rodríguez A 2014
CDK7 cyclin-dependent kinase 7 1022 P50613 ChIP-chip
Subtil-Rodríguez A 2014
CDK8 cyclin-dependent kinase 8 1024 P49336 ChIP-chip
Subtil-Rodríguez A 2014
CDK9 cyclin-dependent kinase 9 1025 P50750 ChIP-chip
Subtil-Rodríguez A 2014
CDKAL1 CDK5 regulatory subunit associated protein 1-like 1 54901 Q5VV42 ChIP-chip
Subtil-Rodríguez A 2014
CDKN1B cyclin-dependent kinase inhibitor 1B (p27, Kip1) 1027 P46527 ChIP-chip
Subtil-Rodríguez A 2014
CDKN2B cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4) 1030 P42772 ChIP-chip
Subtil-Rodríguez A 2014
CDKN2BAS CDKN2B antisense RNA 1 NR_003529 ChIP-chip
Subtil-Rodríguez A 2014
CDKN2C cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4) 1031 P42773 ChIP-chip
Subtil-Rodríguez A 2014
CDV3 CDV3 homolog (mouse) 55573 Q9UKY7 ChIP-chip
Subtil-Rodríguez A 2014
CEBPD CCAAT/enhancer binding protein (C/EBP), delta NM_005195 P49716 ChIP-chip
Subtil-Rodríguez A 2014
CEBPE CCAAT/enhancer binding protein (C/EBP), epsilon NM_001805 Q15744 ChIP-chip
Subtil-Rodríguez A 2014
CECR2 cat eye syndrome chromosome region, candidate 2 27443 Q9BXF3 ChIP-chip
Subtil-Rodríguez A 2014
CENPA centromere protein A 1058 P49450 ChIP-chip
Subtil-Rodríguez A 2014
CENPC1 centromere protein C 1 1060 Q03188 ChIP-chip
Subtil-Rodríguez A 2014
CENPF centromere protein F, 350/400kDa (mitosin) 1063 P49454 ChIP-chip
Subtil-Rodríguez A 2014
CENPH centromere protein H 64946 Q9H3R5 ChIP-chip
Subtil-Rodríguez A 2014
CENPL centromere protein L 91687 Q8N0S6 ChIP-chip
Subtil-Rodríguez A 2014
CENPQ centromere protein Q 55166 Q7L2Z9 ChIP-chip
Subtil-Rodríguez A 2014
CEP135 centrosomal protein 135kDa 9662 Q66GS9 ChIP-chip
Subtil-Rodríguez A 2014
CEP164 centrosomal protein 164kDa 22897 Q9UPV0 ChIP-chip
Subtil-Rodríguez A 2014
CEP250 centrosomal protein 250kDa 11190 Q9BV73 ChIP-chip
Subtil-Rodríguez A 2014
CEP350 centrosomal protein 350kDa 9857 Q5VT06 ChIP-chip
Subtil-Rodríguez A 2014
CEP63 centrosomal protein 63kDa 80254 Q96MT8 ChIP-chip
Subtil-Rodríguez A 2014
CEP68 centrosomal protein 68kDa 23177 Q76N32 ChIP-chip
Subtil-Rodríguez A 2014
CETN3 centrin, EF-hand protein, 3 1070 O15182 ChIP-chip
Subtil-Rodríguez A 2014
CFL1 cofilin 1 (non-muscle) 1072 P23528 ChIP-chip
Subtil-Rodríguez A 2014
CFLAR CASP8 and FADD-like apoptosis regulator 8837 O15519 ChIP-chip
Subtil-Rodríguez A 2014
CGGBP1 CGG triplet repeat binding protein 1 8545 Q9UFW8 ChIP-chip
Subtil-Rodríguez A 2014
CGRRF1 cell growth regulator with ring finger domain 1 NM_006568 Q99675 ChIP-chip
Subtil-Rodríguez A 2014
CHCHD1 coiled-coil-helix-coiled-coil-helix domain containing 1 118487 Q96BP2 ChIP-chip
Subtil-Rodríguez A 2014
CHCHD2 KIT 51142 Q9Y6H1 ChIP-chip
Subtil-Rodríguez A 2014
CHCHD3 coiled-coil-helix-coiled-coil-helix domain containing 3 54927 A4D1N4 ChIP-chip
Subtil-Rodríguez A 2014
CHD2 chromodomain helicase DNA binding protein 2 1106 O14647 ChIP-chip
Subtil-Rodríguez A 2014
CHD7 chromodomain helicase DNA binding protein 7 55636 Q6ZWF9 Bimolecular fluorescence complementation assay; IP/WB; Y2H
Batsukh T 2010
CHD8 chromodomain helicase DNA binding protein 8 57680 Q9HCK8 ChIP-chip
Subtil-Rodríguez A 2014
CHERP calcium homeostasis endoplasmic reticulum protein 10523 Q8IWX8 ChIP-chip
Subtil-Rodríguez A 2014
CHFR checkpoint with forkhead and ring finger domains, E3 ubiquitin protein ligase 55743 Q96EP1 ChIP-chip
Subtil-Rodríguez A 2014
CHIC2 cysteine-rich hydrophobic domain 2 26511 Q9UKJ5 ChIP-chip
Subtil-Rodríguez A 2014
CHM choroideremia (Rab escort protein 1) 1121 P24386 ChIP-chip
Subtil-Rodríguez A 2014
CHP calcineurin-like EF-hand protein 1 11261 Q99653 ChIP-chip
Subtil-Rodríguez A 2014
CHRM5 cholinergic receptor, muscarinic 5 NM_012125 A0A024R9I2 ChIP-chip
Subtil-Rodríguez A 2014
CHRNA5 cholinergic receptor, nicotinic, alpha 5 (neuronal) 1138 P30532 ChIP-chip
Subtil-Rodríguez A 2014
CHRNB3 cholinergic receptor, nicotinic, beta 3 (neuronal) NM_000749 Q05901 ChIP-chip
Subtil-Rodríguez A 2014
CHUK conserved helix-loop-helix ubiquitous kinase 1147 O15111 ChIP-chip
Subtil-Rodríguez A 2014
CISD1 CDGSH iron sulfur domain 1 55847 Q9NZ45 ChIP-chip
Subtil-Rodríguez A 2014
CISD2 CDGSH iron sulfur domain 2 NM_001008388 Q8N5K1 ChIP-chip
Subtil-Rodríguez A 2014
CITED1 Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 1 NM_001144886 Q99966 ChIP-chip
Subtil-Rodríguez A 2014
CITED2 Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 2 10370 D9ZGF1 ChIP-chip
Subtil-Rodríguez A 2014
CKAP2L cytoskeleton associated protein 2-like 150468 Q8IYA6 ChIP-chip
Subtil-Rodríguez A 2014
CKS2 CDC28 protein kinase regulatory subunit 2 1164 P33552 ChIP-chip
Subtil-Rodríguez A 2014
CLASP1 cytoplasmic linker associated protein 1 23332 A2RU21 ChIP-chip
Subtil-Rodríguez A 2014
CLCC1 chloride channel CLIC-like 1 23155 Q96S66 ChIP-chip
Subtil-Rodríguez A 2014
CLCN3 chloride channel, voltage-sensitive 3 1182 B7Z932 ChIP-chip
Subtil-Rodríguez A 2014
CLIC1 chloride intracellular channel 1 1192 O00299 ChIP-chip
Subtil-Rodríguez A 2014
CLIC4 chloride intracellular channel 4 25932 Q6FIC5 ChIP-chip
Subtil-Rodríguez A 2014
CLK1 CDC-like kinase 1 1195 P49759 ChIP-chip
Subtil-Rodríguez A 2014
CLK2 CDC-like kinase 2 1196 P49760 ChIP-chip
Subtil-Rodríguez A 2014
CLK4 CDC-like kinase 4 57396 Q9HAZ1 ChIP-chip
Subtil-Rodríguez A 2014
CLOCK clock circadian regulator 9575 O15516 ChIP-chip
Subtil-Rodríguez A 2014
CLPX ClpX caseinolytic peptidase X homolog (E. coli) 10845 O76031 ChIP-chip
Subtil-Rodríguez A 2014
CLTA clathrin, light chain A 1211 P09496 ChIP-chip
Subtil-Rodríguez A 2014
CLTC clathrin, heavy chain (Hc) 1213 Q00610 ChIP-chip
Subtil-Rodríguez A 2014
CMPK1 cytidine monophosphate (UMP-CMP) kinase 1, cytosolic 51727 E9PGI8 ChIP-chip
Subtil-Rodríguez A 2014
CMTM8 CKLF-like MARVEL transmembrane domain containing 8 NM_178868 Q8IZV2 ChIP-chip
Subtil-Rodríguez A 2014
CNBP CCHC-type zinc finger, nucleic acid binding protein 7555 A8K7V4 ChIP-chip
Subtil-Rodríguez A 2014
CNN2 calponin 2 NM_004368 Q99439 ChIP-chip
Subtil-Rodríguez A 2014
CNNM2 cyclin M2 54805 Q9H8M5 ChIP-chip
Subtil-Rodríguez A 2014
CNO biogenesis of lysosomal organelles complex-1, subunit 4, cappuccino 55330 Q9NUP1 ChIP-chip
Subtil-Rodríguez A 2014
CNOT1 CCR4-NOT transcription complex, subunit 1 23019 A5YKK6 ChIP-chip
Subtil-Rodríguez A 2014
CNOT2 CCR4-NOT transcription complex, subunit 2 4848 B2RDX7 ChIP-chip
Subtil-Rodríguez A 2014
CNOT3 CCR4-NOT transcription complex, subunit 3 4849 O75175 ChIP-chip
Subtil-Rodríguez A 2014
CNOT4 CCR4-NOT transcription complex, subunit 4 4850 O95628 ChIP-chip
Subtil-Rodríguez A 2014
CNOT6 CCR4-NOT transcription complex, subunit 6 57472 Q9ULM6 ChIP-chip
Subtil-Rodríguez A 2014
CNOT8 CCR4-NOT transcription complex, subunit 8 9337 Q9UFF9 ChIP-chip
Subtil-Rodríguez A 2014
CNPY3 canopy FGF signaling regulator 3 NM_006586 Q9BT09 ChIP-chip
Subtil-Rodríguez A 2014
CNPY4 canopy FGF signaling regulator 4 NM_152755 Q8N129 ChIP-chip
Subtil-Rodríguez A 2014
COG2 component of oligomeric golgi complex 2 22796 Q14746 ChIP-chip
Subtil-Rodríguez A 2014
COG4 component of oligomeric golgi complex 4 25839 Q9H9E3 ChIP-chip
Subtil-Rodríguez A 2014
COL4A6 collagen, type IV, alpha 6 1288 Q14031 ChIP-chip
Subtil-Rodríguez A 2014
COL5A2 MKL2 1290 P05997 ChIP-chip
Subtil-Rodríguez A 2014
COMMD2 COMM domain containing 2 51122 Q86X83 ChIP-chip
Subtil-Rodríguez A 2014
COMMD3 COMM domain containing 3 NM_012071 Q9UBI1 ChIP-chip
Subtil-Rodríguez A 2014
COPA coatomer protein complex, subunit alpha 1314 P53621 ChIP-chip
Subtil-Rodríguez A 2014
COPB1 coatomer protein complex, subunit beta 1 1315 P53618 ChIP-chip
Subtil-Rodríguez A 2014
COPS4 COP9 constitutive photomorphogenic homolog subunit 4 (Arabidopsis) 51138 B3KST5 ChIP-chip
Subtil-Rodríguez A 2014
COPS5 COP9 constitutive photomorphogenic homolog subunit 5 (Arabidopsis) 10987 Q92905 ChIP-chip
Subtil-Rodríguez A 2014
COPS6 COP9 constitutive photomorphogenic homolog subunit 6 (Arabidopsis) 10980 Q7L5N1 ChIP-chip
Subtil-Rodríguez A 2014
COPS7A COP9 constitutive photomorphogenic homolog subunit 7A (Arabidopsis) 50813 Q9UBW8 ChIP-chip
Subtil-Rodríguez A 2014
COPZ1 coatomer protein complex, subunit zeta 1 22818 P61923 ChIP-chip
Subtil-Rodríguez A 2014
COQ2 coenzyme Q2 homolog, prenyltransferase (yeast) 27235 Q96H96 ChIP-chip
Subtil-Rodríguez A 2014
COQ3 coenzyme Q3 methyltransferase NM_017421 Q9NZJ6 ChIP-chip
Subtil-Rodríguez A 2014
COQ5 coenzyme Q5 homolog, methyltransferase (S. cerevisiae) 84274 Q5HYK3 ChIP-chip
Subtil-Rodríguez A 2014
COTL1 coactosin-like 1 (Dictyostelium) 23406 Q14019 ChIP-chip
Subtil-Rodríguez A 2014
COX18 cytochrome c oxidase assembly homolog 18 (yeast) 285521 Q8N8Q8 ChIP-chip
Subtil-Rodríguez A 2014
COX4I1 cytochrome c oxidase subunit IV isoform 1 1327 P13073 ChIP-chip
Subtil-Rodríguez A 2014
COX5A cytochrome c oxidase subunit Va 9377 P20674 ChIP-chip
Subtil-Rodríguez A 2014
COX5B cytochrome c oxidase subunit Vb 1329 P10606 ChIP-chip
Subtil-Rodríguez A 2014
COX6A1 cytochrome c oxidase subunit VIa polypeptide 1 1337 H6SG15 ChIP-chip
Subtil-Rodríguez A 2014
COX6C cytochrome c oxidase subunit VIc NM_004374 A0A024R9B7 ChIP-chip
Subtil-Rodríguez A 2014
COX7A2 cytochrome c oxidase subunit VIIa polypeptide 2 (liver) NM_001865 H0UI06 ChIP-chip
Subtil-Rodríguez A 2014
COX7C cytochrome c oxidase subunit VIIc 1350 P15954 ChIP-chip
Subtil-Rodríguez A 2014
CP110 centriolar coiled coil protein 110kDa 9738 B4DTZ1 ChIP-chip
Subtil-Rodríguez A 2014
CPEB4 cytoplasmic polyadenylation element binding protein 4 80315 Q17RY0 ChIP-chip
Subtil-Rodríguez A 2014
CPPED1 calcineurin-like phosphoesterase domain containing 1 55313 Q9BRF8 ChIP-chip
Subtil-Rodríguez A 2014
CPSF3 cleavage and polyadenylation specific factor 3, 73kDa 51692 Q9UKF6 ChIP-chip
Subtil-Rodríguez A 2014
CPSF6 cleavage and polyadenylation specific factor 6, 68kDa 11052 Q16630 ChIP-chip
Subtil-Rodríguez A 2014
CPT1A carnitine palmitoyltransferase 1A (liver) 1374 P50416 ChIP-chip
Subtil-Rodríguez A 2014
CPT1C carnitine palmitoyltransferase 1C NM_152359 A0A024QZI3 ChIP-chip
Subtil-Rodríguez A 2014
CRADD CASP2 and RIPK1 domain containing adaptor with death domain 8738 P78560 ChIP-chip
Subtil-Rodríguez A 2014
CREB3 cAMP responsive element binding protein 3 NM_006368 O43889 ChIP-chip
Subtil-Rodríguez A 2014
CREB3L2 cAMP responsive element binding protein 3-like 2 64764 Q70SY1 ChIP-chip
Subtil-Rodríguez A 2014
CREBL2 cAMP responsive element binding protein-like 2 1389 O60519 ChIP-chip
Subtil-Rodríguez A 2014
CREBZF CREB/ATF bZIP transcription factor 58487 Q9NS37 ChIP-chip
Subtil-Rodríguez A 2014
CREM cAMP responsive element modulator 1390 Q03060 ChIP-chip
Subtil-Rodríguez A 2014
CRIPT cysteine-rich PDZ-binding protein NM_014171 Q9P021 ChIP-chip
Subtil-Rodríguez A 2014
CRK v-crk sarcoma virus CT10 oncogene homolog (avian) 1398 P46108 ChIP-chip
Subtil-Rodríguez A 2014
CRKL v-crk sarcoma virus CT10 oncogene homolog (avian)-like 1399 P46109 ChIP-chip
Subtil-Rodríguez A 2014
CROCC ciliary rootlet coiled-coil, rootletin 9696 Q5TZA2 ChIP-chip
Subtil-Rodríguez A 2014
CROCCL2 ciliary rootlet coiled-coil, rootletin pseudogene 3 NR_023386 ChIP-chip
Subtil-Rodríguez A 2014
CROT NR_026585 ChIP-chip
Subtil-Rodríguez A 2014
CRY1 cryptochrome 1 (photolyase-like) 1407 A2I2P0 ChIP-chip
Subtil-Rodríguez A 2014
CRYL1 crystallin, lambda 1 NM_015974 Q9Y2S2 ChIP-chip
Subtil-Rodríguez A 2014
CRYZ crystallin, zeta (quinone reductase) NM_001134759 Q08257 ChIP-chip
Subtil-Rodríguez A 2014
CS citrate synthase 1431 O75390 ChIP-chip
Subtil-Rodríguez A 2014
CSNK1A1 casein kinase 1, alpha 1 1452 P48729 ChIP-chip
Subtil-Rodríguez A 2014
CSNK1G1 casein kinase 1, gamma 1 53944 Q9HCP0 ChIP-chip
Subtil-Rodríguez A 2014
CSNK2B casein kinase 2, beta polypeptide 1460 P67870 ChIP-chip
Subtil-Rodríguez A 2014
CSPP1 centrosome and spindle pole associated protein 1 NM_024790 Q1MSJ5 ChIP-chip
Subtil-Rodríguez A 2014
CSTF1 cleavage stimulation factor, 3' pre-RNA, subunit 1, 50kDa 1477 Q05048 ChIP-chip
Subtil-Rodríguez A 2014
CSTF3 cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa 1479 Q12996 ChIP-chip
Subtil-Rodríguez A 2014
CTAGE5 CTAGE family, member 5 4253 O15320 ChIP-chip
Subtil-Rodríguez A 2014
CTBP2 C-terminal binding protein 2 1488 P56545 ChIP-chip
Subtil-Rodríguez A 2014
CTCF CCCTC-binding factor (zinc finger protein) 10664 B5MC38 Y2H; GST; ChIP-chip
Ishihara K 2006
CTDSPL2 CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2 51496 Q05D32 ChIP-chip
Subtil-Rodríguez A 2014
CTNNA1 catenin (cadherin-associated protein), alpha 1, 102kDa 1495 P35221 ChIP-chip
Subtil-Rodríguez A 2014
CTNNA2 catenin (cadherin-associated protein), alpha 2 1496 P26232 ChIP-chip
Subtil-Rodríguez A 2014
CTNNB1 catenin (cadherin-associated protein), beta 1, 88kDa 1499 P35222 GST; ChIP-chip
Thompson BA 2008
CTNND1 catenin (cadherin-associated protein), delta 1 1500 O60716 ChIP-chip
Subtil-Rodríguez A 2014
CTTNBP2NL CTTNBP2 N-terminal like 55917 Q9P2B4 ChIP-chip
Subtil-Rodríguez A 2014
CTU1 cytosolic thiouridylase subunit 1 homolog (S. pombe) 90353 Q7Z7A3 ChIP-chip
Subtil-Rodríguez A 2014
CUGBP1 CUGBP, Elav-like family member 1 NM_006560 Q92879 ChIP-chip
Subtil-Rodríguez A 2014
CUL1 cullin 1 8454 Q13616 ChIP-chip
Subtil-Rodríguez A 2014
CUL2 cullin 2 8453 Q13617 ChIP-chip
Subtil-Rodríguez A 2014
CUL5 cullin 5 8065 Q93034 ChIP-chip
Subtil-Rodríguez A 2014
CUTA cutA divalent cation tolerance homolog (E. coli) 51596 O60888 ChIP-chip
Subtil-Rodríguez A 2014
CWC22 CWC22 spliceosome-associated protein homolog (S. cerevisiae) 57703 Q9HCG8 ChIP-chip
Subtil-Rodríguez A 2014
CWF19L1 CWF19-like 1, cell cycle control (S. pombe) 55280 Q69YN2 ChIP-chip
Subtil-Rodríguez A 2014
CXorf56 chromosome X open reading frame 56 NM_022101 Q9H5V9 ChIP-chip
Subtil-Rodríguez A 2014
CXXC4 CXXC finger protein 4 NM_025212 J9JIF5 ChIP-chip
Subtil-Rodríguez A 2014
CYB5A cytochrome b5 type A (microsomal) 1528 P00167 ChIP-chip
Subtil-Rodríguez A 2014
CYB5B cytochrome b5 type B (outer mitochondrial membrane) 80777 J3KNF8 ChIP-chip
Subtil-Rodríguez A 2014
CYB5D1 cytochrome b5 domain containing 1 124637 Q6P9G0 ChIP-chip
Subtil-Rodríguez A 2014
CYB5D2 cytochrome b5 domain containing 2 124936 Q8WUJ1 ChIP-chip
Subtil-Rodríguez A 2014
CYP2R1 cytochrome P450, family 2, subfamily R, polypeptide 1 120227 Q6VVX0 ChIP-chip
Subtil-Rodríguez A 2014
CYP39A1 cytochrome P450, family 39, subfamily A, polypeptide 1 NM_016593 B7Z786 ChIP-chip
Subtil-Rodríguez A 2014
CYP51A1 cytochrome P450, family 51, subfamily A, polypeptide 1 1595 Q16850 ChIP-chip
Subtil-Rodríguez A 2014
CYR61 NXPH1 3491 O00622 ChIP-chip
Subtil-Rodríguez A 2014
CYTH2 cytohesin 2 9266 Q99418 ChIP-chip
Subtil-Rodríguez A 2014
CYTSA sperm antigen with calponin homology and coiled-coil domains 1-like NM_001145468 B2RMV2 ChIP-chip
Subtil-Rodríguez A 2014
DAD1 Dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit DAD1 1603 P61803 ChIP-chip
Subtil-Rodríguez A 2014
DALRD3 DALR anticodon binding domain containing 3 55152 Q5D0E6 ChIP-chip
Subtil-Rodríguez A 2014
DARS2 aspartyl-tRNA synthetase 2, mitochondrial 55157 Q6PI48 ChIP-chip
Subtil-Rodríguez A 2014
DAXX death-domain associated protein 1616 Q53F85 ChIP-chip
Subtil-Rodríguez A 2014
DAZAP2 DAZ associated protein 2 9802 E9PB45 ChIP-chip
Subtil-Rodríguez A 2014
DBNL drebrin-like 28988 Q9UJU6 ChIP-chip
Subtil-Rodríguez A 2014
DBT dihydrolipoamide branched chain transacylase E2 1629 P11182 ChIP-chip
Subtil-Rodríguez A 2014
DCAF11 DDB1 and CUL4 associated factor 11 80344 B3KSW2 ChIP-chip
Subtil-Rodríguez A 2014
DCAF12 DDB1 and CUL4 associated factor 12 25853 Q5T6F0 ChIP-chip
Subtil-Rodríguez A 2014
DCAF13 DDB1 and CUL4 associated factor 13 25879 Q9NV06 ChIP-chip
Subtil-Rodríguez A 2014
DCAF6 DDB1 and CUL4 associated factor 6 NM_018442 Q58WW2 ChIP-chip
Subtil-Rodríguez A 2014
DCAF7 DDB1 and CUL4 associated factor 7 10238 P61962 ChIP-chip
Subtil-Rodríguez A 2014
DCAF8 DDB1 and CUL4 associated factor 8 50717 B7Z8C9 ChIP-chip
Subtil-Rodríguez A 2014
DCDC2 doublecortin domain containing 2 51473 Q9UHG0 ChIP-chip
Subtil-Rodríguez A 2014
DCLRE1C DNA cross-link repair 1C 64421 Q96SD1 ChIP-chip
Subtil-Rodríguez A 2014
DCP2 DCP2 decapping enzyme homolog (S. cerevisiae) 167227 Q8IU60 ChIP-chip
Subtil-Rodríguez A 2014
DCPS decapping enzyme, scavenger 28960 Q96C86 ChIP-chip
Subtil-Rodríguez A 2014
DCTN4 dynactin 4 (p62) 51164 Q9NSJ5 ChIP-chip
Subtil-Rodríguez A 2014
DDAH1 dimethylarginine dimethylaminohydrolase 1 23576 B4E3V1 ChIP-chip
Subtil-Rodríguez A 2014
DDB2 damage-specific DNA binding protein 2, 48kDa 1643 Q92466 ChIP-chip
Subtil-Rodríguez A 2014
DDHD2 DDHD domain containing 2 23259 O94830 ChIP-chip
Subtil-Rodríguez A 2014
DDOST dolichyl-diphosphooligosaccharide--protein glycosyltransferase 1650 P39656 ChIP-chip
Subtil-Rodríguez A 2014
DDX17 DEAD (Asp-Glu-Ala-Asp) box helicase 17 10521 Q59F66 ChIP-chip
Subtil-Rodríguez A 2014
DDX21 DEAD (Asp-Glu-Ala-Asp) box helicase 21 9188 Q9NR30 ChIP-chip
Subtil-Rodríguez A 2014
DDX23 DEAD (Asp-Glu-Ala-Asp) box polypeptide 23 9416 B3KY11 ChIP-chip
Subtil-Rodríguez A 2014
DDX3X DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked 1654 O00571 ChIP-chip
Subtil-Rodríguez A 2014
DDX46 DEAD (Asp-Glu-Ala-Asp) box polypeptide 46 9879 Q7L014 ChIP-chip
Subtil-Rodríguez A 2014
DDX49 DEAD (Asp-Glu-Ala-Asp) box polypeptide 49 54555 Q9Y6V7 ChIP-chip
Subtil-Rodríguez A 2014
DDX5 DEAD (Asp-Glu-Ala-Asp) box helicase 5 1655 P17844 ChIP-chip
Subtil-Rodríguez A 2014
DDX50 DEAD (Asp-Glu-Ala-Asp) box polypeptide 50 79009 Q9BQ39 ChIP-chip
Subtil-Rodríguez A 2014
DEDD death effector domain containing 9191 O75618 ChIP-chip
Subtil-Rodríguez A 2014
DEK DEK oncogene 7913 P35659 ChIP-chip
Subtil-Rodríguez A 2014
DEM1 exonuclease 5 64789 Q9H790 ChIP-chip
Subtil-Rodríguez A 2014
DENND4A DENN/MADD domain containing 4A 10260 Q05C90 ChIP-chip
Subtil-Rodríguez A 2014
DENND4C DENN/MADD domain containing 4C 55667 Q5VZ89 ChIP-chip
Subtil-Rodríguez A 2014
DENND5A DENN/MADD domain containing 5A NM_015213 Q6IQ26 ChIP-chip
Subtil-Rodríguez A 2014
DEPDC1B DEP domain containing 1B 55789 Q8WUY9 ChIP-chip
Subtil-Rodríguez A 2014
DFFA DNA fragmentation factor, 45kDa, alpha polypeptide 1676 O00273 ChIP-chip
Subtil-Rodríguez A 2014
DGKA diacylglycerol kinase, alpha 80kDa NM_001345 A0A024RB23 ChIP-chip
Subtil-Rodríguez A 2014
DHDDS dehydrodolichyl diphosphate synthase 79947 Q86SQ9 ChIP-chip
Subtil-Rodríguez A 2014
DHRS12 dehydrogenase/reductase (SDR family) member 12 NM_024705 A0PJE2 ChIP-chip
Subtil-Rodríguez A 2014
DHRS13 dehydrogenase/reductase (SDR family) member 13 147015 Q6UX07 ChIP-chip
Subtil-Rodríguez A 2014
DHX15 DEAH (Asp-Glu-Ala-His) box polypeptide 15 1665 O43143 ChIP-chip
Subtil-Rodríguez A 2014
DHX16 DEAH (Asp-Glu-Ala-His) box polypeptide 16 8449 B4DZ28 ChIP-chip
Subtil-Rodríguez A 2014
DHX29 DEAH (Asp-Glu-Ala-His) box polypeptide 29 54505 Q7Z478 ChIP-chip
Subtil-Rodríguez A 2014
DHX30 DEAH (Asp-Glu-Ala-His) box polypeptide 30 22907 Q7L2E3 ChIP-chip
Subtil-Rodríguez A 2014
DHX33 DEAH (Asp-Glu-Ala-His) box polypeptide 33 56919 B4DIS6 ChIP-chip
Subtil-Rodríguez A 2014
DHX34 DEAH (Asp-Glu-Ala-His) box polypeptide 34 9704 Q14147