HELP     Sign In
Search

Relevance to Autism

Rare mutations in the CHD8 gene have been identified in individuals with ASD (Oâ??Roak et al., 2012). A balanced chromosomal abnormality (BCA) that disrupted the CHD8 gene was also recently identified in an ASD case (Talkowski et al., 2012).

Molecular Function

This gene encodes a DNA helicase that functions as a transcription repressor by remodeling chromatin structure. It binds beta-catenin and negatively regulates Wnt signaling pathway, which plays a pivotal role in vertebrate early development and morphogenesis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

External Links

        

References

Type
Title
Type of Disorder
Associated Disorders
Author, Year
Primary
Sporadic autism exomes reveal a highly interconnected protein network of de novo mutations.
ASD
Support
Multiplex targeted sequencing identifies recurrently mutated genes in autism spectrum disorders.
ASD
Support
Sequencing chromosomal abnormalities reveals neurodevelopmental loci that confer risk across diagnostic boundaries.
ASD
Support
CHD8 interacts with CHD7, a protein which is mutated in CHARGE syndrome.
Support
Large-scale discovery of novel genetic causes of developmental disorders.
ASD
Support
The contribution of de novo coding mutations to autism spectrum disorder.
ASD
Support
Recurrent ?100 Kb microdeletion in the chromosomal region 14q11.2, involving CHD8 gene, is associated with autism and macrocephaly.
ASD
Support
De novo mutations in schizophrenia implicate chromatin remodeling and support a genetic overlap with autism and intellectual disability.
SCZ
Recent recommendation
CHD8 regulates neurodevelopmental pathways associated with autism spectrum disorder in neural progenitors.
Recent recommendation
Disruptive CHD8 mutations define a subtype of autism early in development.
ASD
DD, ID
Recent recommendation
Synaptic, transcriptional and chromatin genes disrupted in autism.
ASD

Rare

Variant ID
Variant Type
Allele Change
Residue Change
Inheritance Pattern
Inheritance Association
Family Type
Author, Year
 GEN334R001 
 frameshift_variant 
 delCT 
 Leu2120ProfsTer13 
 De novo 
  
 Simplex 
 GEN334R002 
 stop_gained 
 G to A 
 Gln959Ter 
 De novo 
  
 Simplex 
 GEN334R003 
 translocation 
  
  
 De novo 
  
  
 GEN334R004 
 inframe_deletion 
 del(GGT) 
 His2498del 
 De novo 
  
 Simplex 
 GEN334R005 
 frameshift_variant 
 ins(T) 
 Asn2371LysfsTer2 
 De novo 
  
 Simplex 
 GEN334R006 
 frameshift_variant 
 del(CTTC) 
 Glu2103ArgfsTer3 
 De novo 
  
 Simplex 
 GEN334R007 
 stop_gained 
 G>A 
 Arg1337Ter 
 De novo 
  
 Simplex 
 GEN334R008 
 splice_site_variant 
 c.3519-2A>G 
  
 De novo 
  
 Simplex 
 GEN334R009 
 frameshift_variant 
 ins(T) 
 Tyr747Ter 
 De novo 
  
 Simplex 
 GEN334R010 
 stop_gained 
 G>C 
 Ser62Ter 
 De novo 
  
 Simplex 
 GEN334R011 
 stop_gained 
 C>A 
 S2173Ter 
 De novo 
  
 Simplex 
 GEN334R012 
 frameshift_variant 
  
 Val984Ter 
 Familial 
 Maternal 
 Possible multi-generational 
 GEN334R013 
 stop_gained 
  
 Glu1114Ter 
 De novo 
  
  
 GEN334R014 
 frameshift_variant 
  
 Glu1932SerfsTer3 
 De novo 
  
  
 GEN334R015 
 frameshift_variant 
  
 Glu2136ArgfsTer6 
 De novo 
  
  
 GEN334R016 
 inframe_deletion 
  
 Lys2287del 
 Unknown 
  
  
 GEN334R017 
 missense_variant 
  
 Arg910Gln 
 Unknown 
  
 Unknown 
 GEN334R018 
 missense_variant 
  
 Gly1710Val 
 Familial 
 Maternal 
  
 GEN334R019 
 missense_variant 
  
 Arg1797Gln 
 Familial 
 Paternal 
 Possible multi-generational 
 GEN334R020 
 copy_number_gain 
  
  
 Familial 
 Paternal 
 Possible multiplex 
 GEN334R021 
 copy_number_gain 
  
  
 Unknown 
  
 Unknown 
 GEN334R022 
 copy_number_gain 
  
  
 Unknown 
  
 Unknown 
 GEN334R023 
 copy_number_loss 
  
  
 De novo 
  
  
 GEN334R024 
 missense_variant 
 C/T 
 R1242Q 
 De novo 
  
 Simplex 
 GEN334R025 
 missense_variant 
 A/G 
 L834P 
 De novo 
  
 Simplex 
 GEN334R026 
 missense_variant 
 G/A 
 R1178C 
 Familial 
 Paternal 
 Simplex 
 GEN334R027 
 missense_variant 
 A/C 
 F1358C 
 Familial 
 Maternal 
 Simplex 
 GEN334R028 
 missense_variant 
 C/G 
 R213P 
 Familial 
 Maternal 
 Simplex 
 GEN334R029 
 missense_variant 
 C/T 
 R1609H 
 Familial 
 Paternal 
 Simplex 
 GEN334R030 
 frameshift_variant 
 del(T) 
  
 Unknown 
  
 Unknown 
 GEN334R031 
 splice_site_variant 
 A/T 
  
 De novo 
  
 Simplex 
 GEN334R032 
 splice_site_variant 
 T/G 
  
 De novo 
  
 Simplex 
 GEN334R033 
 stop_gained 
 C/T 
  
 Unknown 
  
 Unknown 
 GEN334R034 
 missense_variant 
 C/T 
 R1699H 
 Unknown 
  
 Unknown 
 GEN334R035 
 missense_variant 
 G/A 
 L1072F 
 Unknown 
  
 Unknown 
 GEN334R036 
 missense_variant 
 G/A 
 R1609C 
 Unknown 
  
 Unknown 
 GEN334R037 
 missense_variant 
 G/A 
 R1615C 
 Unknown 
  
 Unknown 
 GEN334R038 
 missense_variant 
 C/T 
  
 Unknown 
  
 Unknown 
 GEN334R039 
 missense_variant 
 G/A 
  
 Unknown 
  
 Unknown 
 GEN334R040 
 missense_variant 
 C/A 
  
 Unknown 
  
 Unknown 
 GEN334R041 
 splice_site_variant 
 del(CTCTTGCACGTCCCATCACAGTAGCAAGGAGTACTCACTTGAGCTT 
  
 De novo 
  
 Simplex 
 GEN334R042 
 missense_variant 
 T/G 
  
 Familial 
 Paternal 
 Multi-generational 

Common

No Common Variants Available



Model Summary

Mode of p53 regulation mediated by CHD8, which may set a threshold for induction of apoptosis during early embryogenesis by counteracting p53 function through recruitment of histone H1

External Links

AllenBrainAtlas   MGI Logo  Entrez Gene

References

Type
Title
Author, Year
Additional
CHD8 suppresses p53-mediated apoptosis through histone H1 recruitment during early embryogenesis.

CHD8_1_KO_HM

Model Type: Genetic
Model Genotype: Homozygous
Mutation: Targeted deletion of all the exons of the Chd8 gene
Allele Type: Targeted (Knock Out)
Strain of Origin: Not specified
Genetic Background: C57BL/6
ES Cell Line: Not specified
Mutant ES Cell Line: Not specified
Model Source: Not specified

CHD8_1_KO_HM

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
Mortality/lethality1
Increased
Description: Increased early embryonic death
Exp Paradigm: General observations
 General observations
 E5.5 - E10.5
Developmental trajectory1
Abnormal
Description: Abnormal developmental trajectory indicated by growth retardation
Exp Paradigm: Histopathological examination
 Histology
 Unreported
 Not Reported: Circadian sleep/wake cycle ,   Communications ,   Emotion ,   Homeostasis ,   Immune response ,   Learning & memory ,   Maternal behavior ,   Molecular profile ,   Motor phenotype ,   Neuroanatomy / Ultrastructure / Cytoarchitecture ,   Neurophysiology ,   Repetitive behavior ,   Seizure ,   Sensory ,   Social behavior ,  


Interactor Symbol Interactor Name Interactor Organism Entrez ID Uniprot ID Interaction Type Evidence Reference
41703 membrane-associated ring finger (C3HC4) 5 NM_017824 Q9NX47 ChIP-chip
Subtil-Rodríguez A 2014
41704 membrane-associated ring finger (C3HC4) 6, E3 ubiquitin protein ligase NM_005885 O60337 ChIP-chip
Subtil-Rodríguez A 2014
41707 membrane-associated ring finger (C3HC4) 9 NM_138396 Q86YJ5 ChIP-chip
Subtil-Rodríguez A 2014
41884 septin 2 NM_004404 Q15019 ChIP-chip
Subtil-Rodríguez A 2014
41886 septin 4 NM_004574 O43236 ChIP-chip
Subtil-Rodríguez A 2014
41889 membrane-associated ring finger (C3HC4) 7, E3 ubiquitin protein ligase NM_022826 B7ZAR7 ChIP-chip
Subtil-Rodríguez A 2014
41893 15 kDa selenoprotein NM_004261 O60613 ChIP-chip
Subtil-Rodríguez A 2014
AAGAB alpha- and gamma-adaptin binding protein 79719 Q6PD74 ChIP-chip
Subtil-Rodríguez A 2014
AAK1 AP2 associated kinase 1 22848 Q2M2I8 ChIP-chip
Subtil-Rodríguez A 2014
AAMDC Mth938 domain-containing protein 28971 Q9H7C9 CHIP-seq
Cotney J 2015
AASDH aminoadipate-semialdehyde dehydrogenase 132949 Q4L235 ChIP-chip
Subtil-Rodríguez A 2014
AASDHPPT aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase 60496 Q9NRN7 ChIP-chip
Subtil-Rodríguez A 2014
ABCA17P ATP-binding cassette, sub-family A (ABC1), member 17, pseudogene 650655 NA CHIP-seq
Cotney J 2015
ABCC5 ATP-binding cassette, sub-family C (CFTR/MRP), member 5 10057 O15440 ChIP-chip
Subtil-Rodríguez A 2014
ABCD3 ATP-binding cassette, sub-family D (ALD), member 3 5825 P28288 ChIP-chip
Subtil-Rodríguez A 2014
ABCE1 ATP-binding cassette, sub-family E (OABP), member 1 6059 P61221 ChIP-chip
Subtil-Rodríguez A 2014
ABHD10 abhydrolase domain containing 10 55347 Q9NUJ1 ChIP-chip
Subtil-Rodríguez A 2014
ABHD12 abhydrolase domain containing 12 26090 Q8N2K0 ChIP-chip
Subtil-Rodríguez A 2014
ABHD14A abhydrolase domain containing 14A NM_015407 Q9BUJ0 ChIP-chip
Subtil-Rodríguez A 2014
ABHD3 abhydrolase domain containing 3 NM_138340 Q8WU67 ChIP-chip
Subtil-Rodríguez A 2014
ABI1 abl-interactor 1 10006 Q8IZP0 ChIP-chip
Subtil-Rodríguez A 2014
ABI2 abl-interactor 2 10152 Q9NYB9 ChIP-chip
Subtil-Rodríguez A 2014
ABL1 c-abl oncogene 1, non-receptor tyrosine kinase 25 P00519 ChIP-chip
Subtil-Rodríguez A 2014
ABT1 activator of basal transcription 1 29777 Q9ULW3 ChIP-chip
Subtil-Rodríguez A 2014
ABTB2 ankyrin repeat and BTB (POZ) domain containing 2 25841 Q8N961 ChIP-chip
Subtil-Rodríguez A 2014
ACACA acetyl-CoA carboxylase alpha 31 Q13085 ChIP-chip
Subtil-Rodríguez A 2014
ACAD9 acyl-CoA dehydrogenase family, member 9 28976 Q9H845 ChIP-chip
Subtil-Rodríguez A 2014
ACADM acyl-CoA dehydrogenase, C-4 to C-12 straight chain 34 P11310 ChIP-chip
Subtil-Rodríguez A 2014
ACADSB Short/branched chain specific acyl-CoA dehydrogenase, mitochondrial 36 P45954 CHIP-seq
Cotney J 2015
ACAT1 acetyl-CoA acetyltransferase 1 38 P24752 ChIP-chip
Subtil-Rodríguez A 2014
ACBD5 acyl-CoA binding domain containing 5 91452 Q5T8D3 CHIP-seq
Cotney J 2015
ACBD6 acyl-CoA binding domain containing 6 84320 B2RAA8 ChIP-chip
Subtil-Rodríguez A 2014
ACIN1 apoptotic chromatin condensation inducer 1 22985 Q9UKV3 ChIP-chip
Subtil-Rodríguez A 2014
ACLY ATP citrate lyase 47 P53396 ChIP-chip
Subtil-Rodríguez A 2014
ACO1 aconitase 1, soluble 48 P21399 ChIP-chip
Subtil-Rodríguez A 2014
ACO2 aconitase 2, mitochondrial 50 Q99798 CHIP-seq
Cotney J 2015
ACOX3 acyl-CoA oxidase 3, pristanoyl NM_003501 O15254 ChIP-chip
Subtil-Rodríguez A 2014
ACP1 acid phosphatase 1, soluble 52 B5MCC7 ChIP-chip
Subtil-Rodríguez A 2014
ACP2 acid phosphatase 2, lysosomal 53 P11117 ChIP-chip
Subtil-Rodríguez A 2014
ACPL2 2-phosphoxylose phosphatase 1 92370 Q8TE99 CHIP-seq
Cotney J 2015
ACSL3 acyl-CoA synthetase long-chain family member 3 2181 B3KMA6 CHIP-seq
Cotney J 2015
ACTB actin, beta 60 P60709 ChIP-chip
Subtil-Rodríguez A 2014
ACTG1 actin, gamma 1 71 P63261 CHIP-seq
Cotney J 2015
ACTL6A actin-like 6A 86 O96019 ChIP-chip
Subtil-Rodríguez A 2014
ACTR1A ARP1 actin-related protein 1 homolog A, centractin alpha (yeast) 10121 P61163 ChIP-chip
Subtil-Rodríguez A 2014
ACTR1B ARP1 actin-related protein 1 homolog B, centractin beta (yeast) 10120 P42025 CHIP-seq
Cotney J 2015
ACTR2 ARP2 actin-related protein 2 homolog (yeast) 10097 E9PF41 ChIP-chip
Subtil-Rodríguez A 2014
ACTR3 ARP3 actin-related protein 3 homolog (yeast) 10096 P61158 ChIP-chip
Subtil-Rodríguez A 2014
ACTR6 ARP6 actin-related protein 6 homolog (yeast) NM_022496 Q9GZN1 ChIP-chip
Subtil-Rodríguez A 2014
ACVR1B activin A receptor, type IB 91 P36896 ChIP-chip
Subtil-Rodríguez A 2014
ACVR2A activin A receptor, type IIA 92 P27037 ChIP-chip
Subtil-Rodríguez A 2014
ACYP1 acylphosphatase 1, erythrocyte (common) type NM_001107 P07311 ChIP-chip
Subtil-Rodríguez A 2014
ACYP2 Acylphosphatase-2 98 P14621 CHIP-seq
Cotney J 2015
ADAL adenosine deaminase-like 161823 Q6DHV7 ChIP-chip
Subtil-Rodríguez A 2014
ADAM17 ADAM metallopeptidase domain 17 6868 B2RNB2 ChIP-chip
Subtil-Rodríguez A 2014
ADAM8 ADAM metallopeptidase domain 8 NM_001109 P78325 ChIP-chip
Subtil-Rodríguez A 2014
ADAM9 ADAM metallopeptidase domain 9 8754 Q13443 ChIP-chip
Subtil-Rodríguez A 2014
ADAMTS10 A disintegrin and metalloproteinase with thrombospondin motifs 10 81794 Q9H324 CHIP-seq
Cotney J 2015
ADAMTS8 ADAM metallopeptidase with thrombospondin type 1 motif, 8 11095 Q5FWF1 ChIP-chip
Subtil-Rodríguez A 2014
ADAR adenosine deaminase, RNA-specific 103 P55265 ChIP-chip
Subtil-Rodríguez A 2014
ADAT2 adenosine deaminase, tRNA-specific 2 134637 Q7Z6V5 CHIP-seq
Cotney J 2015
ADCK4 aarF domain containing kinase 4 79934 Q96D53 CHIP-seq
Cotney J 2015
ADD1 adducin 1 (alpha) 118 P35611 ChIP-chip
Subtil-Rodríguez A 2014
ADK adenosine kinase 132 P55263 ChIP-chip
Subtil-Rodríguez A 2014
ADM adrenomedullin NM_001124 P35318 ChIP-chip
Subtil-Rodríguez A 2014
ADNP activity-dependent neuroprotector homeobox 23394 Q9H2P0 ChIP-chip
Subtil-Rodríguez A 2014
ADO 2-aminoethanethiol (cysteamine) dioxygenase 84890 B3KXN9 CHIP-seq
Cotney J 2015
ADRM1 adhesion regulating molecule 1 11047 Q16186 ChIP-chip
Subtil-Rodríguez A 2014
ADSL adenylosuccinate lyase 158 P30566 ChIP-chip
Subtil-Rodríguez A 2014
ADSS adenylosuccinate synthase 159 P30520 ChIP-chip
Subtil-Rodríguez A 2014
AEBP2 AE binding protein 2 121536 Q6ZN18 CHIP-seq
Cotney J 2015
AES amino-terminal enhancer of split 166 Q08117 CHIP-seq
Cotney J 2015
AFF4 AF4/FMR2 family, member 4 27125 Q9UHB7 CHIP-seq
Cotney J 2015
AFTPH aftiphilin 54812 Q6ULP2 ChIP-chip
Subtil-Rodríguez A 2014
AGA aspartylglucosaminidase NM_000027 P20933 ChIP-chip
Subtil-Rodríguez A 2014
AGAP3 ArfGAP with GTPase domain, ankyrin repeat and PH domain 3 NM_001042535 Q86ST5 ChIP-chip
Subtil-Rodríguez A 2014
AGFG1 ArfGAP with FG repeats 1 3267 P52594 CHIP-seq
Cotney J 2015
AGK acylglycerol kinase 55750 A4D1U5 CHIP-seq
Cotney J 2015
AGO2 argonaute RISC catalytic component 2 27161 A4FVC0 CHIP-seq
Cotney J 2015
AGPAT1 1-acylglycerol-3-phosphate O-acyltransferase 1 10554 Q99943 ChIP-chip
Subtil-Rodríguez A 2014
AGPAT3 1-acylglycerol-3-phosphate O-acyltransferase 3 56894 Q9NRZ7 CHIP-seq
Cotney J 2015
AGPAT6 1-acylglycerol-3-phosphate O-acyltransferase 6 137964 Q2TU73 CHIP-seq
Cotney J 2015
AHCYL2 adenosylhomocysteinase-like 2 23382 Q96HN2 CHIP-seq
Cotney J 2015
AHSA1 AHA1, activator of heat shock 90kDa protein ATPase homolog 1 (yeast) 10598 O95433 ChIP-chip
Subtil-Rodríguez A 2014
AIFM1 apoptosis-inducing factor, mitochondrion-associated, 1 9131 O95831 ChIP-chip
Subtil-Rodríguez A 2014
AIMP1 aminoacyl tRNA synthetase complex-interacting multifunctional protein 1 9255 B4DNK3 CHIP-seq
Cotney J 2015
AK3 adenylate kinase 3 50808 Q7Z4Y4 ChIP-chip
Subtil-Rodríguez A 2014
AKAP11 A kinase (PRKA) anchor protein 11 11215 Q9UKA4 ChIP-chip
Subtil-Rodríguez A 2014
AKAP4 A kinase (PRKA) anchor protein 4 8852 Q5JQC9 ChIP-chip
Subtil-Rodríguez A 2014
AKAP8 A kinase (PRKA) anchor protein 8 10270 O43823 ChIP-chip
Subtil-Rodríguez A 2014
AKAP8L A kinase (PRKA) anchor protein 8-like 26993 Q9ULX6 ChIP-chip
Subtil-Rodríguez A 2014
AKIRIN1 akirin 1 79647 Q9H9L7 CHIP-seq
Cotney J 2015
AKIRIN2 akirin 2 55122 Q53H80 ChIP-chip
Subtil-Rodríguez A 2014
AKT1S1 AKT1 substrate 1 (proline-rich) 84335 Q96B36 ChIP-chip
Subtil-Rodríguez A 2014
AKT2 v-akt murine thymoma viral oncogene homolog 2 208 B4DG79 CHIP-seq
Cotney J 2015
ALDH18A1 aldehyde dehydrogenase 18 family, member A1 5832 P54886 ChIP-chip
Subtil-Rodríguez A 2014
ALG10 ALG10, alpha-1,2-glucosyltransferase 84920 Q5BKT4 ChIP-chip
Subtil-Rodríguez A 2014
ALG10B ALG10B, alpha-1,2-glucosyltransferase 144245 Q5I7T1 ChIP-chip
Subtil-Rodríguez A 2014
ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit NM_144988 Q96F25 ChIP-chip
Subtil-Rodríguez A 2014
ALG2 ALG2, alpha-1,3/1,6-mannosyltransferase 85365 Q9H553 ChIP-chip
Subtil-Rodríguez A 2014
ALG5 ALG5, dolichyl-phosphate beta-glucosyltransferase 29880 Q9Y673 ChIP-chip
Subtil-Rodríguez A 2014
ALG8 ALG8, alpha-1,3-glucosyltransferase 79053 A6NDW6 ChIP-chip
Subtil-Rodríguez A 2014
ALG9 ALG9, alpha-1,2-mannosyltransferase 79796 Q9H6U8 CHIP-seq
Cotney J 2015
ALKBH5 alkB, alkylation repair homolog 5 (E. coli) 54890 Q6P6C2 ChIP-chip
Subtil-Rodríguez A 2014
ALKBH8 alkB, alkylation repair homolog 8 (E. coli) 91801 Q96BT7 ChIP-chip
Subtil-Rodríguez A 2014
ALMS1 Alstrom syndrome 1 7840 Q8TCU4 ChIP-chip
Subtil-Rodríguez A 2014
ALOXE3 Hydroperoxide isomerase ALOXE3 59344 Q9BYJ1 CHIP-seq
Cotney J 2015
ALS2 amyotrophic lateral sclerosis 2 (juvenile) NM_001135745 Q96Q42 ChIP-chip
Subtil-Rodríguez A 2014
AMBRA1 autophagy/beclin-1 regulator 1 55626 Q9C0C7 ChIP-chip
Subtil-Rodríguez A 2014
AMD1 adenosylmethionine decarboxylase 1 262 P17707 CHIP-seq
Cotney J 2015
AMFR autocrine motility factor receptor, E3 ubiquitin protein ligase 267 Q9UKV5 CHIP-seq
Cotney J 2015
AMHR2 anti-Mullerian hormone receptor, type II 269 Q16671 ChIP-chip
Subtil-Rodríguez A 2014
AMMECR1L AMMECR1-like 83607 Q6DCA0 ChIP-chip
Subtil-Rodríguez A 2014
AMOTL2 CDH10 51421 Q9Y2J4 CHIP-seq
Cotney J 2015
ANAPC10 anaphase promoting complex subunit 10 10393 Q9UM13 ChIP-chip
Subtil-Rodríguez A 2014
ANAPC13 anaphase promoting complex subunit 13 25847 A8K3Z6 ChIP-chip
Subtil-Rodríguez A 2014
ANAPC5 anaphase promoting complex subunit 5 51433 Q9UJX4 ChIP-chip
Subtil-Rodríguez A 2014
ANAPC7 anaphase promoting complex subunit 7 51434 Q9UJX3 ChIP-chip
Subtil-Rodríguez A 2014
ANG angiogenin, ribonuclease, RNase A family, 5 283 P03950 ChIP-chip
Subtil-Rodríguez A 2014
ANGEL2 angel homolog 2 (Drosophila) 90806 Q5VTE6 CHIP-seq
Cotney J 2015
ANKH ankylosis, progressive homolog (mouse) 56172 Q9HCJ1 CHIP-seq
Cotney J 2015
ANKLE2 Ankyrin repeat and LEM domain-containing protein 2 23141 Q86XL3 CHIP-seq
Cotney J 2015
ANKRD11 ankyrin repeat domain 11 29123 Q6UB99 CHIP-seq
Cotney J 2015
ANKRD12 ankyrin repeat domain 12 23253 Q6UB98 ChIP-chip
Subtil-Rodríguez A 2014
ANKRD13A ankyrin repeat domain 13A 88455 Q3ZTS7 ChIP-chip
Subtil-Rodríguez A 2014
ANKRD13C ankyrin repeat domain 13C 81573 Q8N6S4 ChIP-chip
Subtil-Rodríguez A 2014
ANKRD16 ankyrin repeat domain 16 54522 Q6P6B7 CHIP-seq
Cotney J 2015
ANKRD17 ankyrin repeat domain 17 26057 O75179 ChIP-chip
Subtil-Rodríguez A 2014
ANKRD32 ankyrin repeat domain 32 84250 I6L9F1 ChIP-chip
Subtil-Rodríguez A 2014
ANKRD34A ankyrin repeat domain 34A NM_001039888 Q69YU3 ChIP-chip
Subtil-Rodríguez A 2014
ANKRD40 ankyrin repeat domain 40 91369 A8IK34 ChIP-chip
Subtil-Rodríguez A 2014
ANKRD42 ankyrin repeat domain 42 NM_182603 Q8N9B4 ChIP-chip
Subtil-Rodríguez A 2014
ANKRD50 ankyrin repeat domain 50 57182 Q8TB46 ChIP-chip
Subtil-Rodríguez A 2014
ANLN anillin, actin binding protein 54443 Q9NQW6 ChIP-chip
Subtil-Rodríguez A 2014
ANO8 anoctamin 8 57719 Q9HCE9 CHIP-seq
Cotney J 2015
ANP32A acidic (leucine-rich) nuclear phosphoprotein 32 family, member A 8125 P39687 ChIP-chip
Subtil-Rodríguez A 2014
ANP32B acidic (leucine-rich) nuclear phosphoprotein 32 family, member B 10541 Q92688 CHIP-seq
Cotney J 2015
ANP32E acidic (leucine-rich) nuclear phosphoprotein 32 family, member E 81611 Q9BTT0 ChIP-chip
Subtil-Rodríguez A 2014
ANXA2 annexin A2 302 P07355 ChIP-chip
Subtil-Rodríguez A 2014
ANXA7 annexin A7 310 P20073 ChIP-chip
Subtil-Rodríguez A 2014
AOX1 aldehyde oxidase 1 316 Q06278 qRT-PCR; ChIP-qPCR
Fang M 2014
AP1G1 adaptor-related protein complex 1, gamma 1 subunit 164 O43747 ChIP-chip
Subtil-Rodríguez A 2014
AP1M1 adaptor-related protein complex 1, mu 1 subunit 8907 Q59EK3 ChIP-chip
Subtil-Rodríguez A 2014
AP1S3 adaptor-related protein complex 1, sigma 3 subunit 130340 Q96PC3 ChIP-chip
Subtil-Rodríguez A 2014
AP2A2 adaptor-related protein complex 2, alpha 2 subunit 161 O94973 CHIP-seq
Cotney J 2015
AP3B1 adaptor-related protein complex 3, beta 1 subunit 8546 E5RJ68 ChIP-chip
Subtil-Rodríguez A 2014
AP4E1 adaptor-related protein complex 4, epsilon 1 subunit 23431 B4DM48 CHIP-seq
Cotney J 2015
AP4M1 adaptor-related protein complex 4, mu 1 subunit 9179 O00189 CHIP-seq
Cotney J 2015
AP4S1 adaptor-related protein complex 4, sigma 1 subunit 11154 Q9Y587 CHIP-seq
Cotney J 2015
AP5B1 AP-5 complex subunit beta-1 91056 Q2VPB7 CHIP-seq
Cotney J 2015
AP5M1 AP-5 complex subunit mu-1 55745 Q9H0R1 CHIP-seq
Cotney J 2015
AP5S1 AP-5 complex subunit sigma-1 55317 Q9NUS5 CHIP-seq
Cotney J 2015
APBA1 Amyloid beta A4 precursor protein-binding family A member 1 320 Q02410 CHIP-seq
Cotney J 2015
APBB2 amyloid beta (A4) precursor protein-binding, family B, member 2 323 Q92870 ChIP-chip
Subtil-Rodríguez A 2014
APEH N-acylaminoacyl-peptide hydrolase 327 P13798 ChIP-chip
Subtil-Rodríguez A 2014
APEX1 APEX nuclease (multifunctional DNA repair enzyme) 1 328 P27695 ChIP-chip
Subtil-Rodríguez A 2014
API5 apoptosis inhibitor 5 8539 Q9BZZ5 CHIP-seq
Cotney J 2015
APIP APAF1 interacting protein 51074 Q96GX9 ChIP-chip
Subtil-Rodríguez A 2014
APITD1 Centromere protein S 1325 Q8N2Z9 CHIP-seq
Cotney J 2015
APITD1-CORT Centromere protein S 100526739 Q8N2Z9 CHIP-seq
Cotney J 2015
APLP1 amyloid beta (A4) precursor-like protein 1 333 P51693 CHIP-seq
Cotney J 2015
APLP2 amyloid beta (A4) precursor-like protein 2 334 Q06481 ChIP-chip
Subtil-Rodríguez A 2014
APOLD1 apolipoprotein L domain containing 1 81575 Q96LR9 ChIP-chip
Subtil-Rodríguez A 2014
APOO apolipoprotein O NM_024122 Q9BUR5 ChIP-chip
Subtil-Rodríguez A 2014
APOPT1 Apoptogenic protein 1, mitochondrial 84334 Q96IL0 CHIP-seq
Cotney J 2015
APP amyloid beta (A4) precursor protein 351 P05067 ChIP-chip
Subtil-Rodríguez A 2014
APPBP2 amyloid beta precursor protein (cytoplasmic tail) binding protein 2 10513 Q92624 ChIP-chip
Subtil-Rodríguez A 2014
APPL1 adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1 26060 Q9UKG1 ChIP-chip
Subtil-Rodríguez A 2014
APTX aprataxin 54840 Q7Z2E3 ChIP-chip
Subtil-Rodríguez A 2014
AR androgen receptor 367 P10275 IP/WB
Menon T 2010
ARAF v-raf murine sarcoma 3611 viral oncogene homolog 369 P10398 ChIP-chip
Subtil-Rodríguez A 2014
ARF1 ADP-ribosylation factor 1 375 Q8N6T3 CHIP-seq
Cotney J 2015
ARF4 ADP-ribosylation factor 4 378 P18085 ChIP-chip
Subtil-Rodríguez A 2014
ARF6 ADP-ribosylation factor 6 382 P62330 ChIP-chip
Subtil-Rodríguez A 2014
ARFGAP1 ADP-ribosylation factor GTPase activating protein 1 55738 Q8N6T3 ChIP-chip
Subtil-Rodríguez A 2014
ARFGAP2 ADP-ribosylation factor GTPase activating protein 2 84364 B4DX29 CHIP-seq
Cotney J 2015
ARFRP1 ADP-ribosylation factor related protein 1 NM_003224 Q13795 ChIP-chip
Subtil-Rodríguez A 2014
ARHGAP11A Rho GTPase activating protein 11A 9824 Q6P4F7 ChIP-chip
Subtil-Rodríguez A 2014
ARHGAP11B Rho GTPase activating protein 11B NM_001039841 Q3KRB8 ChIP-chip
Subtil-Rodríguez A 2014
ARHGAP21 Rho GTPase activating protein 21 57584 Q5T5U3 ChIP-chip
Subtil-Rodríguez A 2014
ARHGAP5 Rho GTPase activating protein 5 394 Q13017 ChIP-chip
Subtil-Rodríguez A 2014
ARHGDIA Rho GDP dissociation inhibitor (GDI) alpha 396 P52565 CHIP-seq
Cotney J 2015
ARHGEF11 Rho guanine nucleotide exchange factor (GEF) 11 9826 O15085 CHIP-seq
Cotney J 2015
ARHGEF12 Rho guanine nucleotide exchange factor (GEF) 12 23365 B4E2K6 ChIP-chip
Subtil-Rodríguez A 2014
ARID1A AT rich interactive domain 1A (SWI-like) 8289 O14497 ChIP-chip
Subtil-Rodríguez A 2014
ARID1B AT rich interactive domain 1B (SWI1-like) 57492 Q8NFD5 CHIP-seq
Cotney J 2015
ARID2 AT rich interactive domain 2 (ARID, RFX-like) 196528 Q68CP9 CHIP-seq
Cotney J 2015
ARID3A AT rich interactive domain 3A (BRIGHT-like) 1820 Q99856 CHIP-seq
Cotney J 2015
ARID4A AT rich interactive domain 4A (RBP1-like) 5926 P29374 CHIP-seq
Cotney J 2015
ARID4B AT rich interactive domain 4B (RBP1-like) 51742 Q4LE39 CHIP-seq
Cotney J 2015
ARID5B AT rich interactive domain 5B (MRF1-like) 84159 Q14865 CHIP-seq
Cotney J 2015
ARIH1 ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 (Drosophila) 25820 Q9Y4X5 ChIP-chip
Subtil-Rodríguez A 2014
ARL13B ADP-ribosylation factor-like 13B 200894 Q3SXY8 ChIP-chip
Subtil-Rodríguez A 2014
ARL17P1 ADP-ribosylation factor-like 17A NM_001113738 A8K0M5 ChIP-chip
Subtil-Rodríguez A 2014
ARL2BP ADP-ribosylation factor-like 2 binding protein 23568 Q9Y2Y0 CHIP-seq
Cotney J 2015
ARL3 ADP-ribosylation factor-like 3 NM_004311 P36405 ChIP-chip
Subtil-Rodríguez A 2014
ARL4A ADP-ribosylation factor-like 4A NM_001037164 A0A024R9Z2 ChIP-chip
Subtil-Rodríguez A 2014
ARL5A ADP-ribosylation factor-like 5A 26225 Q9Y689 CHIP-seq
Cotney J 2015
ARL5B ADP-ribosylation factor-like 5B 221079 B0YIW9 ChIP-chip
Subtil-Rodríguez A 2014
ARL6 ADP-ribosylation factor-like 6 NM_177976 Q9H0F7 ChIP-chip
Subtil-Rodríguez A 2014
ARL6IP1 ADP-ribosylation factor-like 6 interacting protein 1 23204 Q15041 ChIP-chip
Subtil-Rodríguez A 2014
ARL6IP6 ADP-ribosylation-like factor 6 interacting protein 6 151188 B3KMZ5 ChIP-chip
Subtil-Rodríguez A 2014
ARL8A ADP-ribosylation factor-like 8A 127829 Q96BM9 CHIP-seq
Cotney J 2015
ARMC1 armadillo repeat containing 1 55156 Q9NVT9 ChIP-chip
Subtil-Rodríguez A 2014
ARMC5 armadillo repeat containing 5 79798 Q96C12 CHIP-seq
Cotney J 2015
ARMC6 armadillo repeat containing 6 93436 Q6NXE6 CHIP-seq
Cotney J 2015
ARMCX5 armadillo repeat containing, X-linked 5 NM_022838 Q6P1M9 ChIP-chip
Subtil-Rodríguez A 2014
ARPC4 actin related protein 2/3 complex, subunit 4, 20kDa 10093 F6TTL5 ChIP-chip
Subtil-Rodríguez A 2014
ARPC4-TTLL3 Protein ARPC4-TTLL3 100526693 A0A0A6YYG9 CHIP-seq
Cotney J 2015
ARPC5 actin related protein 2/3 complex, subunit 5, 16kDa 10092 O15511 ChIP-chip
Subtil-Rodríguez A 2014
ARPP19 cAMP-regulated phosphoprotein, 19kDa 10776 P56211 ChIP-chip
Subtil-Rodríguez A 2014
ARRDC3 arrestin domain containing 3 57561 Q96B67 ChIP-chip
Subtil-Rodríguez A 2014
ARRDC3-AS1 ARRDC3 antisense RNA 1 100129716 NA CHIP-seq
Cotney J 2015
ARSB arylsulfatase B 411 P15848 ChIP-chip
Subtil-Rodríguez A 2014
ARSK arylsulfatase family, member K NM_198150 Q6UWY0 ChIP-chip
Subtil-Rodríguez A 2014
ARV1 ARV1 homolog (S. cerevisiae) 64801 Q9H2C2 ChIP-chip
Subtil-Rodríguez A 2014
ASAP2 ArfGAP with SH3 domain, ankyrin repeat and PH domain 2 8853 O43150 CHIP-seq
Cotney J 2015
ASB6 ankyrin repeat and SOCS box containing 6 140459 Q9NWX5 CHIP-seq
Cotney J 2015
ASB7 ankyrin repeat and SOCS box containing 7 140460 Q9H672 CHIP-seq
Cotney J 2015
ASCC3 activating signal cointegrator 1 complex subunit 3 10973 Q8N3C0 ChIP-chip
Subtil-Rodríguez A 2014
ASF1A Histone chaperone ASF1A 25842 Q9Y294 CHIP-seq
Cotney J 2015
ASF1B ASF1 anti-silencing function 1 homolog B (S. cerevisiae) 55723 Q9NVP2 ChIP-chip
Subtil-Rodríguez A 2014
ASH1L ash1 (absent, small, or homeotic)-like (Drosophila) 55870 Q9NR48 CHIP-seq
Cotney J 2015
ASH1L-AS1 ASH1L antisense RNA 1 645676 NA CHIP-seq
Cotney J 2015
ASH2L ash2 (absent, small, or homeotic)-like (Drosophila) 9070 Q9UBL3 IP; Bimolecular fluorescence complementation assay; IP/WB; Y2H
Yates JA 2010
ASNA1 arsA arsenite transporter, ATP-binding, homolog 1 (bacterial) NM_004317 O43681 ChIP-chip
Subtil-Rodríguez A 2014
ASPM asp (abnormal spindle) homolog, microcephaly associated (Drosophila) 259266 B3KWI2 ChIP-chip
Subtil-Rodríguez A 2014
ASPSCR1 alveolar soft part sarcoma chromosome region, candidate 1 79058 Q9BZE9 CHIP-seq
Cotney J 2015
ASXL1 additional sex combs like 1 (Drosophila) 171023 Q498B9 ChIP-chip
Subtil-Rodríguez A 2014
ATAD2B ATPase family, AAA domain containing 2B 54454 Q9ULI0 CHIP-seq
Cotney J 2015
ATAD3A ATPase family, AAA domain containing 3A 55210 Q9NVI7 CHIP-seq
Cotney J 2015
ATAD5 ATPase family, AAA domain containing 5 79915 Q96QE3 ChIP-chip
Subtil-Rodríguez A 2014
ATE1 arginyltransferase 1 11101 O95260 ChIP-chip
Subtil-Rodríguez A 2014
ATF1 activating transcription factor 1 466 P18846 ChIP-chip
Subtil-Rodríguez A 2014
ATF2 activating transcription factor 2 1386 P15336 CHIP-seq
Cotney J 2015
ATF6 activating transcription factor 6 22926 A8K383 ChIP-chip
Subtil-Rodríguez A 2014
ATF7 activating transcription factor 7 NM_006856 P17544 ChIP-chip
Subtil-Rodríguez A 2014
ATF7IP activating transcription factor 7 interacting protein 55729 Q6VMQ6 ChIP-chip
Subtil-Rodríguez A 2014
ATG16L1 autophagy related 16-like 1 (S. cerevisiae) 55054 Q53SV2 ChIP-chip
Subtil-Rodríguez A 2014
ATG16L2 autophagy related 16-like 2 (S. cerevisiae) NM_033388 Q8NAA4 ChIP-chip
Subtil-Rodríguez A 2014
ATG3 Ubiquitin-like-conjugating enzyme ATG3 64422 Q9NT62 CHIP-seq
Cotney J 2015
ATG4B autophagy related 4B, cysteine peptidase 23192 B3KVU2 CHIP-seq
Cotney J 2015
ATG4C autophagy related 4C, cysteine peptidase 84938 Q96DT6 ChIP-chip
Subtil-Rodríguez A 2014
ATG5 autophagy related 5 9474 A9UGY9 ChIP-chip
Subtil-Rodríguez A 2014
ATL1 Atlastin-1 51062 Q8WXF7 CHIP-seq
Cotney J 2015
ATL2 atlastin GTPase 2 64225 Q8NHH9 ChIP-chip
Subtil-Rodríguez A 2014
ATL3 atlastin GTPase 3 25923 Q6DD88 ChIP-chip
Subtil-Rodríguez A 2014
ATM ataxia telangiectasia mutated 472 Q13315 ChIP-chip
Subtil-Rodríguez A 2014
ATN1 atrophin 1 1822 P54259 ChIP-chip
Subtil-Rodríguez A 2014
ATP10D CYFIP1 57205 Q9P241 ChIP-chip
Subtil-Rodríguez A 2014
ATP11A ATPase, class VI, type 11A 23250 P98196 ChIP-chip
Subtil-Rodríguez A 2014
ATP11B ATPase, class VI, type 11B 23200 B4DKX1 ChIP-chip
Subtil-Rodríguez A 2014
ATP1A1 ATPase, Na+/K+ transporting, alpha 1 polypeptide 476 P05023 ChIP-chip
Subtil-Rodríguez A 2014
ATP2A1 ATPase, Ca++ transporting, cardiac muscle, fast twitch 1 487 O14983 ChIP-chip
Subtil-Rodríguez A 2014
ATP2A2 ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 488 P16615 CHIP-seq
Cotney J 2015
ATP5A1 ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle 498 P25705 ChIP-chip
Subtil-Rodríguez A 2014
ATP5B ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide 506 P06576 ChIP-chip
Subtil-Rodríguez A 2014
ATP5E ATP synthase, H+ transporting, mitochondrial F1 complex, epsilon subunit NM_006886 P56381 ChIP-chip
Subtil-Rodríguez A 2014
ATP5F1 ATP synthase, H+ transporting, mitochondrial Fo complex, subunit B1 515 P24539 ChIP-chip
Subtil-Rodríguez A 2014
ATP5G1 ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C1 (subunit 9) 516 P05496 ChIP-chip
Subtil-Rodríguez A 2014
ATP5G2 ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C2 (subunit 9) 517 Q06055 ChIP-chip
Subtil-Rodríguez A 2014
ATP5I ATP synthase, H+ transporting, mitochondrial Fo complex, subunit E 521 P56385 ChIP-chip
Subtil-Rodríguez A 2014
ATP5J ATP synthase, H+ transporting, mitochondrial Fo complex, subunit F6 522 P18859 ChIP-chip
Subtil-Rodríguez A 2014
ATP6V0C ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c 527 P27449 CHIP-seq
Cotney J 2015
ATP6V0D1 ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d1 NM_004691 P61421 ChIP-chip
Subtil-Rodríguez A 2014
ATP6V1A ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A 523 P38606 ChIP-chip
Subtil-Rodríguez A 2014
ATP6V1G1 ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G1 9550 O75348 ChIP-chip
Subtil-Rodríguez A 2014
ATP6V1G2 ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G2 534 Q2L6F8 CHIP-seq
Cotney J 2015
ATP6V1G2-DDX39B ATP6V1G2-DDX39B readthrough (NMD candidate) 100532737 NA CHIP-seq
Cotney J 2015
ATP9A ATPase, class II, type 9A 10079 O75110 CHIP-seq
Cotney J 2015
ATPAF2 ATP synthase mitochondrial F1 complex assembly factor 2 NM_145691 Q8N5M1 ChIP-chip
Subtil-Rodríguez A 2014
ATPBD4 diphthamine biosynthesis 6 NM_001141972 Q7L8W6 ChIP-chip
Subtil-Rodríguez A 2014
ATR ataxia telangiectasia and Rad3 related 545 Q13535 ChIP-chip
Subtil-Rodríguez A 2014
ATRAID All-trans retinoic acid-induced differentiation factor 51374 Q6UW56 CHIP-seq
Cotney J 2015
ATRN attractin 8455 B4DZ36 CHIP-seq
Cotney J 2015
ATRNL1 attractin-like 1 26033 Q5VV63 CHIP-seq
Cotney J 2015
ATXN10 ataxin 10 25814 Q9UBB4 CHIP-seq
Cotney J 2015
ATXN2 ataxin 2 6311 Q99700 CHIP-seq
Cotney J 2015
ATXN2L ataxin 2-like 11273 Q8WWM7 ChIP-chip
Subtil-Rodríguez A 2014
ATXN3 ataxin 3 4287 E9PB63 CHIP-seq
Cotney J 2015
ATXN7 ataxin 7 6314 O15265 CHIP-seq
Cotney J 2015
ATXN7L2 ataxin 7-like 2 127002 Q5T6C5 CHIP-seq
Cotney J 2015
ATXN7L3B Putative ataxin-7-like protein 3B 552889 Q96GX2 CHIP-seq
Cotney J 2015
AUP1 ancient ubiquitous protein 1 550 Q9Y679 ChIP-chip
Subtil-Rodríguez A 2014
AUTS2 Autism susceptibility gene 2 protein 26053 Q8WXX7 CHIP-seq
Cotney J 2015
AVEN Cell death regulator Aven 57099 Q9NQS1 CHIP-seq
Cotney J 2015
AVL9 AVL9 homolog (S. cerevisiase) 23080 Q8NBF6 CHIP-seq
Cotney J 2015
AXIN2 axin 2 8313 Q9Y2T1 ChIP-qPCR; Bimolecular fluorescence complementation assay; IP/WB; Y2H
Thompson BA 2008
AZIN1 antizyme inhibitor 1 51582 O14977 ChIP-chip
Subtil-Rodríguez A 2014
B2M beta-2-microglobulin NM_004048 P61769 ChIP-chip
Subtil-Rodríguez A 2014
B3GALNT2 beta-1,3-N-acetylgalactosaminyltransferase 2 148789 Q8NCR0 ChIP-chip
Subtil-Rodríguez A 2014
B3GALTL beta 1,3-galactosyltransferase-like 145173 Q6Y288 CHIP-seq
Cotney J 2015
B4GALNT1 Beta-1,4 N-acetylgalactosaminyltransferase 1 2583 Q00973 CHIP-seq
Cotney J 2015
B4GALT5 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5 9334 O43286 CHIP-seq
Cotney J 2015
B4GALT6 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 6 9331 Q9UBX8 CHIP-seq
Cotney J 2015
B4GALT7 DNM1L 11285 Q9UBV7 ChIP-chip
Subtil-Rodríguez A 2014
B9D1 B9 protein domain 1 NM_015681 B4DN64 ChIP-chip
Subtil-Rodríguez A 2014
BACH1 BTB and CNC homology 1, basic leucine zipper transcription factor 1 571 O14867 IP/WB; ChIP-chip
Fang M 2014
BACH2 BTB and CNC homology 1, basic leucine zipper transcription factor 2 60468 Q9BYV9 ChIP-chip
Subtil-Rodríguez A 2014
BAD Bcl2-associated agonist of cell death 572 Q92934 CHIP-seq
Cotney J 2015
BAG2 BCL2-associated athanogene 2 9532 O95816 ChIP-chip
Subtil-Rodríguez A 2014
BAG5 BCL2-associated athanogene 5 9529 Q9UL15 CHIP-seq
Cotney J 2015
BAHCC1 DPP6 57597 Q9P281 ChIP-chip
Subtil-Rodríguez A 2014
BANF1 barrier to autointegration factor 1 8815 O75531 CHIP-seq
Cotney J 2015
BANP BTG3 associated nuclear protein 54971 B3KM38 ChIP-chip
Subtil-Rodríguez A 2014
BAP1 BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase) 8314 Q92560 ChIP-chip
Subtil-Rodríguez A 2014
BASP1 Brain acid soluble protein 1 10409 P80723 CHIP-seq
Cotney J 2015
BAT1 DEAD (Asp-Glu-Ala-Asp) box polypeptide 39B NM_080598 A0A024RCM3 ChIP-chip
Subtil-Rodríguez A 2014
BAT2 proline-rich coiled-coil 2A 7916 P48634 ChIP-chip
Subtil-Rodríguez A 2014
BAT2L proline-rich coiled-coil 2B NM_013318 Q5JSZ5 ChIP-chip
Subtil-Rodríguez A 2014
BAT3 BCL2-associated athanogene 6 7917 P46379 ChIP-chip
Subtil-Rodríguez A 2014
BAT4 G patch domain and ankyrin repeats 1 NM_033177 A0A024RCU2 ChIP-chip
Subtil-Rodríguez A 2014
BAT5 DUSP22 7920 B3KNX9 ChIP-chip
Subtil-Rodríguez A 2014
BAZ1B bromodomain adjacent to zinc finger domain, 1B 9031 Q9UIG0 CHIP-seq
Cotney J 2015
BBS10 Bardet-Biedl syndrome 10 79738 Q8TAM1 ChIP-chip
Subtil-Rodríguez A 2014
BBS4 Bardet-Biedl syndrome 4 585 Q96RK4 ChIP-chip
Subtil-Rodríguez A 2014
BBS5 Bardet-Biedl syndrome 5 129880 Q8N3I7 ChIP-chip
Subtil-Rodríguez A 2014
BBX bobby sox homolog (Drosophila) 56987 A8K6U2 ChIP-chip
Subtil-Rodríguez A 2014
BCAR1 breast cancer anti-estrogen resistance 1 9564 B4DEV4 CHIP-seq
Cotney J 2015
BCAR3 breast cancer anti-estrogen resistance 3 8412 O75815 CHIP-seq
Cotney J 2015
BCAS2 breast carcinoma amplified sequence 2 10286 B2R7W3 ChIP-chip
Subtil-Rodríguez A 2014
BCAS4 breast carcinoma amplified sequence 4 NM_017843 H7BXG3 ChIP-chip
Subtil-Rodríguez A 2014
BCAT1 branched chain amino-acid transaminase 1, cytosolic 586 P54687 ChIP-chip
Subtil-Rodríguez A 2014
BCCIP BRCA2 and CDKN1A interacting protein 56647 Q9P287 ChIP-chip
Subtil-Rodríguez A 2014
BCL2 B-cell CLL/lymphoma 2 596 P10415 ChIP-chip
Subtil-Rodríguez A 2014
BCL2L1 BCL2-like 1 598 Q07817 ChIP-chip
Subtil-Rodríguez A 2014
BCL2L12 BCL2-like 12 (proline rich) 83596 Q9HB09 ChIP-chip
Subtil-Rodríguez A 2014
BCL2L13 BCL2-like 13 (apoptosis facilitator) 23786 Q9BXK5 ChIP-chip
Subtil-Rodríguez A 2014
BCL7A B-cell CLL/lymphoma 7A 605 Q4VC05 CHIP-seq
Cotney J 2015
BCL9 B-cell CLL/lymphoma 9 607 O00512 CHIP-seq
Cotney J 2015
BCR breakpoint cluster region 613 P11274 ChIP-chip
Subtil-Rodríguez A 2014
BEND3 BEN domain containing 3 57673 Q5T5X7 CHIP-seq
Cotney J 2015
BEND5 BEN domain containing 5 79656 Q7L4P6 CHIP-seq
Cotney J 2015
BFAR bifunctional apoptosis regulator 51283 Q9NZS9 ChIP-chip
Subtil-Rodríguez A 2014
BHLHE41 basic helix-loop-helix family, member e41 79365 Q8TAT1 ChIP-chip
Subtil-Rodríguez A 2014
BICD2 bicaudal D homolog 2 (Drosophila) 23299 Q8TD16 CHIP-seq
Cotney J 2015
BIRC6 baculoviral IAP repeat containing 6 57448 Q9NR09 CHIP-seq
Cotney J 2015
BIVM basic, immunoglobulin-like variable motif containing 54841 Q86UB2 CHIP-seq
Cotney J 2015
BLK Tyrosine-protein kinase Blk 640 P51451 ChIP-chip
Subtil-Rodríguez A 2014
BLMH bleomycin hydrolase 642 Q13867 CHIP-seq
Cotney J 2015
BLOC1S6 biogenesis of lysosomal organelles complex-1, subunit 6, pallidin 26258 B3KY40 CHIP-seq
Cotney J 2015
BLZF1 basic leucine zipper nuclear factor 1 8548 Q9H2G9 ChIP-chip
Subtil-Rodríguez A 2014
BMI1 BMI1 polycomb ring finger oncogene 648 P35226 CHIP-seq
Cotney J 2015
BMPR1A bone morphogenetic protein receptor, type IA 657 P36894 CHIP-seq
Cotney J 2015
BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) 659 Q13873 ChIP-chip
Subtil-Rodríguez A 2014
BMS1 BMS1 homolog, ribosome assembly protein (yeast) 9790 Q14692 ChIP-chip
Subtil-Rodríguez A 2014
BMS1P4 BMS1 pseudogene 4 NR_026592 ChIP-chip
Subtil-Rodríguez A 2014
BMS1P5 BMS1 pseudogene 5 NR_003611 ChIP-chip
Subtil-Rodríguez A 2014
BNC2 basonuclin 2 54796 Q6ZN30 ChIP-chip
Subtil-Rodríguez A 2014
BNIP1 BCL2/adenovirus E1B 19kDa interacting protein 1 NM_013980 Q12981 ChIP-chip
Subtil-Rodríguez A 2014
BNIP2 BCL2/adenovirus E1B 19kDa interacting protein 2 663 J3KN59 ChIP-chip
Subtil-Rodríguez A 2014
BNIP3L BCL2/adenovirus E1B 19kDa interacting protein 3-like 665 O60238 CHIP-seq
Cotney J 2015
BOD1 biorientation of chromosomes in cell division 1 91272 Q96IK1 ChIP-chip
Subtil-Rodríguez A 2014
BOD1L biorientation of chromosomes in cell division 1-like 1 259282 Q8NFC6 ChIP-chip
Subtil-Rodríguez A 2014
BOLA3 bolA homolog 3 (E. coli) 388962 Q53S33 ChIP-chip
Subtil-Rodríguez A 2014
BOLA3-AS1 BOLA3 antisense RNA 1 (head to head) 100507171 NA CHIP-seq
Cotney J 2015
BPGM 2,3-bisphosphoglycerate mutase 669 P07738 ChIP-chip
Subtil-Rodríguez A 2014
BPNT1 3'(2'), 5'-bisphosphate nucleotidase 1 NM_006085 O95861 ChIP-chip
Subtil-Rodríguez A 2014
BPTF bromodomain PHD finger transcription factor 2186 Q12830 CHIP-seq
Cotney J 2015
BRAF Serine/threonine-protein kinase B-raf 673 P15056 ChIP-chip
Subtil-Rodríguez A 2014
BRCA1 breast cancer 1, early onset 672 P38398 ChIP; Bimolecular fluorescence complementation assay; IP/WB; Y2H
Ishihara K 2006
BRD2 bromodomain containing 2 6046 P25440 ChIP-chip
Subtil-Rodríguez A 2014
BRD8 bromodomain containing 8 10902 Q9H0E9 ChIP-chip
Subtil-Rodríguez A 2014
BRD9 Bromodomain-containing protein 9 65980 Q9H8M2 CHIP-seq
Cotney J 2015
BRF2 BRF2, subunit of RNA polymerase III transcription initiation factor, BRF1-like 55290 Q9HAW0 ChIP-chip
Subtil-Rodríguez A 2014
BRIX1 BRX1, biogenesis of ribosomes, homolog (S. cerevisiae) 55299 Q8TDN6 ChIP-chip
Subtil-Rodríguez A 2014
BRMS1 breast cancer metastasis suppressor 1 25855 G5E9I4 ChIP-chip
Subtil-Rodríguez A 2014
BRP44 mitochondrial pyruvate carrier 2 NM_015415 A0A024R8Z5 ChIP-chip
Subtil-Rodríguez A 2014
BRWD1 bromodomain and WD repeat domain containing 1 54014 Q9NSI6 CHIP-seq
Cotney J 2015
BRWD1-AS1 BRWD1 antisense RNA 1 100874093 NA CHIP-seq
Cotney J 2015
BRWD1-IT2 103091865 NA CHIP-seq
Cotney J 2015
BSCL2 Berardinelli-Seip congenital lipodystrophy 2 (seipin) NM_001130702 A0A024R540 ChIP-chip
Subtil-Rodríguez A 2014
BTAF1 BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa (Mot1 homolog, S. cerevisiae) 9044 O14981 ChIP-chip
Subtil-Rodríguez A 2014
BTBD1 BTB (POZ) domain containing 1 53339 Q9H0C5 ChIP-chip
Subtil-Rodríguez A 2014
BTBD2 BTB (POZ) domain containing 2 55643 Q9BX70 ChIP-chip
Subtil-Rodríguez A 2014
BTF3 basic transcription factor 3 689 P20290 ChIP-chip
Subtil-Rodríguez A 2014
BTF3L4 basic transcription factor 3-like 4 91408 Q96K17 ChIP-chip
Subtil-Rodríguez A 2014
BTG3 BTG family, member 3 10950 Q14201 ChIP-chip
Subtil-Rodríguez A 2014
BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 8945 B2R8L3 ChIP-chip
Subtil-Rodríguez A 2014
BUD13 BUD13 homolog (S. cerevisiae) 84811 Q9BRD0 CHIP-seq
Cotney J 2015
BZW1 basic leucine zipper and W2 domains 1 9689 Q3LIC9 CHIP-seq
Cotney J 2015
C10orf104 anaphase promoting complex subunit 16 NM_173473 C5H3H2 ChIP-chip
Subtil-Rodríguez A 2014
C10orf114 cancer susceptibility candidate 10 NM_001010911 Q5T4H9 ChIP-chip
Subtil-Rodríguez A 2014
C10orf119 minichromosome maintenance complex binding protein NM_024834 Q9BTE3 ChIP-chip
Subtil-Rodríguez A 2014
C10orf137 chromosome 10 open reading frame 137 26098 Q3B7T1 ChIP-chip
Subtil-Rodríguez A 2014
C10orf140 chromosome 10 open reading frame 140 387640 Q1XH10 ChIP-chip
Subtil-Rodríguez A 2014
C10orf2 chromosome 10 open reading frame 2 56652 Q96RR1 ChIP-chip
Subtil-Rodríguez A 2014
C10ORF25 Uncharacterized protein C10orf25 220979 Q5T742 CHIP-seq
Cotney J 2015
C10orf28 R3H domain and coiled-coil containing 1-like 27291 D3DR60 ChIP-chip
Subtil-Rodríguez A 2014
C10orf4 fragile site, folic acid type, rare, fra(10)(q23.3) or fra(10)(q24.2) candidate 1 NM_145246 Q70Z53 ChIP-chip
Subtil-Rodríguez A 2014
C10orf57 transmembrane protein 254 NM_025125 B4DU43 ChIP-chip
Subtil-Rodríguez A 2014
C10orf78 SWI5-dependent recombination repair 1 NM_145247 Q86XK3 ChIP-chip
Subtil-Rodríguez A 2014
C11orf10 transmembrane protein 258 NM_014206 P61165 ChIP-chip
Subtil-Rodríguez A 2014
C11orf30 chromosome 11 open reading frame 30 56946 Q7Z589 ChIP-chip
Subtil-Rodríguez A 2014
C11orf46 ADP-ribosylation factor-like 14 effector protein 120534 Q8N8R7 ChIP-chip
Subtil-Rodríguez A 2014
C11orf48 chromosome 11 open reading frame 48 79081 Q9BQE6 ChIP-chip
Subtil-Rodríguez A 2014
C11orf58 chromosome 11 open reading frame 58 10944 O00193 ChIP-chip
Subtil-Rodríguez A 2014
C11orf59 late endosomal/lysosomal adaptor, MAPK and MTOR activator 1 NM_017907 Q6IAA8 ChIP-chip
Subtil-Rodríguez A 2014
C11ORF68 UPF0696 protein C11orf68 83638 Q9H3H3 CHIP-seq
Cotney J 2015
C11orf82 chromosome 11 open reading frame 82 220042 Q8IXT1 ChIP-chip
Subtil-Rodríguez A 2014
C11ORF84 chromosome 11 open reading frame 84 144097 Q9BUA3 CHIP-seq
Cotney J 2015
C11ORF95 Uncharacterized protein C11orf95 65998 C9JLR9 CHIP-seq
Cotney J 2015
C12orf10 chromosome 12 open reading frame 10 60314 Q86UA3 ChIP-chip
Subtil-Rodríguez A 2014
C12ORF23 chromosome 12 open reading frame 23 90488 Q8WUH6 CHIP-seq
Cotney J 2015
C12orf30 N(alpha)-acetyltransferase 25, NatB auxiliary subunit NM_024953 Q14CX7 ChIP-chip
Subtil-Rodríguez A 2014
C12ORF52 chromosome 12 open reading frame 52 84934 Q96K30 CHIP-seq
Cotney J 2015
C12orf57 chromosome 12 open reading frame 57 113246 Q99622 ChIP-chip
Subtil-Rodríguez A 2014
C12ORF60 Uncharacterized protein C12orf60 144608 Q5U649 CHIP-seq
Cotney J 2015
C12ORF61 Putative uncharacterized protein encoded by LINC01465 283416 Q8N7H1 CHIP-seq
Cotney J 2015
C12orf65 chromosome 12 open reading frame 65 91574 Q9H3J6 ChIP-chip
Subtil-Rodríguez A 2014
C12orf72 methyltransferase like 20 NM_173802 Q8IXQ9 ChIP-chip
Subtil-Rodríguez A 2014
C13orf23 proline and serine rich 1 NM_025138 Q86XN7 ChIP-chip
Subtil-Rodríguez A 2014
C14orf101 transmembrane protein 260 NM_017799 B3KN73 ChIP-chip
Subtil-Rodríguez A 2014
C14orf106 MIS18 binding protein 1 NM_018353 Q6P0N0 ChIP-chip
Subtil-Rodríguez A 2014
C14orf119 chromosome 14 open reading frame 119 NM_017924 Q9NWQ9 ChIP-chip
Subtil-Rodríguez A 2014
C14orf135 chromosome 14 open reading frame 135 64430 Q63HM2 ChIP-chip
Subtil-Rodríguez A 2014
C14orf178 chromosome 14 open reading frame 178 NM_174943 F8WAD5 ChIP-chip
Subtil-Rodríguez A 2014
C14orf181 NM_207442 ChIP-chip
Subtil-Rodríguez A 2014
C14orf33 KTN1 antisense RNA 1 NR_027123 Q86SY8 ChIP-chip
Subtil-Rodríguez A 2014
C14ORF80 chromosome 14 open reading frame 80 283643 E9PAQ4 CHIP-seq
Cotney J 2015
C14orf93 chromosome 14 open reading frame 93 NM_001130706 Q9H972 ChIP-chip
Subtil-Rodríguez A 2014
C15orf23 kinetochore-localized astrin/SPAG5 binding protein 90417 Q9Y448 ChIP-chip
Subtil-Rodríguez A 2014
C15orf33 family with sequence similarity 227, member B NM_152647 Q96M60 ChIP-chip
Subtil-Rodríguez A 2014
C16orf45 chromosome 16 open reading frame 45 NM_033201 Q96MC5 ChIP-chip
Subtil-Rodríguez A 2014
C16orf58 chromosome 16 open reading frame 58 64755 Q96GQ5 ChIP-chip
Subtil-Rodríguez A 2014
C16orf61 C-x(9)-C motif containing 2 NM_020188 Q9NRP2 ChIP-chip
Subtil-Rodríguez A 2014
C16orf62 chromosome 16 open reading frame 62 57020 E7EWW0 ChIP-chip
Subtil-Rodríguez A 2014
C16orf7 VPS9 domain containing 1 NM_004913 Q9Y2B5 ChIP-chip
Subtil-Rodríguez A 2014
C16orf72 chromosome 16 open reading frame 72 29035 Q14CZ0 ChIP-chip
Subtil-Rodríguez A 2014
C16orf80 chromosome 16 open reading frame 80 29105 Q9Y6A4 ChIP-chip
Subtil-Rodríguez A 2014
C16ORF87 chromosome 16 open reading frame 87 388272 Q6PH81 CHIP-seq
Cotney J 2015
C16orf88 chromosome 16 open reading frame 88 400506 Q1ED39 ChIP-chip
Subtil-Rodríguez A 2014
C17orf59 chromosome 17 open reading frame 59 NM_017622 Q96GS4 ChIP-chip
Subtil-Rodríguez A 2014
C17orf70 chromosome 17 open reading frame 70 80233 A4ZI32 ChIP-chip
Subtil-Rodríguez A 2014
C17ORF75 chromosome 17 open reading frame 75 64149 Q9HAS0 CHIP-seq
Cotney J 2015
C17orf90 oxidoreductase-like domain containing 1 339229 Q5BKU9 ChIP-chip
Subtil-Rodríguez A 2014
C18orf25 chromosome 18 open reading frame 25 147339 Q96B23 ChIP-chip
Subtil-Rodríguez A 2014
C18orf32 chromosome 18 open reading frame 32 497661 Q8TCD1 ChIP-chip
Subtil-Rodríguez A 2014
C18orf54 chromosome 18 open reading frame 54 162681 I7GY12 ChIP-chip
Subtil-Rodríguez A 2014
C18orf55 translocase of inner mitochondrial membrane 21 homolog (yeast) 29090 A8K1K8 ChIP-chip
Subtil-Rodríguez A 2014
C19orf12 chromosome 19 open reading frame 12 83636 Q9NSK7 ChIP-chip
Subtil-Rodríguez A 2014
C19orf2 URI1, prefoldin-like chaperone 8725 O94763 ChIP-chip
Subtil-Rodríguez A 2014
C19orf39 SWIM-type zinc finger 7 associated protein 1 NM_175871 Q6NVH7 ChIP-chip
Subtil-Rodríguez A 2014
C19ORF43 chromosome 19 open reading frame 43 79002 Q9BQ61 CHIP-seq
Cotney J 2015
C19orf48 chromosome 19 open reading frame 48 84798 Q6RUI8 ChIP-chip
Subtil-Rodríguez A 2014
C19orf54 chromosome 19 open reading frame 54 284325 Q5BKX5 ChIP-chip
Subtil-Rodríguez A 2014
C19orf55 chromosome 19 open reading frame 55 148137 Q2NL68 ChIP-chip
Subtil-Rodríguez A 2014
C19ORF60 Uncharacterized protein C19orf60 55049 Q96EN9 CHIP-seq
Cotney J 2015
C19orf61 SMG9 nonsense mediated mRNA decay factor NM_019108 A0A024R0Q0 ChIP-chip
Subtil-Rodríguez A 2014
C19orf62 BRISC and BRCA1 A complex member 1 NM_014173 A0A024R7L2 ChIP-chip
Subtil-Rodríguez A 2014
C19orf76 adrenomedullin 5 (putative) NM_001101340 C9JUS6 ChIP-chip
Subtil-Rodríguez A 2014
C1D C1D nuclear receptor corepressor 10438 Q13901 CHIP-seq
Cotney J 2015
C1orf107 digestive organ expansion factor homolog (zebrafish) NM_014388 Q68CQ4 ChIP-chip
Subtil-Rodríguez A 2014
C1orf109 chromosome 1 open reading frame 109 54955 Q9NX04 ChIP-chip
Subtil-Rodríguez A 2014
C1orf112 chromosome 1 open reading frame 112 55732 Q9NSG2 ChIP-chip
Subtil-Rodríguez A 2014
C1ORF122 chromosome 1 open reading frame 122 127687 E9PQ13 CHIP-seq
Cotney J 2015
C1orf151 mitochondrial inner membrane organizing system 1 NM_001032363 Q5TGZ0 ChIP-chip
Subtil-Rodríguez A 2014
C1orf156 methyltransferase like 18 NM_033418 A0A024R8Y7 ChIP-chip
Subtil-Rodríguez A 2014
C1ORF174 chromosome 1 open reading frame 174 339448 Q8IYL3 CHIP-seq
Cotney J 2015
C1orf182 TSSK6 activating co-chaperone NM_144627 Q96A04 ChIP-chip
Subtil-Rodríguez A 2014
C1ORF198 chromosome 1 open reading frame 198 84886 B3KTW1 CHIP-seq
Cotney J 2015
C1ORF21 chromosome 1 open reading frame 21 81563 Q9H246 CHIP-seq
Cotney J 2015
C1orf213 chromosome 1 open reading frame 213 148898 Q8NC38 ChIP-chip
Subtil-Rodríguez A 2014
C1orf231 coiled-coil domain containing 163, pseudogene NM_001102601 ChIP-chip
Subtil-Rodríguez A 2014
C1orf27 chromosome 1 open reading frame 27 54953 Q5SWX8 ChIP-chip
Subtil-Rodríguez A 2014
C1ORF35 chromosome 1 open reading frame 35 79169 Q9BU76 CHIP-seq
Cotney J 2015
C1orf43 chromosome 1 open reading frame 43 25912 Q9BWL3 ChIP-chip
Subtil-Rodríguez A 2014
C1orf52 chromosome 1 open reading frame 52 148423 Q8N6N3 ChIP-chip
Subtil-Rodríguez A 2014
C1orf55 SDE2 telomere maintenance homolog (S. pombe) NM_152608 Q6IQ49 ChIP-chip
Subtil-Rodríguez A 2014
C1orf71 consortin, connexin sorting protein NM_001139459 Q6PJW8 ChIP-chip
Subtil-Rodríguez A 2014
C1orf83 transcription elongation factor A (SII) N-terminal and central domain containing 2 NM_153035 Q96MN5 ChIP-chip
Subtil-Rodríguez A 2014
C1orf9 SUN domain containing ossification factor 51430 Q9UBS9 ChIP-chip
Subtil-Rodríguez A 2014
C1orf96 centriole, cilia and spindle-associated protein 126731 Q6IQ19 ChIP-chip
Subtil-Rodríguez A 2014
C1orf97 long intergenic non-protein coding RNA 467 NR_026761 Q9BRT7 ChIP-chip
Subtil-Rodríguez A 2014
C1QBP complement component 1, q subcomponent binding protein 708 Q07021 ChIP-chip
Subtil-Rodríguez A 2014
C2 Complement C2 717 P06681 CHIP-seq
Cotney J 2015
C20ORF112 chromosome 20 open reading frame 112 140688 Q6P0R2 CHIP-seq
Cotney J 2015
C20ORF196 chromosome 20 open reading frame 196 149840 Q8IYI0 CHIP-seq
Cotney J 2015
C20orf199 ZNFX1 antisense RNA 1 NR_003604 ChIP-chip
Subtil-Rodríguez A 2014
C20orf24 chromosome 20 open reading frame 24 55969 Q9BUV8 ChIP-chip
Subtil-Rodríguez A 2014
C20orf29 adaptor-related protein complex 5, sigma 1 subunit 55317 Q9NUS5 ChIP-chip
Subtil-Rodríguez A 2014
C20orf3 adipocyte plasma membrane associated protein 57136 Q9HDC9 ChIP-chip
Subtil-Rodríguez A 2014
C20orf30 transmembrane protein 230 NM_014145 Q96A57 ChIP-chip
Subtil-Rodríguez A 2014
C20orf4 AAR2 splicing factor homolog (S. cerevisiae) 25980 Q9Y312 ChIP-chip
Subtil-Rodríguez A 2014
C20orf72 mitochondrial genome maintenance exonuclease 1 92667 Q9BQP7 ChIP-chip
Subtil-Rodríguez A 2014
C20orf94 SLX4 interacting protein 128710 Q5VYV7 ChIP-chip
Subtil-Rodríguez A 2014
C21orf2 chromosome 21 open reading frame 2 NM_004928 O43822 ChIP-chip
Subtil-Rodríguez A 2014
C21orf34 mir-99a-let-7c cluster host gene (non-protein coding) NR_027790 A1L4M7 ChIP-chip
Subtil-Rodríguez A 2014
C21orf45 MIS18 kinetochore protein A NM_018944 Q9NYP9 ChIP-chip
Subtil-Rodríguez A 2014
C21ORF49 Putative uncharacterized protein C21orf62-AS1 54067 Q17RA5 CHIP-seq
Cotney J 2015
C21orf57 ybeY metallopeptidase (putative) NM_001006114 Q8TBC8 ChIP-chip
Subtil-Rodríguez A 2014
C21orf91 chromosome 21 open reading frame 91 54149 Q68DA1 ChIP-chip
Subtil-Rodríguez A 2014
C22ORF24 Uncharacterized protein C22orf24 25775 Q9Y442 CHIP-seq
Cotney J 2015
C22orf28 chromosome 22 open reading frame 28 51493 Q9Y3I0 ChIP-chip
Subtil-Rodríguez A 2014
C22ORF29 chromosome 22 open reading frame 29 79680 Q7L3V2 CHIP-seq
Cotney J 2015
C22orf32 single-pass membrane protein with aspartate-rich tail 1 NM_033318 Q9H4I9 ChIP-chip
Subtil-Rodríguez A 2014
C2orf28 all-trans retinoic acid-induced differentiation factor 51374 Q6UW56 ChIP-chip
Subtil-Rodríguez A 2014
C2orf29 CCR4-NOT transcription complex, subunit 11 55571 Q9UKZ1 ChIP-chip
Subtil-Rodríguez A 2014
C2orf3 GC-rich sequence DNA-binding factor 2 6936 A4UHR0 ChIP-chip
Subtil-Rodríguez A 2014
C2orf34 calmodulin-lysine N-methyltransferase NM_024766 Q7Z624 ChIP-chip
Subtil-Rodríguez A 2014
C2orf42 chromosome 2 open reading frame 42 NM_017880 Q9NWW7 ChIP-chip
Subtil-Rodríguez A 2014
C2orf43 chromosome 2 open reading frame 43 60526 Q9H6V9 ChIP-chip
Subtil-Rodríguez A 2014
C2ORF47 chromosome 2 open reading frame 47 79568 Q8WWC4 CHIP-seq
Cotney J 2015
C2orf52 long intergenic non-protein coding RNA 471 NR_024079 ChIP-chip
Subtil-Rodríguez A 2014
C2orf64 cytochrome c oxidase assembly factor 5 NM_001008215 Q86WW8 ChIP-chip
Subtil-Rodríguez A 2014
C2orf69 chromosome 2 open reading frame 69 205327 Q8N8R5 ChIP-chip
Subtil-Rodríguez A 2014
C2orf79 peptidyl-tRNA hydrolase domain containing 1 NM_001013663 Q6GMV3 ChIP-chip
Subtil-Rodríguez A 2014
C2orf86 WD repeat containing planar cell polarity effector NM_015910 O95876 ChIP-chip
Subtil-Rodríguez A 2014
C3orf1 translocase of inner mitochondrial membrane domain containing 1 NM_016589 Q9NPL8 ChIP-chip
Subtil-Rodríguez A 2014
C3orf19 coiled-coil domain containing 174 51244 Q6PII3 ChIP-chip
Subtil-Rodríguez A 2014
C4orf21 chromosome 4 open reading frame 21 55345 B4DSN6 ChIP-chip
Subtil-Rodríguez A 2014
C4orf34 small integral membrane protein 14 201895 Q96QK8 ChIP-chip
Subtil-Rodríguez A 2014
C4orf41 trafficking protein particle complex 11 60684 Q7Z392 ChIP-chip
Subtil-Rodríguez A 2014
C4orf43 translation machinery associated 16 homolog (S. cerevisiae) 55319 Q96EY4 ChIP-chip
Subtil-Rodríguez A 2014
C4orf46 chromosome 4 open reading frame 46 NM_001008393 Q504U0 ChIP-chip
Subtil-Rodríguez A 2014
C4ORF48 Neuropeptide-like protein C4orf48 401115 Q5BLP8 CHIP-seq
Cotney J 2015
C5orf15 chromosome 5 open reading frame 15 56951 Q8NC54 ChIP-chip
Subtil-Rodríguez A 2014
C5orf24 chromosome 5 open reading frame 24 134553 Q7Z6I8 ChIP-chip
Subtil-Rodríguez A 2014
C5ORF28 chromosome 5 open reading frame 28 64417 Q0VDI3 CHIP-seq
Cotney J 2015
C5orf34 chromosome 5 open reading frame 34 375444 Q96MH7 ChIP-chip
Subtil-Rodríguez A 2014
C5orf35 SET domain containing 9 NM_153706 Q8NE22 ChIP-chip
Subtil-Rodríguez A 2014
C5orf36 KIAA0825 NM_173665 Q8IV33 ChIP-chip
Subtil-Rodríguez A 2014
C5orf37 POC5 centriolar protein NM_001099271 Q8NA72 ChIP-chip
Subtil-Rodríguez A 2014
C5orf39 annexin A2 receptor NM_001014279 Q3ZCQ2 ChIP-chip
Subtil-Rodríguez A 2014
C5orf41 CREB3 regulatory factor 153222 Q8IUR6 ChIP-chip
Subtil-Rodríguez A 2014
C5orf44 trafficking protein particle complex 13 NR_003545 A5PLN9 ChIP-chip
Subtil-Rodríguez A 2014
C5orf51 chromosome 5 open reading frame 51 285636 A6NDU8 ChIP-chip
Subtil-Rodríguez A 2014
C6orf115 ABRA C-terminal like NM_021243 Q9P1F3 ChIP-chip
Subtil-Rodríguez A 2014
C6orf120 chromosome 6 open reading frame 120 387263 Q7Z4R8 ChIP-chip
Subtil-Rodríguez A 2014
C6orf129 coiled-coil domain containing 167 NM_138493 Q9P0B6 ChIP-chip
Subtil-Rodríguez A 2014
C6ORF136 Uncharacterized protein C6orf136 221545 Q5SQH8 CHIP-seq
Cotney J 2015
C6orf142 muscular LMNA-interacting protein NM_138569 Q5VWP3 ChIP-chip
Subtil-Rodríguez A 2014
C6orf145 PX domain containing 1 221749 Q5TGL8 ChIP-chip
Subtil-Rodríguez A 2014
C6orf162 small integral membrane protein 8 57150 Q96KF7 ChIP-chip
Subtil-Rodríguez A 2014
C6ORF211 chromosome 6 open reading frame 211 79624 Q9H993 CHIP-seq
Cotney J 2015
C6orf217 long intergenic non-protein coding RNA 271 NR_026805 P0C7V0 ChIP-chip
Subtil-Rodríguez A 2014
C6orf57 chromosome 6 open reading frame 57 NM_145267 Q5VUM1 ChIP-chip
Subtil-Rodríguez A 2014
C6orf62 chromosome 6 open reading frame 62 81688 Q9GZU0 ChIP-chip
Subtil-Rodríguez A 2014
C7ORF10 chromosome 7 open reading frame 10 79783 Q9HAC7 CHIP-seq
Cotney J 2015
C7ORF25 chromosome 7 open reading frame 25 79020 J3KR36 CHIP-seq
Cotney J 2015
C7ORF26 chromosome 7 open reading frame 26 79034 Q96N11 CHIP-seq
Cotney J 2015
C7orf30 mitochondrial assembly of ribosomal large subunit 1 115416 Q96EH3 ChIP-chip
Subtil-Rodríguez A 2014
C7orf36 Yae1 domain containing 1 57002 B2RC46 ChIP-chip
Subtil-Rodríguez A 2014
C7orf38 family with sequence similarity 200, member A NM_145111 Q8TCP9 ChIP-chip
Subtil-Rodríguez A 2014
C7orf55 chromosome 7 open reading frame 55 NM_197964 Q96HJ9 ChIP-chip
Subtil-Rodríguez A 2014
C7ORF55-LUC7L2 UPF0562 protein C7orf55 100996928 Q96HJ9 CHIP-seq
Cotney J 2015
C7orf60 chromosome 7 open reading frame 60 154743 Q1RMZ1 ChIP-chip
Subtil-Rodríguez A 2014
C8G Complement component C8 gamma chain 733 P07360 CHIP-seq
Cotney J 2015
C8orf37 chromosome 8 open reading frame 37 NM_177965 F4Y588 ChIP-chip
Subtil-Rodríguez A 2014
C8orf39 RBM12B antisense RNA 1 NR_027259 Q9P1G2 ChIP-chip
Subtil-Rodríguez A 2014
C8orf40 small integral membrane protein 19 114926 Q96E16 ChIP-chip
Subtil-Rodríguez A 2014
C8orf41 TELO2 interacting protein 2 80185 Q6NXR4 ChIP-chip
Subtil-Rodríguez A 2014
C8orf59 chromosome 8 open reading frame 59 NM_001099670 A0A024R838 ChIP-chip
Subtil-Rodríguez A 2014
C9orf130 long intergenic non-protein coding RNA 476 NR_023389 Q8WZB0 ChIP-chip
Subtil-Rodríguez A 2014
C9orf156 chromosome 9 open reading frame 156 51531 Q9BU70 ChIP-chip
Subtil-Rodríguez A 2014
C9ORF169 Cysteine-rich tail protein 1 375791 A8MQ03 CHIP-seq
Cotney J 2015
C9orf30 chromosome 9 open reading frame 30 91283 Q96H12 ChIP-chip
Subtil-Rodríguez A 2014
C9orf40 chromosome 9 open reading frame 40 55071 Q8IXQ3 ChIP-chip
Subtil-Rodríguez A 2014
C9orf41 chromosome 9 open reading frame 41 138199 Q8N4J0 ChIP-chip
Subtil-Rodríguez A 2014
C9ORF43 Uncharacterized protein C9orf43 257169 Q8TAL5 CHIP-seq
Cotney J 2015
C9orf5 transmembrane protein 245 23731 Q9H330 ChIP-chip
Subtil-Rodríguez A 2014
C9ORF69 Protein C9orf69 90120 H0YL14 CHIP-seq
Cotney J 2015
C9orf78 chromosome 9 open reading frame 78 51759 Q9NZ63 ChIP-chip
Subtil-Rodríguez A 2014
C9orf82 caspase activity and apoptosis inhibitor 1 79886 Q9H8G2 ChIP-chip
Subtil-Rodríguez A 2014
C9orf86 RAB, member RAS oncogene family-like 6 55684 Q3YEC7 ChIP-chip
Subtil-Rodríguez A 2014
C9ORF96 Serine/threonine kinase-like domain-containing protein STKLD1 169436 Q8NE28 CHIP-seq
Cotney J 2015
CA11 carbonic anhydrase XI NM_001217 O75493 ChIP-chip
Subtil-Rodríguez A 2014
CAB39 calcium binding protein 39 51719 A8K8L7 CHIP-seq
Cotney J 2015
CACNA1G calcium channel, voltage-dependent, T type, alpha 1G subunit 8913 O43497 qRT-PCR; ChIP-qPCR
Fang M 2014
CACTIN Cactin 58509 Q8WUQ7 CHIP-seq
Cotney J 2015
CACYBP calcyclin binding protein 27101 B3KSF1 ChIP-chip
Subtil-Rodríguez A 2014
CALM1 calmodulin 1 (phosphorylase kinase, delta) 801 P62158 ChIP-chip
Subtil-Rodríguez A 2014
CALM2 calmodulin 2 (phosphorylase kinase, delta) 805 B4DJ51 ChIP-chip
Subtil-Rodríguez A 2014
CALM3 calmodulin 3 (phosphorylase kinase, delta) 808 B4DJ51 CHIP-seq
Cotney J 2015
CALR calreticulin 811 P27797 ChIP-chip
Subtil-Rodríguez A 2014
CALU calumenin 813 D6QS54 ChIP-chip
Subtil-Rodríguez A 2014
CAMSAP1 calmodulin regulated spectrin-associated protein 1 157922 Q5T5Y3 CHIP-seq
Cotney J 2015
CAMSAP1L1 calmodulin regulated spectrin-associated protein family, member 2 23271 B3KTI4 ChIP-chip
Subtil-Rodríguez A 2014
CAND1 cullin-associated and neddylation-dissociated 1 55832 Q86VP6 ChIP-chip
Subtil-Rodríguez A 2014
CANX calnexin 821 P27824 ChIP-chip
Subtil-Rodríguez A 2014
CAPRIN1 cell cycle associated protein 1 4076 Q14444 CHIP-seq
Cotney J 2015
CAPRIN2 caprin family member 2 65981 Q6IMN6 ChIP-chip
Subtil-Rodríguez A 2014
CAPZA1 capping protein (actin filament) muscle Z-line, alpha 1 829 P52907 ChIP-chip
Subtil-Rodríguez A 2014
CAPZA2 capping protein (actin filament) muscle Z-line, alpha 2 830 A4D0V4 ChIP-chip
Subtil-Rodríguez A 2014
CAPZB capping protein (actin filament) muscle Z-line, beta 832 P47756 CHIP-seq
Cotney J 2015
CARD8 caspase recruitment domain family, member 8 22900 B5KVR6 ChIP-chip
Subtil-Rodríguez A 2014
CARM1 coactivator-associated arginine methyltransferase 1 10498 Q86X55 CHIP-seq
Cotney J 2015
CARS2 cysteinyl-tRNA synthetase 2, mitochondrial (putative) 79587 B7Z7E6 ChIP-chip
Subtil-Rodríguez A 2014
CASC3 cancer susceptibility candidate 3 22794 O15234 ChIP-chip
Subtil-Rodríguez A 2014
CASC4 cancer susceptibility candidate 4 113201 Q6P4E1 ChIP-chip
Subtil-Rodríguez A 2014
CASC5 cancer susceptibility candidate 5 57082 Q8NG31 ChIP-chip
Subtil-Rodríguez A 2014
CASD1 CAS1 domain containing 1 NM_022900 Q8WZ77 ChIP-chip
Subtil-Rodríguez A 2014
CASKIN2 CASK interacting protein 2 57513 Q8WXE0 CHIP-seq
Cotney J 2015
CASP2 caspase 2, apoptosis-related cysteine peptidase 835 D3DXD9 ChIP-chip
Subtil-Rodríguez A 2014
CASP3 caspase 3, apoptosis-related cysteine peptidase 836 P42574 CHIP-seq
Cotney J 2015
CASP8AP2 caspase 8 associated protein 2 NM_012115 Q9UKL3 ChIP-chip
Subtil-Rodríguez A 2014
CBFB core-binding factor, beta subunit 865 Q13951 CHIP-seq
Cotney J 2015
CBLL1 Cbl proto-oncogene, E3 ubiquitin protein ligase-like 1 79872 B4DDV7 ChIP-chip
Subtil-Rodríguez A 2014
CBWD2 COBW domain containing 2 150472 Q8IUF1 ChIP-chip
Subtil-Rodríguez A 2014
CBX3 chromobox homolog 3 11335 Q13185 CHIP-seq
Cotney J 2015
CBX3P2 chromobox homolog 3 pseudogene 2 645158 NA CHIP-seq
Cotney J 2015
CBX4 chromobox homolog 4 8535 O00257 ChIP-chip
Subtil-Rodríguez A 2014
CBX5 chromobox homolog 5 23468 P45973 ChIP-chip
Subtil-Rodríguez A 2014
CBX6 chromobox homolog 6 23466 O95503 ChIP-chip
Subtil-Rodríguez A 2014
CBX8 chromobox homolog 8 57332 Q9HC52 ChIP-chip
Subtil-Rodríguez A 2014
CCAR1 cell division cycle and apoptosis regulator 1 55749 Q8IX12 ChIP-chip
Subtil-Rodríguez A 2014
CCBL1 cysteine conjugate-beta lyase, cytoplasmic 883 A8K563 CHIP-seq
Cotney J 2015
CCDC102B coiled-coil domain containing 102B NM_001093729 A1A4H1 ChIP-chip
Subtil-Rodríguez A 2014
CCDC106 coiled-coil domain containing 106 29903 Q9BWC9 ChIP-chip
Subtil-Rodríguez A 2014
CCDC109A mitochondrial calcium uniporter NM_138357 Q8NE86 ChIP-chip
Subtil-Rodríguez A 2014
CCDC111 DNA-directed primase/polymerase protein 201973 Q96LW4 CHIP-seq
Cotney J 2015
CCDC115 Coiled-coil domain-containing protein 115 84317 Q96NT0 CHIP-seq
Cotney J 2015
CCDC136 coiled-coil domain containing 136 64753 Q96JN2 CHIP-seq
Cotney J 2015
CCDC137 coiled-coil domain containing 137 339230 Q6PK04 ChIP-chip
Subtil-Rodríguez A 2014
CCDC142 coiled-coil domain containing 142 84865 Q17RM4 CHIP-seq
Cotney J 2015
CCDC18 coiled-coil domain containing 18 343099 E9PFB9 ChIP-chip
Subtil-Rodríguez A 2014
CCDC21 centrosomal protein 85kDa NM_022778 Q6P2H3 ChIP-chip
Subtil-Rodríguez A 2014
CCDC45 centrosomal protein 95kDa NM_138363 Q96GE4 ChIP-chip
Subtil-Rodríguez A 2014
CCDC47 coiled-coil domain containing 47 57003 Q96A33 ChIP-chip
Subtil-Rodríguez A 2014
CCDC49 CWC25 spliceosome-associated protein homolog (S. cerevisiae) NM_017748 Q9NXE8 ChIP-chip
Subtil-Rodríguez A 2014
CCDC50 coiled-coil domain containing 50 152137 Q8IVM0 CHIP-seq
Cotney J 2015
CCDC55 nuclear speckle splicing regulatory protein 1 NM_032141 A0A024QZ33 ChIP-chip
Subtil-Rodríguez A 2014
CCDC56 coiled-coil domain containing 56 28958 Q9Y2R0 ChIP-chip
Subtil-Rodríguez A 2014
CCDC57 coiled-coil domain containing 57 284001 Q2TAC2 CHIP-seq
Cotney J 2015
CCDC58 coiled-coil domain containing 58 NM_001017928 Q4VC31 ChIP-chip
Subtil-Rodríguez A 2014
CCDC6 coiled-coil domain containing 6 8030 Q05CP8 ChIP-chip
Subtil-Rodríguez A 2014
CCDC66 coiled-coil domain containing 66 285331 A2RUB6 ChIP-chip
Subtil-Rodríguez A 2014
CCDC71L Coiled-coil domain-containing protein 71L 168455 Q8N9Z2 CHIP-seq
Cotney J 2015
CCDC76 tRNA methyltransferase 13 homolog (S. cerevisiae) NM_019083 Q9NUP7 ChIP-chip
Subtil-Rodríguez A 2014
CCDC77 Coiled-coil domain-containing protein 77 84318 Q9BR77 CHIP-seq
Cotney J 2015
CCDC83 coiled-coil domain containing 83 NM_173556 Q8IWF9 ChIP-chip
Subtil-Rodríguez A 2014
CCDC84 coiled-coil domain containing 84 NM_198489 Q86UT8 ChIP-chip
Subtil-Rodríguez A 2014
CCDC85C coiled-coil domain containing 85C 317762 A6NKD9 CHIP-seq
Cotney J 2015
CCDC88A coiled-coil domain containing 88A 55704 Q3V6T2 ChIP-chip
Subtil-Rodríguez A 2014
CCDC90B coiled-coil domain containing 90B 60492 Q9GZT6 ChIP-chip
Subtil-Rodríguez A 2014
CCDC92 Coiled-coil domain-containing protein 92 80212 Q53HC0 CHIP-seq
Cotney J 2015
CCDC97 coiled-coil domain containing 97 90324 Q96F63 ChIP-chip
Subtil-Rodríguez A 2014
CCM2 cerebral cavernous malformation 2 83605 Q9BSQ5 ChIP-chip
Subtil-Rodríguez A 2014
CCNA2 cyclin A2 890 P20248 ChIP-chip
Subtil-Rodríguez A 2014
CCNE2 cyclin E2 9134 O96020 CHIP-seq
Cotney J 2015
CCNG2 cyclin G2 901 Q16589 CHIP-seq
Cotney J 2015
CCNI cyclin I 10983 Q14094 ChIP-chip
Subtil-Rodríguez A 2014
CCNL1 cyclin L1 57018 Q9UK58 ChIP-chip
Subtil-Rodríguez A 2014
CCNT1 cyclin T1 904 O60563 ChIP-chip
Subtil-Rodríguez A 2014
CCNT2 cyclin T2 905 B4DH21 ChIP-chip
Subtil-Rodríguez A 2014
CCPG1 HUWE1 9236 Q9ULG6 ChIP-chip
Subtil-Rodríguez A 2014
CCSAP Centriole, cilia and spindle-associated protein 126731 Q6IQ19 CHIP-seq
Cotney J 2015
CCT2 chaperonin containing TCP1, subunit 2 (beta) 10576 P78371 ChIP-chip
Subtil-Rodríguez A 2014
CCT4 chaperonin containing TCP1, subunit 4 (delta) 10575 P50991 ChIP-chip
Subtil-Rodríguez A 2014
CCT7 chaperonin containing TCP1, subunit 7 (eta) 10574 Q99832 ChIP-chip
Subtil-Rodríguez A 2014
CD164 CD164 molecule, sialomucin 8763 Q04900 ChIP-chip
Subtil-Rodríguez A 2014
CD276 CD276 molecule 80381 Q5ZPR3 CHIP-seq
Cotney J 2015
CD3EAP CD3e molecule, epsilon associated protein 10849 O15446 ChIP-chip
Subtil-Rodríguez A 2014
CD47 CD47 molecule 961 Q08722 ChIP-chip
Subtil-Rodríguez A 2014
CDC123 cell division cycle 123 homolog (S. cerevisiae) 8872 O75794 CHIP-seq
Cotney J 2015
CDC14A cell division cycle 14A NM_033313 Q59EF4 ChIP-chip
Subtil-Rodríguez A 2014
CDC20 cell division cycle 20 991 Q12834 ChIP-chip
Subtil-Rodríguez A 2014
CDC27 cell division cycle 27 996 G3V1C4 ChIP-chip
Subtil-Rodríguez A 2014
CDC2L5 cyclin-dependent kinase 13 NM_003718 A0A024RA85 ChIP-chip
Subtil-Rodríguez A 2014
CDC40 cell division cycle 40 51362 O60508 CHIP-seq
Cotney J 2015
CDC42 cell division cycle 42 (GTP binding protein, 25kDa) 998 P60953 CHIP-seq
Cotney J 2015
CDC42BPB CDC42 binding protein kinase beta (DMPK-like) 9578 Q86XZ8 CHIP-seq
Cotney J 2015
CDC42EP3 CDC42 effector protein (Rho GTPase binding) 3 10602 Q9UKI2 CHIP-seq
Cotney J 2015
CDC42SE1 CDC42 small effector 1 56882 Q9NRR8 CHIP-seq
Cotney J 2015
CDC45L cell division cycle 45 NM_003504 O75419 ChIP-chip
Subtil-Rodríguez A 2014
CDC6 cell division cycle 6 homolog (S. cerevisiae) 990 Q99741 ChIP-chip
Subtil-Rodríguez A 2014
CDC7 cell division cycle 7 8317 O00311 ChIP-chip
Subtil-Rodríguez A 2014
CDC73 cell division cycle 73 79577 Q6P1J9 ChIP-chip
Subtil-Rodríguez A 2014
CDH2 cadherin 2, type 1, N-cadherin (neuronal) 1000 P19022