Human Gene Module / Chromosome X / MAOA

MAOAmonoamine oxidase A

SFARI Gene Score
2
Strong Candidate Criteria 2.1
Autism Reports / Total Reports
13 / 23
Rare Variants / Common Variants
15 / 5
Aliases
-
Associated Syndromes
Brunner syndrome
Chromosome Band
Xp11.3
Associated Disorders
DD/NDD
Relevance to Autism

The 3-repeat MAO-uVNTR (low-activity) allele was associated with increased severity of autism, as measured by parent and teacher reports, IQ, adaptive skills, language assessments and multiple other scoring methods (Cohen et al., 2003 & 2011) and was found to be associated with ASD in a Korean population cohort (Yoo et al., 2009). In addition, genetic association has been found between MAOA and ADHD in an Indian population cohort (Das et al., 2006).

Molecular Function

The encoded protein degrades amine neurotransmitters.

SFARI Genomic Platforms
Reports related to MAOA (23 Reports)
# Type Title Author, Year Autism Report Associated Disorders
1 Primary Association of autism severity with a monoamine oxidase A functional polymorphism Cohen IL , et al. (2003) Yes -
2 Recent Recommendation MAOA, maltreatment, and gene-environment interaction predicting children's mental health: new evidence and a meta-analysis Kim-Cohen J , et al. (2006) No -
3 Recent Recommendation MAOA promoter polymorphism and attention deficit hyperactivity disorder (ADHD) in indian children Das M , et al. (2006) No -
4 Positive Association Family- and population-based association studies of monoamine oxidase A and autism spectrum disorders in Korean Yoo HJ , et al. (2008) Yes -
5 Support Deletion of MAOA and MAOB in a male patient causes severe developmental delay, intermittent hypotonia and stereotypical hand movements Whibley A , et al. (2010) No -
6 Positive Association Autism severity is associated with child and maternal MAOA genotypes Cohen IL , et al. (2010) Yes -
7 Support Monoamine oxidase A and A/B knockout mice display autistic-like features Bortolato M , et al. (2012) No -
8 Support MAOA/B deletion syndrome in male siblings with severe developmental delay and sudden loss of muscle tonus Saito M , et al. (2013) Yes DD
9 Recent Recommendation 20 ans après: a second mutation in MAOA identified by targeted high-throughput sequencing in a family with altered behavior and cognition Piton A , et al. (2013) Yes -
10 Positive Association Sexual dimorphic effect in the genetic association of monoamine oxidase A (MAOA) markers with autism spectrum disorder Verma D , et al. (2013) Yes -
11 Recent Recommendation New insights into Brunner syndrome and potential for targeted therapy Palmer EE , et al. (2015) No -
12 Support Integrated analysis of whole-exome sequencing and transcriptome profiling in males with autism spectrum disorders Codina-Sol M , et al. (2015) Yes -
13 Support Exome Pool-Seq in neurodevelopmental disorders Popp B , et al. (2017) No Behavioral anomalies
14 Support Targeted Next-Generation Sequencing in Patients with Suggestive X-Linked Intellectual Disability Ibarluzea N , et al. (2020) No -
15 Support - Alonso-Gonzalez A et al. (2021) Yes -
16 Support - Hu C et al. (2022) Yes -
17 Support - Prah A et al. (2022) No -
18 Support - Tuncay IO et al. (2023) Yes -
19 Support - Ashlesha Gogate et al. (2024) Yes -
20 Support - Gabriela Repiská et al. (2025) Yes -
21 Support - Giovanni Spirito et al. (2026) Yes -
22 Highly Cited Aggressive behavior and altered amounts of brain serotonin and norepinephrine in mice lacking MAOA Cases O , et al. (1995) No -
23 Highly Cited Abnormal behavior associated with a point mutation in the structural gene for monoamine oxidase A Brunner HG , et al. (1993) No -
Rare Variants   (15)
Status Allele Change Residue Change Variant Type Inheritance Pattern Parental Transmission Family Type PubMed ID Author, Year
- - copy_number_loss Familial Maternal Multiplex 23414621 Saito M , et al. (2013)
- - copy_number_loss Familial Maternal Multiplex 20485326 Whibley A , et al. (2010)
c.208G>A p.Val70Met missense_variant Familial Maternal - 35741772 Hu C et al. (2022)
c.730G>A p.Val244Ile missense_variant Familial Maternal - 29158550 Popp B , et al. (2017)
c.112A>T p.Ser38Cys missense_variant Unknown - - 40869941 Gabriela Repiská et al. (2025)
c.710A>T p.Gln237Leu missense_variant Familial Maternal - 37492102 Tuncay IO et al. (2023)
c.815C>T p.Ala272Val missense_variant De novo - Simplex 33431980 Alonso-Gonzalez A et al. (2021)
c.1438-2A>G - splice_site_variant Familial Maternal Multiplex 25969726 Codina-Sol M , et al. (2015)
c.133C>T p.Arg45Trp missense_variant Familial Maternal Multiplex 25807999 Palmer EE , et al. (2015)
c.617G>A p.Arg206Gln missense_variant Familial Maternal Multiplex 31906484 Ibarluzea N , et al. (2020)
c.886C>T p.Gln296Ter stop_gained Familial Maternal Multi-generational 8211186 Brunner HG , et al. (1993)
c.749_750insT p.Ser251LysfsTer2 frameshift_variant Unknown - Multiplex 25807999 Palmer EE , et al. (2015)
c.1526C>T p.Thr509Ile missense_variant Familial Maternal Simplex 39632905 Ashlesha Gogate et al. (2024)
c.608G>A p.Gly203Asp missense_variant Familial Maternal Multiplex 41629344 Giovanni Spirito et al. (2026)
c.797_798delinsTT p.Cys266Phe missense_variant Familial Maternal Multi-generational 24169519 Piton A , et al. (2013)
Common Variants   (5)
Status Allele Change Residue Change Variant Type Inheritance Pattern Paternal Transmission Family Type PubMed ID Author, Year
c.-1241_-1212ACCGGCACCGGCACCAGTACCCGCACCAGT(3_5) - microsatellite - - - 16856146 Das M , et al. (2006)
c.-1241_-1212ACCGGCACCGGCACCAGTACCCGCACCAGT(3_5) - microsatellite - - - 19100789 Yoo HJ , et al. (2008)
c.-1241_-1212ACCGGCACCGGCACCAGTACCCGCACCAGT(3_5) - microsatellite - - - 12919132 Cohen IL , et al. (2003)
c.-1241_-1212ACCGGCACCGGCACCAGTACCCGCACCAGT(3_5) - microsatellite - - - 20573161 Cohen IL , et al. (2010)
c.891G>T;c.492G>T p.(=) synonymous_variant - - - 24291416 Verma D , et al. (2013)
SFARI Gene score
2

Strong Candidate

Gene has several association studies which are not genome-wide significant.

Score Delta: Score remained at 2

2

Strong Candidate

See all Category 2 Genes

We considered a rigorous statistical comparison between cases and controls, yielding genome-wide statistical significance, with independent replication, to be the strongest possible evidence for a gene. These criteria were relaxed slightly for category 2.

4/1/2022
3
icon
2

Decreased from 3 to 2

Description

Gene has several association studies which are not genome-wide significant.

1/1/2021
3
icon
3

Decreased from 3 to 3

Description

Gene has several association studies which are not genome-wide significant.

1/1/2020
3
icon
3

Decreased from 3 to 3

Description

Gene has several association studies which are not genome-wide significant.

10/1/2019
4
icon
3

Decreased from 4 to 3

New Scoring Scheme
Description

Gene has several association studies which are not genome-wide significant.

Reports Added
[New Scoring Scheme]
7/1/2018
4
icon
4

Decreased from 4 to 4

Description

Gene has several association studies which are not genome-wide significant.

10/1/2017
4
icon
4

Decreased from 4 to 4

Description

Gene has several association studies which are not genome-wide significant.

4/1/2015
7/1/2014
No data
icon
4

Increased from No data to 4

Description

Gene has several association studies which are not genome-wide significant.

4/1/2014
No data
icon
4

Increased from No data to 4

Description

Gene has several association studies which are not genome-wide significant.

Krishnan Probability Score

Score 0.44726448879571

Ranking 13422/25841 scored genes


[Show Scoring Methodology]
Krishnan and colleagues generated probability scores genome-wide by using a machine learning approach on a human brain-specific gene network. The method was first presented in Nat Neurosci 19, 1454-1462 (2016), and scores for more than 25,000 RefSeq genes can be accessed in column G of supplementary table 3 (see: http://www.nature.com/neuro/journal/v19/n11/extref/nn.4353-S5.xlsx). A searchable browser, with the ability to view networks of associated ASD risk genes, can be found at asd.princeton.edu.
ExAC Score

Score 0.99322249050876

Ranking 1648/18225 scored genes


[Show Scoring Methodology]
The Exome Aggregation Consortium (ExAC) is a summary database of 60,706 exomes that has been widely used to estimate 'constraint' on mutation for individual genes. It was introduced by Lek et al. Nature 536, 285-291 (2016), and the ExAC browser can be found at exac.broadinstitute.org. The pLI score was developed as measure of intolerance to loss-of- function mutation. A pLI > 0.9 is generally viewed as highly constrained, and thus any loss-of- function mutations in autism in such a gene would be more likely to confer risk. For a full list of pLI scores see: ftp://ftp.broadinstitute.org/pub/ExAC_release/release0.3.1/functional_gene_constraint/fordist_cle aned_exac_nonTCGA_z_pli_rec_null_data.txt
Sanders TADA Score

Score 0.93089286536752

Ranking 11551/18665 scored genes


[Show Scoring Methodology]
The TADA score ('Transmission and De novo Association') was introduced by He et al. PLoS Genet 9(8):e1003671 (2013), and is a statistic that integrates evidence from both de novo and transmitted mutations. It forms the basis for the claim of 65 individual genes being strongly associated with autism risk at a false discovery rate of 0.1 (Sanders et al. Neuron 87, 1215-1233 (2015)). The calculated TADA score for 18,665 RefSeq genes can be found in column P of Supplementary Table 6 in the Sanders et al. paper (the column headed 'tadaFdrAscSscExomeSscAgpSmallDel'), which represents a combined analysis of exome data and small de novo deletions (see www.cell.com/cms/attachment/2038545319/2052606711/mmc7.xlsx).
Larsen Cumulative Evidence Score

Score 34.5

Ranking 62/461 scored genes


[Show Scoring Methodology]
Larsen and colleagues generated gene scores based on the sum of evidence for all available ASD-associated variants in a gene, with assessments based on mode of inheritance, effect size, and variant frequency in the general population. The approach was first presented in Mol Autism 7:44 (2016), and scores for 461 genes can be found in column I in supplementary table 4 from that paper.
Zhang D Score

Score -0.23396601316553

Ranking 16094/20870 scored genes


[Show Scoring Methodology]
The DAMAGES score (disease-associated mutation analysis using gene expression signatures), or D score, was developed to combine evidence from de novo loss-of- function mutation with evidence from cell-type- specific gene expression in the mouse brain (specifically translational profiles of 24 specific mouse CNS cell types isolated from 6 different brain regions). Genes with positive D scores are more likely to be associated with autism risk, with higher-confidence genes having higher D scores. This statistic was first presented by Zhang & Shen (Hum Mutat 38, 204- 215 (2017), and D scores for more than 20,000 RefSeq genes can be found in column M in supplementary table 2 from that paper.
Submit New Gene

Report an Error