MAOAmonoamine oxidase A
Autism Reports / Total Reports
13 / 23Rare Variants / Common Variants
15 / 5Aliases
-Associated Syndromes
Brunner syndromeChromosome Band
Xp11.3Associated Disorders
DD/NDDRelevance to Autism
The 3-repeat MAO-uVNTR (low-activity) allele was associated with increased severity of autism, as measured by parent and teacher reports, IQ, adaptive skills, language assessments and multiple other scoring methods (Cohen et al., 2003 & 2011) and was found to be associated with ASD in a Korean population cohort (Yoo et al., 2009). In addition, genetic association has been found between MAOA and ADHD in an Indian population cohort (Das et al., 2006).
Molecular Function
The encoded protein degrades amine neurotransmitters.
External Links
SFARI Genomic Platforms
Reports related to MAOA (23 Reports)
| # | Type | Title | Author, Year | Autism Report | Associated Disorders |
|---|---|---|---|---|---|
| 1 | Primary | Association of autism severity with a monoamine oxidase A functional polymorphism | Cohen IL , et al. (2003) | Yes | - |
| 2 | Recent Recommendation | MAOA, maltreatment, and gene-environment interaction predicting children's mental health: new evidence and a meta-analysis | Kim-Cohen J , et al. (2006) | No | - |
| 3 | Recent Recommendation | MAOA promoter polymorphism and attention deficit hyperactivity disorder (ADHD) in indian children | Das M , et al. (2006) | No | - |
| 4 | Positive Association | Family- and population-based association studies of monoamine oxidase A and autism spectrum disorders in Korean | Yoo HJ , et al. (2008) | Yes | - |
| 5 | Support | Deletion of MAOA and MAOB in a male patient causes severe developmental delay, intermittent hypotonia and stereotypical hand movements | Whibley A , et al. (2010) | No | - |
| 6 | Positive Association | Autism severity is associated with child and maternal MAOA genotypes | Cohen IL , et al. (2010) | Yes | - |
| 7 | Support | Monoamine oxidase A and A/B knockout mice display autistic-like features | Bortolato M , et al. (2012) | No | - |
| 8 | Support | MAOA/B deletion syndrome in male siblings with severe developmental delay and sudden loss of muscle tonus | Saito M , et al. (2013) | Yes | DD |
| 9 | Recent Recommendation | 20 ans après: a second mutation in MAOA identified by targeted high-throughput sequencing in a family with altered behavior and cognition | Piton A , et al. (2013) | Yes | - |
| 10 | Positive Association | Sexual dimorphic effect in the genetic association of monoamine oxidase A (MAOA) markers with autism spectrum disorder | Verma D , et al. (2013) | Yes | - |
| 11 | Recent Recommendation | New insights into Brunner syndrome and potential for targeted therapy | Palmer EE , et al. (2015) | No | - |
| 12 | Support | Integrated analysis of whole-exome sequencing and transcriptome profiling in males with autism spectrum disorders | Codina-Sol M , et al. (2015) | Yes | - |
| 13 | Support | Exome Pool-Seq in neurodevelopmental disorders | Popp B , et al. (2017) | No | Behavioral anomalies |
| 14 | Support | Targeted Next-Generation Sequencing in Patients with Suggestive X-Linked Intellectual Disability | Ibarluzea N , et al. (2020) | No | - |
| 15 | Support | - | Alonso-Gonzalez A et al. (2021) | Yes | - |
| 16 | Support | - | Hu C et al. (2022) | Yes | - |
| 17 | Support | - | Prah A et al. (2022) | No | - |
| 18 | Support | - | Tuncay IO et al. (2023) | Yes | - |
| 19 | Support | - | Ashlesha Gogate et al. (2024) | Yes | - |
| 20 | Support | - | Gabriela Repiská et al. (2025) | Yes | - |
| 21 | Support | - | Giovanni Spirito et al. (2026) | Yes | - |
| 22 | Highly Cited | Aggressive behavior and altered amounts of brain serotonin and norepinephrine in mice lacking MAOA | Cases O , et al. (1995) | No | - |
| 23 | Highly Cited | Abnormal behavior associated with a point mutation in the structural gene for monoamine oxidase A | Brunner HG , et al. (1993) | No | - |
Rare Variants (15)
| Status | Allele Change | Residue Change | Variant Type | Inheritance Pattern | Parental Transmission | Family Type | PubMed ID | Author, Year |
|---|---|---|---|---|---|---|---|---|
| - | - | copy_number_loss | Familial | Maternal | Multiplex | 23414621 | Saito M , et al. (2013) | |
| - | - | copy_number_loss | Familial | Maternal | Multiplex | 20485326 | Whibley A , et al. (2010) | |
| c.208G>A | p.Val70Met | missense_variant | Familial | Maternal | - | 35741772 | Hu C et al. (2022) | |
| c.730G>A | p.Val244Ile | missense_variant | Familial | Maternal | - | 29158550 | Popp B , et al. (2017) | |
| c.112A>T | p.Ser38Cys | missense_variant | Unknown | - | - | 40869941 | Gabriela Repiská et al. (2025) | |
| c.710A>T | p.Gln237Leu | missense_variant | Familial | Maternal | - | 37492102 | Tuncay IO et al. (2023) | |
| c.815C>T | p.Ala272Val | missense_variant | De novo | - | Simplex | 33431980 | Alonso-Gonzalez A et al. (2021) | |
| c.1438-2A>G | - | splice_site_variant | Familial | Maternal | Multiplex | 25969726 | Codina-Sol M , et al. (2015) | |
| c.133C>T | p.Arg45Trp | missense_variant | Familial | Maternal | Multiplex | 25807999 | Palmer EE , et al. (2015) | |
| c.617G>A | p.Arg206Gln | missense_variant | Familial | Maternal | Multiplex | 31906484 | Ibarluzea N , et al. (2020) | |
| c.886C>T | p.Gln296Ter | stop_gained | Familial | Maternal | Multi-generational | 8211186 | Brunner HG , et al. (1993) | |
| c.749_750insT | p.Ser251LysfsTer2 | frameshift_variant | Unknown | - | Multiplex | 25807999 | Palmer EE , et al. (2015) | |
| c.1526C>T | p.Thr509Ile | missense_variant | Familial | Maternal | Simplex | 39632905 | Ashlesha Gogate et al. (2024) | |
| c.608G>A | p.Gly203Asp | missense_variant | Familial | Maternal | Multiplex | 41629344 | Giovanni Spirito et al. (2026) | |
| c.797_798delinsTT | p.Cys266Phe | missense_variant | Familial | Maternal | Multi-generational | 24169519 | Piton A , et al. (2013) |
Common Variants (5)
| Status | Allele Change | Residue Change | Variant Type | Inheritance Pattern | Paternal Transmission | Family Type | PubMed ID | Author, Year |
|---|---|---|---|---|---|---|---|---|
| c.-1241_-1212ACCGGCACCGGCACCAGTACCCGCACCAGT(3_5) | - | microsatellite | - | - | - | 16856146 | Das M , et al. (2006) | |
| c.-1241_-1212ACCGGCACCGGCACCAGTACCCGCACCAGT(3_5) | - | microsatellite | - | - | - | 19100789 | Yoo HJ , et al. (2008) | |
| c.-1241_-1212ACCGGCACCGGCACCAGTACCCGCACCAGT(3_5) | - | microsatellite | - | - | - | 12919132 | Cohen IL , et al. (2003) | |
| c.-1241_-1212ACCGGCACCGGCACCAGTACCCGCACCAGT(3_5) | - | microsatellite | - | - | - | 20573161 | Cohen IL , et al. (2010) | |
| c.891G>T;c.492G>T | p.(=) | synonymous_variant | - | - | - | 24291416 | Verma D , et al. (2013) |
SFARI Gene score
Strong Candidate

Gene has several association studies which are not genome-wide significant.
Score Delta: Score remained at 2
criteria met
See SFARI Gene'scoring criteriaWe considered a rigorous statistical comparison between cases and controls, yielding genome-wide statistical significance, with independent replication, to be the strongest possible evidence for a gene. These criteria were relaxed slightly for category 2.
4/1/2022

Decreased from 3 to 2
Description
Gene has several association studies which are not genome-wide significant.
1/1/2021

Decreased from 3 to 3
Description
Gene has several association studies which are not genome-wide significant.
1/1/2020

Decreased from 3 to 3
Description
Gene has several association studies which are not genome-wide significant.
10/1/2019

Decreased from 4 to 3
New Scoring Scheme
Description
Gene has several association studies which are not genome-wide significant.
Reports Added
[New Scoring Scheme]7/1/2018

Decreased from 4 to 4
Description
Gene has several association studies which are not genome-wide significant.
10/1/2017

Decreased from 4 to 4
Description
Gene has several association studies which are not genome-wide significant.
Reports Added
[Exome Pool-Seq in neurodevelopmental disorders.2017]4/1/2015

Decreased from 4 to 4
Description
Gene has several association studies which are not genome-wide significant.
7/1/2014

Increased from No data to 4
Description
Gene has several association studies which are not genome-wide significant.
4/1/2014

Increased from No data to 4
Description
Gene has several association studies which are not genome-wide significant.
Krishnan Probability Score
Score 0.44726448879571
Ranking 13422/25841 scored genes
[Show Scoring Methodology]
ExAC Score
Score 0.99322249050876
Ranking 1648/18225 scored genes
[Show Scoring Methodology]
Sanders TADA Score
Score 0.93089286536752
Ranking 11551/18665 scored genes
[Show Scoring Methodology]
Larsen Cumulative Evidence Score
Score 34.5
Ranking 62/461 scored genes
[Show Scoring Methodology]
Zhang D Score
Score -0.23396601316553
Ranking 16094/20870 scored genes
[Show Scoring Methodology]