MAOAmonoamine oxidase A
Autism Reports / Total Reports
10 / 20Rare Variants / Common Variants
12 / 5Aliases
-Associated Syndromes
Brunner syndromeChromosome Band
Xp11.3Associated Disorders
DD/NDDRelevance to Autism
The 3-repeat MAO-uVNTR (low-activity) allele was associated with increased severity of autism, as measured by parent and teacher reports, IQ, adaptive skills, language assessments and multiple other scoring methods (Cohen et al., 2003 & 2011) and was found to be associated with ASD in a Korean population cohort (Yoo et al., 2009). In addition, genetic association has been found between MAOA and ADHD in an Indian population cohort (Das et al., 2006).
Molecular Function
The encoded protein degrades amine neurotransmitters.
External Links
SFARI Genomic Platforms
Reports related to MAOA (20 Reports)
| # | Type | Title | Author, Year | Autism Report | Associated Disorders |
|---|---|---|---|---|---|
| 1 | Primary | Association of autism severity with a monoamine oxidase A functional polymorphism | Cohen IL , et al. (2003) | Yes | - |
| 2 | Recent Recommendation | MAOA, maltreatment, and gene-environment interaction predicting children's mental health: new evidence and a meta-analysis | Kim-Cohen J , et al. (2006) | No | - |
| 3 | Recent Recommendation | MAOA promoter polymorphism and attention deficit hyperactivity disorder (ADHD) in indian children | Das M , et al. (2006) | No | - |
| 4 | Positive Association | Family- and population-based association studies of monoamine oxidase A and autism spectrum disorders in Korean | Yoo HJ , et al. (2008) | Yes | - |
| 5 | Support | Deletion of MAOA and MAOB in a male patient causes severe developmental delay, intermittent hypotonia and stereotypical hand movements | Whibley A , et al. (2010) | No | - |
| 6 | Positive Association | Autism severity is associated with child and maternal MAOA genotypes | Cohen IL , et al. (2010) | Yes | - |
| 7 | Support | Monoamine oxidase A and A/B knockout mice display autistic-like features | Bortolato M , et al. (2012) | No | - |
| 8 | Support | MAOA/B deletion syndrome in male siblings with severe developmental delay and sudden loss of muscle tonus | Saito M , et al. (2013) | Yes | DD |
| 9 | Recent Recommendation | 20 ans après: a second mutation in MAOA identified by targeted high-throughput sequencing in a family with altered behavior and cognition | Piton A , et al. (2013) | Yes | - |
| 10 | Positive Association | Sexual dimorphic effect in the genetic association of monoamine oxidase A (MAOA) markers with autism spectrum disorder | Verma D , et al. (2013) | Yes | - |
| 11 | Recent Recommendation | New insights into Brunner syndrome and potential for targeted therapy | Palmer EE , et al. (2015) | No | - |
| 12 | Support | Integrated analysis of whole-exome sequencing and transcriptome profiling in males with autism spectrum disorders | Codina-Sol M , et al. (2015) | Yes | - |
| 13 | Support | Exome Pool-Seq in neurodevelopmental disorders | Popp B , et al. (2017) | No | Behavioral anomalies |
| 14 | Support | Targeted Next-Generation Sequencing in Patients with Suggestive X-Linked Intellectual Disability | Ibarluzea N , et al. (2020) | No | - |
| 15 | Support | - | Alonso-Gonzalez A et al. (2021) | Yes | - |
| 16 | Support | - | Hu C et al. (2022) | Yes | - |
| 17 | Support | - | Prah A et al. (2022) | No | - |
| 18 | Support | - | Tuncay IO et al. (2023) | Yes | - |
| 19 | Highly Cited | Aggressive behavior and altered amounts of brain serotonin and norepinephrine in mice lacking MAOA | Cases O , et al. (1995) | No | - |
| 20 | Highly Cited | Abnormal behavior associated with a point mutation in the structural gene for monoamine oxidase A | Brunner HG , et al. (1993) | No | - |
Rare Variants (12)
| Status | Allele Change | Residue Change | Variant Type | Inheritance Pattern | Parental Transmission | Family Type | PubMed ID | Author, Year |
|---|---|---|---|---|---|---|---|---|
| - | - | copy_number_loss | Familial | Maternal | Multiplex | 23414621 | Saito M , et al. (2013) | |
| - | - | copy_number_loss | Familial | Maternal | Multiplex | 20485326 | Whibley A , et al. (2010) | |
| c.208G>A | p.Val70Met | missense_variant | Familial | Maternal | - | 35741772 | Hu C et al. (2022) | |
| c.730G>A | p.Val244Ile | missense_variant | Familial | Maternal | - | 29158550 | Popp B , et al. (2017) | |
| c.710A>T | p.Gln237Leu | missense_variant | Familial | Maternal | - | 37492102 | Tuncay IO et al. (2023) | |
| c.815C>T | p.Ala272Val | missense_variant | De novo | - | Simplex | 33431980 | Alonso-Gonzalez A et al. (2021) | |
| c.1438-2A>G | - | splice_site_variant | Familial | Maternal | Multiplex | 25969726 | Codina-Sol M , et al. (2015) | |
| c.133C>T | p.Arg45Trp | missense_variant | Familial | Maternal | Multiplex | 25807999 | Palmer EE , et al. (2015) | |
| c.617G>A | p.Arg206Gln | missense_variant | Familial | Maternal | Multiplex | 31906484 | Ibarluzea N , et al. (2020) | |
| c.886C>T | p.Gln296Ter | stop_gained | Familial | Maternal | Multi-generational | 8211186 | Brunner HG , et al. (1993) | |
| c.749_750insT | p.Ser251LysfsTer2 | frameshift_variant | Unknown | - | Multiplex | 25807999 | Palmer EE , et al. (2015) | |
| c.797_798delinsTT | p.Cys266Phe | missense_variant | Familial | Maternal | Multi-generational | 24169519 | Piton A , et al. (2013) |
Common Variants (5)
| Status | Allele Change | Residue Change | Variant Type | Inheritance Pattern | Paternal Transmission | Family Type | PubMed ID | Author, Year |
|---|---|---|---|---|---|---|---|---|
| c.-1241_-1212ACCGGCACCGGCACCAGTACCCGCACCAGT(3_5) | - | microsatellite | - | - | - | 16856146 | Das M , et al. (2006) | |
| c.-1241_-1212ACCGGCACCGGCACCAGTACCCGCACCAGT(3_5) | - | microsatellite | - | - | - | 19100789 | Yoo HJ , et al. (2008) | |
| c.-1241_-1212ACCGGCACCGGCACCAGTACCCGCACCAGT(3_5) | - | microsatellite | - | - | - | 12919132 | Cohen IL , et al. (2003) | |
| c.-1241_-1212ACCGGCACCGGCACCAGTACCCGCACCAGT(3_5) | - | microsatellite | - | - | - | 20573161 | Cohen IL , et al. (2010) | |
| c.891G>T;c.492G>T | p.(=) | synonymous_variant | - | - | - | 24291416 | Verma D , et al. (2013) |
SFARI Gene score
2
Strong Candidate
Gene has several association studies which are not genome-wide significant.
Score Delta: Score remained at 2
criteria met
See SFARI Gene'scoring criteriaWe considered a rigorous statistical comparison between cases and controls, yielding genome-wide statistical significance, with independent replication, to be the strongest possible evidence for a gene. These criteria were relaxed slightly for category 2.
4/1/2022
3
2
Decreased from 3 to 2
Description
Gene has several association studies which are not genome-wide significant.
1/1/2021
3
3
Decreased from 3 to 3
Description
Gene has several association studies which are not genome-wide significant.
1/1/2020
3
3
Decreased from 3 to 3
Description
Gene has several association studies which are not genome-wide significant.
10/1/2019
4
3
Decreased from 4 to 3
New Scoring Scheme
Description
Gene has several association studies which are not genome-wide significant.
Reports Added
[New Scoring Scheme]7/1/2018
4
4
Decreased from 4 to 4
Description
Gene has several association studies which are not genome-wide significant.
10/1/2017
4
4
Decreased from 4 to 4
Description
Gene has several association studies which are not genome-wide significant.
Reports Added
[Exome Pool-Seq in neurodevelopmental disorders.2017]4/1/2015
4
4
Decreased from 4 to 4
Description
Gene has several association studies which are not genome-wide significant.
7/1/2014
No data
4
Increased from No data to 4
Description
Gene has several association studies which are not genome-wide significant.
4/1/2014
No data
4
Increased from No data to 4
Description
Gene has several association studies which are not genome-wide significant.
Krishnan Probability Score
Score 0.44726448879571
Ranking 13422/25841 scored genes
[Show Scoring Methodology]
Krishnan and colleagues generated probability scores genome-wide by using a machine learning
approach on a human brain-specific gene network. The method was first presented in Nat
Neurosci 19, 1454-1462 (2016), and scores for more than 25,000 RefSeq genes can be accessed
in column G of supplementary table 3 (see:
http://www.nature.com/neuro/journal/v19/n11/extref/nn.4353-S5.xlsx). A searchable browser,
with the ability to view networks of associated ASD risk genes, can be found at
asd.princeton.edu.
ExAC Score
Score 0.99322249050876
Ranking 1648/18225 scored genes
[Show Scoring Methodology]
The Exome Aggregation Consortium (ExAC) is a summary database of 60,706 exomes that has
been widely used to estimate 'constraint' on mutation for individual genes. It was introduced by
Lek et al. Nature 536, 285-291 (2016), and the ExAC browser can be found at
exac.broadinstitute.org. The pLI score was developed as measure of intolerance to loss-of-
function mutation. A pLI > 0.9 is generally viewed as highly constrained, and thus any loss-of-
function mutations in autism in such a gene would be more likely to confer risk. For a full list of
pLI scores see:
ftp://ftp.broadinstitute.org/pub/ExAC_release/release0.3.1/functional_gene_constraint/fordist_cle
aned_exac_nonTCGA_z_pli_rec_null_data.txt
Sanders TADA Score
Score 0.93089286536752
Ranking 11551/18665 scored genes
[Show Scoring Methodology]
The TADA score ('Transmission and De novo Association') was introduced by He et al. PLoS Genet 9(8):e1003671 (2013),
and is a statistic that integrates evidence from both de novo and transmitted mutations.
It forms the basis for the claim of 65 individual genes being strongly associated with autism risk at a false discovery rate of 0.1 (Sanders et al. Neuron 87, 1215-1233
(2015)). The calculated TADA score for 18,665 RefSeq genes can be found in column P of Supplementary Table 6 in the Sanders et al. paper
(the column headed 'tadaFdrAscSscExomeSscAgpSmallDel'), which represents a combined analysis of exome data and small de novo deletions (see www.cell.com/cms/attachment/2038545319/2052606711/mmc7.xlsx).
Larsen Cumulative Evidence Score
Score 34.5
Ranking 62/461 scored genes
[Show Scoring Methodology]
Larsen and colleagues generated gene scores based on the sum of evidence for all available
ASD-associated variants in a gene, with assessments based on mode of inheritance, effect size,
and variant frequency in the general population. The approach was first presented in Mol Autism
7:44 (2016), and scores for 461 genes can be found in column I in supplementary table 4 from
that paper.
Zhang D Score
Score -0.23396601316553
Ranking 16094/20870 scored genes
[Show Scoring Methodology]
The DAMAGES score (disease-associated mutation analysis using gene expression signatures),
or D score, was developed to combine evidence from de novo loss-of- function mutation with
evidence from cell-type- specific gene expression in the mouse brain (specifically translational
profiles of 24 specific mouse CNS cell types isolated from 6 different brain regions). Genes with
positive D scores are more likely to be associated with autism risk, with higher-confidence genes
having higher D scores. This statistic was first presented by Zhang & Shen (Hum Mutat 38, 204-
215 (2017), and D scores for more than 20,000 RefSeq genes can be found in column M in
supplementary table 2 from that paper.