Human Gene Module / Chromosome 16 / TSC2

TSC2tuberous sclerosis 2

SFARI Gene Score
1S
High Confidence, Syndromic Criteria 1.1, Syndromic
Autism Reports / Total Reports
38 / 72
Rare Variants / Common Variants
137 / 1
Aliases
TSC2, LAM,  TSC4,  FLJ43106
Associated Syndromes
-
Chromosome Band
16p13.3
Associated Disorders
DD/NDD, ID, EP, EPS, ASD
Relevance to Autism

Mutations in TSC2 cause the autosomal dominant disorder tuberous sclerosis (TSC). About 25% of individuals with TSC have autism and 40%-50% meet diagnostic criteria within the autistic spectrum disorders (Smalley et al., 1998). Schaaf et al., 2011 and Kelleher et al., 2012 identified a number of TSC2 missense variants in ASD probands that were not observed in control populations. Rare de novo and inherited missense variants in TSC2 have been identified in ASD probands from the Simons Simplex Collection (ORoak et al., 2012; Bahl et al., 2013; Iossifov et al., 2014), as well as in ASD probands from the Autism Clinical and Genetic Resources in China (ACGC) cohort (Wang et al., 2016). Targeted gene panel screening of a clinical population of 100 children with ASD from the Connecticut Childrens Medical Center Autism Neurogenetics Program in Kalsner et al., 2016 identified 18 rare TSC2 variants in ASD cases (18.0%) compared to 9.8% in the ExAC database (P = 0.0062); the statistical enrichment of rare TSC2 variants in ASD cases remained significant after multiple comparisons correction. Addtional de novo loss-of-function variants and potentially damaging missense variants in the TSC2 gene were reported in ASD probands from the Autism Sequencing Consortium, the MSSNG cohort, and the SPARK cohort in Zhou et al., 2022; a two-stage analysis of rare de novo and inherited coding variants in 42,607 ASD cases, including 35,130 new cases from the SPARK cohort, in this report identified TSC2 as a gene reaching exome-wide significance (P < 2.5E-06).

Molecular Function

The product of this gene is believed to be a tumor suppressor and is able to stimulate specific GTPases.

SFARI Genomic Platforms
Reports related to TSC2 (72 Reports)
# Type Title Author, Year Autism Report Associated Disorders
1 Highly Cited Tsc tumour suppressor proteins antagonize amino-acid-TOR signalling Gao X , et al. (2002) No -
2 Positive Association Association of INPP1, PIK3CG, and TSC2 gene variants with autistic disorder: implications for phosphatidylinositol signalling in autism Serajee FJ , et al. (2003) Yes -
3 Recent Recommendation Neuroepileptic correlates of autistic symptomatology in tuberous sclerosis Bolton PF (2004) No -
4 Recent Recommendation Regulation of neuronal morphology and function by the tumor suppressors Tsc1 and Tsc2 Tavazoie SF , et al. (2005) No -
5 Recent Recommendation Reversal of learning deficits in a Tsc2+/- mouse model of tuberous sclerosis Ehninger D , et al. (2008) No -
6 Recent Recommendation Tuberous sclerosis complex proteins control axon formation Choi YJ , et al. (2008) No -
7 Recent Recommendation ARD1 stabilization of TSC2 suppresses tumorigenesis through the mTOR signaling pathway Kuo HP , et al. (2010) No -
8 Support Oligogenic heterozygosity in individuals with high-functioning autism spectrum disorders Schaaf CP , et al. (2011) Yes -
9 Support Sporadic autism exomes reveal a highly interconnected protein network of de novo mutations O'Roak BJ , et al. (2012) Yes -
10 Support High-throughput sequencing of mGluR signaling pathway genes reveals enrichment of rare variants in autism Kelleher RJ 3rd , et al. (2012) Yes -
11 Negative Association Lack of association of rare functional variants in TSC1/TSC2 genes with autism spectrum disorder Bahl S , et al. (2013) Yes -
12 Support Performance comparison of bench-top next generation sequencers using microdroplet PCR-based enrichment for targeted sequencing in patients with autism spectrum disorder Koshimizu E , et al. (2013) Yes ID, epilepsy
13 Recent Recommendation Identification of regions critical for the integrity of the TSC1-TSC2-TBC1D7 complex Santiago Lima AJ , et al. (2014) No -
14 Recent Recommendation Loss of mTOR-dependent macroautophagy causes autistic-like synaptic pruning deficits Tang G , et al. (2014) No -
15 Support Excess of rare, inherited truncating mutations in autism Krumm N , et al. (2015) Yes -
16 Recent Recommendation Low load for disruptive mutations in autism genes and their biased transmission Iossifov I , et al. (2015) Yes -
17 Support Next-generation sequencing using a pre-designed gene panel for the molecular diagnosis of congenital disorders in pediatric patients Lim EC , et al. (2015) No MCAs
18 Support Everolimus improves neuropsychiatric symptoms in a patient with tuberous sclerosis carrying a novel TSC2 mutation Hwang SK , et al. (2016) No ASD, DD, epilepsy
19 Support De novo genic mutations among a Chinese autism spectrum disorder cohort Wang T , et al. (2016) Yes -
20 Support Targeted sequencing identifies 91 neurodevelopmental-disorder risk genes with autism and developmental-disability biases Stessman HA , et al. (2017) Yes -
21 Support Somatic Mutations in TSC1 and TSC2 Cause Focal Cortical Dysplasia Lim JS , et al. (2017) No -
22 Recent Recommendation Genetic testing including targeted gene panel in a diverse clinical population of children with autism spectrum disorder: Findings and implications Kalsner L , et al. (2017) Yes -
23 Support Diagnostic exome sequencing of syndromic epilepsy patients in clinical practice Tumien B , et al. (2017) No DD, specific learning disability
24 Recent Recommendation Purkinje cells derived from TSC patients display hypoexcitability and synaptic deficits associated with reduced FMRP levels and reversed by rapamycin Sundberg M , et al. (2018) No -
25 Recent Recommendation Regionally specific TSC1 and TSC2 gene expression in tuberous sclerosis complex Li Y , et al. (2018) No -
26 Support Targeted resequencing of 358 candidate genes for autism spectrum disorder in a Chinese cohort reveals diagnostic potential and genotype-phenotype correlations Zhou WZ , et al. (2019) Yes -
27 Support Neurological Diseases With Autism Spectrum Disorder: Role of ASD Risk Genes Xiong J , et al. (2019) Yes Tuberous sclerosis complex, epilepsy/seizures
28 Support Inherited and De Novo Genetic Risk for Autism Impacts Shared Networks Ruzzo EK , et al. (2019) Yes -
29 Support Autism risk in offspring can be assessed through quantification of male sperm mosaicism Breuss MW , et al. (2019) Yes -
30 Support Rare genetic susceptibility variants assessment in autism spectrum disorder: detection rate and practical use Husson T , et al. (2020) Yes -
31 Support Utility of clinical exome sequencing in a complex Emirati pediatric cohort Mahfouz NA et al. (2020) Yes -
32 Support Next-Generation Sequencing in Korean Children With Autism Spectrum Disorder and Comorbid Epilepsy Lee J et al. (2020) Yes Epilepsy/seizures, tuberous sclerosis
33 Support - Zou D et al. (2021) No -
34 Support - Hisatsune C et al. (2021) No -
35 Support - Takanezawa Y et al. (2021) No -
36 Support - Pagani M et al. (2021) Yes -
37 Support - Chen S et al. (2021) Yes Epilepsy/seizures
38 Support - Ferreira H et al. (2022) Yes -
39 Support - Joly F et al. (2022) No -
40 Support - Kútna V et al. (2022) Yes -
41 Support - Verberne EA et al. (2022) No -
42 Support - Marcogliese PC et al. (2022) Yes -
43 Support - Chuan Z et al. (2022) No ID
44 Recent Recommendation - Zhou X et al. (2022) Yes -
45 Support - Granak S et al. (2022) Yes -
46 Support - Shimelis H et al. (2023) No BPD, depressive disorder, epilepsy/seizures
47 Support - Kashii H et al. (2023) Yes -
48 Support - Sanchis-Juan A et al. (2023) No -
49 Support - Karthika Ajit Valaparambil et al. () No -
50 Support - Luigi Vetri et al. (2024) No -
51 Support - Omri Bar et al. (2024) Yes ID
52 Support - Christine Chin-Jung Hsieh et al. (2024) No ASD
53 Support - Magdalena Badura-Stronka et al. (2024) No -
54 Support - Alessia Romagnolo et al. (2024) No -
55 Support - Olga Doszyn et al. (2024) Yes -
56 Support - Karen Lob et al. () Yes Epilepsy/seizures
57 Support - Hosneara Akter et al. () No ASD, epilepsy/seizures
58 Support - Guihua Lai et al. (2024) No -
59 Support - Chengyan Li et al. (2024) No -
60 Support - Paola Granata et al. (2024) Yes -
61 Support - Mary-Bronwen L Chalkley et al. () No -
62 Support - Pauline Martin et al. () No -
63 Support - Antonia Ramme et al. (2025) Yes -
64 Support - Mariana Lapo Pais et al. (2025) Yes -
65 Support - Helena Ferreira et al. (2025) Yes -
66 Support - Congcong Chen et al. () Yes -
67 Support - Gabriela Repiská et al. (2025) Yes -
68 Support - Ruohao Wu et al. (2025) Yes -
69 Support - Silvia Guerrera et al. (2026) Yes -
70 Recent Recommendation - Natividad Avila, Marina et al. (2026) Yes -
71 Highly Cited Interaction between hamartin and tuberin, the TSC1 and TSC2 gene products van Slegtenhorst M , et al. (1998) No -
72 Primary Autism and tuberous sclerosis Smalley SL (1998) No ASD
Rare Variants   (137)
Status Allele Change Residue Change Variant Type Inheritance Pattern Parental Transmission Family Type PubMed ID Author, Year
- - - - - - 9813776 Smalley SL (1998)
- - copy_number_loss Familial Maternal - 39136901 Karen Lob et al. ()
c.2838-122G>A - intron_variant Unknown - - 32477112 Lee J et al. (2020)
CCTT>C - inframe_deletion Unknown - - 29271092 Kalsner L , et al. (2017)
c.599+1G>A - splice_site_variant Unknown - - 34145886 Zou D et al. (2021)
c.1839+1G>T - splice_site_variant Unknown - - 34145886 Zou D et al. (2021)
c.2639+2T>C - splice_site_variant Unknown - - 34145886 Zou D et al. (2021)
c.775-1G>C - splice_site_variant De novo - - 35982159 Zhou X et al. (2022)
c.2353C>T p.Gln785Ter stop_gained Unknown - - 34145886 Zou D et al. (2021)
c.849-3T>G - splice_region_variant Unknown - - 34145886 Zou D et al. (2021)
c.1444-1G>A - splice_site_variant De novo - - 35982159 Zhou X et al. (2022)
c.1957A>T p.Arg653Ter stop_gained De novo - - 35982159 Zhou X et al. (2022)
c.4639G>A p.Val1547Ile missense_variant - - - 28215400 Lim JS , et al. (2017)
G>T - intergenic_variant De novo - Multiplex 40738258 Congcong Chen et al. ()
c.4662+1G>A - splice_site_variant De novo - - 29286531 Tumien B , et al. (2017)
c.4494-2A>C p.? splice_site_variant De novo - - 41127290 Ruohao Wu et al. (2025)
CCTT>C - inframe_deletion Familial Maternal - 29271092 Kalsner L , et al. (2017)
c.1443+1G>A - splice_site_variant Unknown - - 35253369 Verberne EA et al. (2022)
c.2089T>G p.Leu697Val missense_variant De novo - - 35982159 Zhou X et al. (2022)
c.2636C>T p.Ser879Phe missense_variant De novo - - 35982159 Zhou X et al. (2022)
c.2742G>C p.Lys914Asn missense_variant De novo - - 35982159 Zhou X et al. (2022)
c.632C>T p.Ser211Phe missense_variant Unknown - - 35571021 Chuan Z et al. (2022)
c.3412C>T p.Arg1138Ter stop_gained Unknown - - 36475376 Shimelis H et al. (2023)
c.4537G>A p.Glu1513Lys missense_variant De novo - - 35982159 Zhou X et al. (2022)
c.4856T>C p.Phe1619Ser missense_variant De novo - - 35982159 Zhou X et al. (2022)
c.2377G>A p.Glu793Lys missense_variant De novo - - 27824329 Wang T , et al. (2016)
c.1168A>T p.Thr390Ser missense_variant Unknown - - 35571021 Chuan Z et al. (2022)
c.4183C>T p.Gln1395Ter stop_gained Unknown - - 35253369 Verberne EA et al. (2022)
c.1839+6G>A - intron_variant - - Multiplex 22558107 Kelleher RJ 3rd , et al. (2012)
c.5069-8C>T - intron_variant - - Multiplex 22558107 Kelleher RJ 3rd , et al. (2012)
c.3284+1G>A - splice_site_variant Familial Paternal - 34145886 Zou D et al. (2021)
c.5126C>T p.Pro1709Leu missense_variant Unknown - - 35571021 Chuan Z et al. (2022)
c.5323A>T p.Lys1775Ter stop_gained De novo - - 28191889 Stessman HA , et al. (2017)
c.*5G>A - 3_prime_UTR_variant - - Multiplex 22558107 Kelleher RJ 3rd , et al. (2012)
c.583A>G p.Ile195Val missense_variant De novo - - 29271092 Kalsner L , et al. (2017)
c.*26G>A - 3_prime_UTR_variant - - Multiplex 22558107 Kelleher RJ 3rd , et al. (2012)
c.1318G>A p.Gly440Ser missense_variant Unknown - - 29271092 Kalsner L , et al. (2017)
c.1747G>A p.Ala583Thr missense_variant Unknown - - 29271092 Kalsner L , et al. (2017)
c.2035G>A p.Val679Met missense_variant Unknown - - 29271092 Kalsner L , et al. (2017)
c.2133G>T p.Glu711Asp missense_variant Unknown - - 39342494 Hosneara Akter et al. ()
c.2510T>C p.Leu837Pro missense_variant Unknown - - 39342494 Hosneara Akter et al. ()
c.600-1G>A - splice_site_variant De novo - Simplex 31873310 Breuss MW , et al. (2019)
c.4744_4746del p.Ile1582del inframe_deletion Unknown - - 32477112 Lee J et al. (2020)
c.5065A>G p.Lys1689Glu missense_variant Unknown - - 29271092 Kalsner L , et al. (2017)
c.5359G>A p.Gly1787Ser missense_variant Unknown - - 29271092 Kalsner L , et al. (2017)
c.5172G>T p.Gln1724His missense_variant Unknown - - 39342494 Hosneara Akter et al. ()
c.1572dupC p.Asn525fs frameshift_variant Unknown - - 39439447 Guihua Lai et al. (2024)
c.4678G>A p.Ala1560Thr missense_variant De novo - - 38256219 Luigi Vetri et al. (2024)
c.2838-122G>A - intron_variant Unknown - Simplex 37541188 Sanchis-Juan A et al. (2023)
c.2044G>C p.Gly682Arg missense_variant De novo - Simplex 35982159 Zhou X et al. (2022)
c.2586G>A p.Ala862= synonymous_variant De novo - Simplex 35982159 Zhou X et al. (2022)
c.1318G>A p.Gly440Ser missense_variant Unknown - - 39654053 Paola Granata et al. (2024)
c.2475del p.Leu826TrpfsTer3 frameshift_variant De novo - - 35982159 Zhou X et al. (2022)
c.4470G>C p.Glu1490Asp missense_variant De novo - Simplex 35982159 Zhou X et al. (2022)
c.5378G>A p.Arg1793Gln missense_variant Unknown - - 39654053 Paola Granata et al. (2024)
c.4589dup p.Val1531GlyfsTer35 frameshift_variant Unknown - - 34145886 Zou D et al. (2021)
c.1864C>T p.Arg622Trp missense_variant Familial Paternal - 34800434 Chen S et al. (2021)
c.1643G>T p.Arg548Met missense_variant De novo - Simplex 25961944 Krumm N , et al. (2015)
c.148A>G p.Met50Val missense_variant Unknown - Simplex 21624971 Schaaf CP , et al. (2011)
c.1939G>A p.Asp647Asn missense_variant Familial Paternal - 27824329 Wang T , et al. (2016)
c.2182del p.Cys728AlafsTer43 frameshift_variant Unknown - - 35571021 Chuan Z et al. (2022)
c.4285G>T p.Ala1429Ser missense_variant Familial - Simplex 23514105 Bahl S , et al. (2013)
c.919C>G p.His307Asp missense_variant Familial Maternal - 30763456 Zhou WZ , et al. (2019)
c.3100G>A p.Val1034Ile missense_variant Familial Maternal - 27824329 Wang T , et al. (2016)
c.1864C>T p.Arg622Trp missense_variant Familial Paternal - 31031587 Xiong J , et al. (2019)
c.886G>A p.Val296Met missense_variant Familial Paternal - 29286531 Tumien B , et al. (2017)
c.1378G>A p.Ala460Thr missense_variant Unknown - Simplex 21624971 Schaaf CP , et al. (2011)
c.1609C>T p.Arg537Cys missense_variant Unknown - Simplex 21624971 Schaaf CP , et al. (2011)
c.1816A>G p.Ile606Val missense_variant Unknown - Simplex 21624971 Schaaf CP , et al. (2011)
c.2712C>G p.Phe904Leu missense_variant Unknown - Simplex 21624971 Schaaf CP , et al. (2011)
c.1754G>A p.Arg585His missense_variant Unknown - Simplex 32382396 Mahfouz NA et al. (2020)
c.433G>A p.Ala145Thr missense_variant - - Multiplex 22558107 Kelleher RJ 3rd , et al. (2012)
c.618C>T p.Cys206= synonymous_variant - - Multiplex 22558107 Kelleher RJ 3rd , et al. (2012)
c.2859dup p.Lys954GlnfsTer6 frameshift_variant Unknown - - 36475376 Shimelis H et al. (2023)
c.3293C>T p.Pro1098Leu missense_variant Unknown - Simplex 21624971 Schaaf CP , et al. (2011)
c.4106G>A p.Arg1369Gln missense_variant Unknown - Simplex 21624971 Schaaf CP , et al. (2011)
c.4273G>A p.Gly1425Arg missense_variant Unknown - Simplex 21624971 Schaaf CP , et al. (2011)
c.4738C>T p.Arg1580Trp missense_variant De novo - Simplex 22495309 O'Roak BJ , et al. (2012)
c.1292C>T p.Ala431Val missense_variant - - Multiplex 22558107 Kelleher RJ 3rd , et al. (2012)
c.1912G>A p.Val638Met missense_variant - - Multiplex 22558107 Kelleher RJ 3rd , et al. (2012)
c.2155T>C p.Tyr719His missense_variant - - Multiplex 22558107 Kelleher RJ 3rd , et al. (2012)
c.2621C>T p.Pro874Leu missense_variant - - Multiplex 22558107 Kelleher RJ 3rd , et al. (2012)
c.1143G>A p.Arg381= synonymous_variant - - Multiplex 22558107 Kelleher RJ 3rd , et al. (2012)
c.2086_2087del p.Cys696LeufsTer6 frameshift_variant De novo - - 35982159 Zhou X et al. (2022)
c.1070C>T p.Ala357Val missense_variant Familial Paternal - 29271092 Kalsner L , et al. (2017)
c.1747G>A p.Ala583Thr missense_variant Familial Maternal - 29271092 Kalsner L , et al. (2017)
c.1865G>A p.Arg622Gln missense_variant Familial Paternal - 29271092 Kalsner L , et al. (2017)
c.1946T>C p.Met649Thr missense_variant Familial Maternal - 29271092 Kalsner L , et al. (2017)
c.2153G>C p.Arg718Pro missense_variant Familial Paternal - 29271092 Kalsner L , et al. (2017)
c.2032G>A p.Ala678Thr missense_variant Unknown - Unknown 24066114 Koshimizu E , et al. (2013)
c.3252C>G p.Asp1084Glu missense_variant - - Multiplex 22558107 Kelleher RJ 3rd , et al. (2012)
c.3827C>T p.Ser1276Phe missense_variant - - Multiplex 22558107 Kelleher RJ 3rd , et al. (2012)
c.3914C>T p.Pro1305Leu missense_variant - - Multiplex 22558107 Kelleher RJ 3rd , et al. (2012)
c.3974G>A p.Gly1325Asp missense_variant - - Multiplex 22558107 Kelleher RJ 3rd , et al. (2012)
c.4051G>A p.Glu1351Lys missense_variant - - Multiplex 22558107 Kelleher RJ 3rd , et al. (2012)
c.4316G>A p.Gly1439Asp missense_variant - - Multiplex 22558107 Kelleher RJ 3rd , et al. (2012)
c.4460C>G p.Ser1487Cys missense_variant - - Multiplex 22558107 Kelleher RJ 3rd , et al. (2012)
c.3126G>T p.Pro1042= synonymous_variant - - Multiplex 22558107 Kelleher RJ 3rd , et al. (2012)
c.4341C>T p.Ser1447= synonymous_variant - - Multiplex 22558107 Kelleher RJ 3rd , et al. (2012)
c.5028G>A p.Leu1676= synonymous_variant - - Multiplex 22558107 Kelleher RJ 3rd , et al. (2012)
c.5175G>A p.Val1725= synonymous_variant - - Multiplex 22558107 Kelleher RJ 3rd , et al. (2012)
c.4678G>A p.Ala1560Thr missense_variant Unknown - - 40869941 Gabriela Repiská et al. (2025)
c.5317C>T p.His1773Tyr missense_variant Unknown - - 40869941 Gabriela Repiská et al. (2025)
c.5238_5255del p.His1746_Arg1751del inframe_deletion De novo - - 35982159 Zhou X et al. (2022)
c.4285G>T p.Ala1429Ser missense_variant Familial Maternal - 29271092 Kalsner L , et al. (2017)
c.5359G>A p.Gly1787Ser missense_variant Familial Maternal - 29271092 Kalsner L , et al. (2017)
c.5413G>A p.Glu1805Lys missense_variant Familial Paternal - 29271092 Kalsner L , et al. (2017)
c.190A>G p.Ile64Val missense_variant Familial Paternal Simplex 23514105 Bahl S , et al. (2013)
c.454C>G p.His152Asp missense_variant Familial Maternal Simplex 23514105 Bahl S , et al. (2013)
c.4538_4548del p.Glu1513AlafsTer7 frameshift_variant De novo - - 30763456 Zhou WZ , et al. (2019)
c.4663-7_4663-1delCCCACAG - splice_site_variant Unknown - - 41716258 Silvia Guerrera et al. (2026)
c.1853T>C p.Leu618Pro missense_variant De novo - - 41912808 Natividad Avila, Marina et al. (2026)
c.2607C>T p.Phe869= synonymous_variant De novo - - 41912808 Natividad Avila, Marina et al. (2026)
c.5025_5032dup p.Tyr1678CysfsTer151 frameshift_variant De novo - - 35571021 Chuan Z et al. (2022)
c.1597A>C p.Lys533Gln missense_variant Familial Maternal Simplex 23514105 Bahl S , et al. (2013)
c.2861A>G p.Lys954Arg missense_variant Familial Paternal Simplex 23514105 Bahl S , et al. (2013)
c.2950G>C p.Glu984Gln missense_variant Familial Paternal Simplex 23514105 Bahl S , et al. (2013)
c.3202del p.Thr1068LeufsTer2 frameshift_variant Unknown - Unknown 26666243 Lim EC , et al. (2015)
c.4912_4914del p.Lys1638del inframe_deletion De novo - Simplex 39439447 Guihua Lai et al. (2024)
c.4672G>A p.Glu1558Lys missense_variant Unknown - - 37943464 Karthika Ajit Valaparambil et al. ()
c.5228G>A p.Arg1743Gln missense_variant De novo - - 41912808 Natividad Avila, Marina et al. (2026)
c.5306A>C p.His1769Pro missense_variant De novo - - 41912808 Natividad Avila, Marina et al. (2026)
c.2070C>G p.Phe690Leu missense_variant Familial Maternal Simplex 38256266 Omri Bar et al. (2024)
c.1597A>C p.Lys533Gln missense_variant Familial Maternal Simplex 21624971 Schaaf CP , et al. (2011)
c.2950G>C p.Glu984Gln missense_variant Familial Paternal Simplex 21624971 Schaaf CP , et al. (2011)
c.3422C>T p.Ala1141Val missense_variant Familial Paternal Simplex 21624971 Schaaf CP , et al. (2011)
c.5094C>A p.Ser1698Arg missense_variant Familial Maternal Simplex 21624971 Schaaf CP , et al. (2011)
c.3023_3026del p.Val1008AlafsTer7 frameshift_variant De novo - Simplex 32094338 Husson T , et al. (2020)
C>CCAGCGGGTAGGGAATATGGGGCTCCCT - inframe_insertion Familial Paternal - 29271092 Kalsner L , et al. (2017)
c.880G>A p.Gly294Arg missense_variant De novo - Simplex 38328757 Magdalena Badura-Stronka et al. (2024)
c.5068+2T>C - splice_site_variant Familial Paternal Multiplex 38328757 Magdalena Badura-Stronka et al. (2024)
c.3846_3854del p.Ser1282_Gly1285delinsArg inframe_deletion De novo - Simplex 21624971 Schaaf CP , et al. (2011)
c.2636C>T p.Ser879Phe missense_variant De novo - Multiplex (monozygotic twins) 31398340 Ruzzo EK , et al. (2019)
c.538_539del p.Leu180GlyfsTer8 frameshift_variant Familial - Multi-generational 27216612 Hwang SK , et al. (2016)
c.4544_4547del p.Asn1515SerfsTer60 frameshift_variant De novo - Simplex 41912808 Natividad Avila, Marina et al. (2026)
c.5332_5387del p.Ala1778HisfsTer89 frameshift_variant Familial Maternal Multi-generational 39528574 Chengyan Li et al. (2024)
c.2032G>A p.Ala678Thr missense_variant Familial (1 case); unknown (1 case) Maternal (1 case) Simplex 21624971 Schaaf CP , et al. (2011)
Common Variants   (1)
Status Allele Change Residue Change Variant Type Inheritance Pattern Paternal Transmission Family Type PubMed ID Author, Year
c.482-348A>G;c.755-348A>G;c.644-348A>G;c.551-348A>G C/T intron_variant - - - 14627686 Serajee FJ , et al. (2003)
SFARI Gene score
1S

High Confidence, Syndromic

Score Delta: Score remained at 1S

1

High Confidence

See all Category 1 Genes

We considered a rigorous statistical comparison between cases and controls, yielding genome-wide statistical significance, with independent replication, to be the strongest possible evidence for a gene. These criteria were relaxed slightly for category 2.

The syndromic category includes mutations that are associated with a substantial degree of increased risk and consistently linked to additional characteristics not required for an ASD diagnosis. If there is independent evidence implicating a gene in idiopathic ASD, it will be listed as "#S" (e.g., 2S, 3S, etc.). If there is no such independent evidence, the gene will be listed simply as "S."

4/1/2020
1
icon
1

Score remained at 1

Description

Mutations in TSC2 cause the autosomal dominant disorder tuberous sclerosis (TSC). About 25% of individuals with TSC have autism and 40%-50% meet diagnostic criteria within the autistic spectrum disorders (Smalley et al., 1998). Schaaf et al., 2011 and Kelleher et al., 2012 identified a number of TSC2 missense variants in ASD probands that were not observed in control populations. Rare de novo and inherited missense variants in TSC2 have been identified in ASD probands from the Simons Simplex Collection (ORoak et al., 2012; Bahl et al., 2013; Iossifov et al., 2014), as well as in ASD probands from the Autism Clinical and Genetic Resources in China (ACGC) cohort (Wang et al., 2016). Targeted gene panel screening of a clinical population of 100 children with ASD from the Connecticut Childrens Medical Center Autism Neurogenetics Program in Kalsner et al., 2016 identified 18 rare variants in ASD cases (18.0%) compared to 9.8% in the ExAC database (P = 0.0062); the statistical enrichment of rare TSC2 variants in ASD cases remained significant after multiple comparisons correction.

1/1/2020
1
icon
1

Score remained at 1

Description

Mutations in TSC2 cause the autosomal dominant disorder tuberous sclerosis (TSC). About 25% of individuals with TSC have autism and 40%-50% meet diagnostic criteria within the autistic spectrum disorders (Smalley et al., 1998). Schaaf et al., 2011 and Kelleher et al., 2012 identified a number of TSC2 missense variants in ASD probands that were not observed in control populations. Rare de novo and inherited missense variants in TSC2 have been identified in ASD probands from the Simons Simplex Collection (ORoak et al., 2012; Bahl et al., 2013; Iossifov et al., 2014), as well as in ASD probands from the Autism Clinical and Genetic Resources in China (ACGC) cohort (Wang et al., 2016). Targeted gene panel screening of a clinical population of 100 children with ASD from the Connecticut Childrens Medical Center Autism Neurogenetics Program in Kalsner et al., 2016 identified 18 rare variants in ASD cases (18.0%) compared to 9.8% in the ExAC database (P = 0.0062); the statistical enrichment of rare TSC2 variants in ASD cases remained significant after multiple comparisons correction.

10/1/2019
3S
icon
1

Decreased from 3S to 1

New Scoring Scheme
Description

Mutations in TSC2 cause the autosomal dominant disorder tuberous sclerosis (TSC). About 25% of individuals with TSC have autism and 40%-50% meet diagnostic criteria within the autistic spectrum disorders (Smalley et al., 1998). Schaaf et al., 2011 and Kelleher et al., 2012 identified a number of TSC2 missense variants in ASD probands that were not observed in control populations. Rare de novo and inherited missense variants in TSC2 have been identified in ASD probands from the Simons Simplex Collection (ORoak et al., 2012; Bahl et al., 2013; Iossifov et al., 2014), as well as in ASD probands from the Autism Clinical and Genetic Resources in China (ACGC) cohort (Wang et al., 2016). Targeted gene panel screening of a clinical population of 100 children with ASD from the Connecticut Childrens Medical Center Autism Neurogenetics Program in Kalsner et al., 2016 identified 18 rare variants in ASD cases (18.0%) compared to 9.8% in the ExAC database (P = 0.0062); the statistical enrichment of rare TSC2 variants in ASD cases remained significant after multiple comparisons correction.

Reports Added
[New Scoring Scheme]
7/1/2019
3S
icon
3S

Decreased from 3S to 3S

Description

Mutations in TSC2 cause the autosomal dominant disorder tuberous sclerosis (TSC). About 25% of individuals with TSC have autism and 40%-50% meet diagnostic criteria within the autistic spectrum disorders (Smalley et al., 1998). Schaaf et al., 2011 and Kelleher et al., 2012 identified a number of TSC2 missense variants in ASD probands that were not observed in control populations. Rare de novo and inherited missense variants in TSC2 have been identified in ASD probands from the Simons Simplex Collection (ORoak et al., 2012; Bahl et al., 2013; Iossifov et al., 2014), as well as in ASD probands from the Autism Clinical and Genetic Resources in China (ACGC) cohort (Wang et al., 2016). Targeted gene panel screening of a clinical population of 100 children with ASD from the Connecticut Childrens Medical Center Autism Neurogenetics Program in Kalsner et al., 2016 identified 18 rare variants in ASD cases (18.0%) compared to 9.8% in the ExAC database (P = 0.0062); the statistical enrichment of rare TSC2 variants in ASD cases remained significant after multiple comparisons correction.

4/1/2019
3S
icon
3S

Decreased from 3S to 3S

Description

Mutations in TSC2 cause the autosomal dominant disorder tuberous sclerosis (TSC). About 25% of individuals with TSC have autism and 40%-50% meet diagnostic criteria within the autistic spectrum disorders (Smalley et al., 1998). Schaaf et al., 2011 and Kelleher et al., 2012 identified a number of TSC2 missense variants in ASD probands that were not observed in control populations. Rare de novo and inherited missense variants in TSC2 have been identified in ASD probands from the Simons Simplex Collection (ORoak et al., 2012; Bahl et al., 2013; Iossifov et al., 2014), as well as in ASD probands from the Autism Clinical and Genetic Resources in China (ACGC) cohort (Wang et al., 2016). Targeted gene panel screening of a clinical population of 100 children with ASD from the Connecticut Childrens Medical Center Autism Neurogenetics Program in Kalsner et al., 2016 identified 18 rare variants in ASD cases (18.0%) compared to 9.8% in the ExAC database (P = 0.0062); the statistical enrichment of rare TSC2 variants in ASD cases remained significant after multiple comparisons correction.

1/1/2019
3S
icon
3S

Decreased from 3S to 3S

Description

Mutations in TSC2 cause the autosomal dominant disorder tuberous sclerosis (TSC). About 25% of individuals with TSC have autism and 40%-50% meet diagnostic criteria within the autistic spectrum disorders (Smalley et al., 1998). Schaaf et al., 2011 and Kelleher et al., 2012 identified a number of TSC2 missense variants in ASD probands that were not observed in control populations. Rare de novo and inherited missense variants in TSC2 have been identified in ASD probands from the Simons Simplex Collection (ORoak et al., 2012; Bahl et al., 2013; Iossifov et al., 2014), as well as in ASD probands from the Autism Clinical and Genetic Resources in China (ACGC) cohort (Wang et al., 2016). Targeted gene panel screening of a clinical population of 100 children with ASD from the Connecticut Childrens Medical Center Autism Neurogenetics Program in Kalsner et al., 2016 identified 18 rare variants in ASD cases (18.0%) compared to 9.8% in the ExAC database (P = 0.0062); the statistical enrichment of rare TSC2 variants in ASD cases remained significant after multiple comparisons correction.

7/1/2018
S
icon
3S

Increased from S to 3S

Description

Mutations in TSC2 cause the autosomal dominant disorder tuberous sclerosis (TSC). About 25% of individuals with TSC have autism and 40%-50% meet diagnostic criteria within the autistic spectrum disorders (Smalley et al., 1998). Schaaf et al., 2011 and Kelleher et al., 2012 identified a number of TSC2 missense variants in ASD probands that were not observed in control populations. Rare de novo and inherited missense variants in TSC2 have been identified in ASD probands from the Simons Simplex Collection (ORoak et al., 2012; Bahl et al., 2013; Iossifov et al., 2014), as well as in ASD probands from the Autism Clinical and Genetic Resources in China (ACGC) cohort (Wang et al., 2016). Targeted gene panel screening of a clinical population of 100 children with ASD from the Connecticut Childrens Medical Center Autism Neurogenetics Program in Kalsner et al., 2016 identified 18 rare variants in ASD cases (18.0%) compared to 9.8% in the ExAC database (P = 0.0062); the statistical enrichment of rare TSC2 variants in ASD cases remained significant after multiple comparisons correction.

1/1/2017
S
icon
S

Increased from S to S

Description

Mutations in TSC2 cause the autosomal dominant disorder tuberous sclerosis (TSC). About 25% of individuals with TSC have autism and 40%-50% meet diagnostic criteria within the autistic spectrum disorders.

10/1/2016
S
icon
S

Increased from S to S

Description

Mutations in TSC2 cause the autosomal dominant disorder tuberous sclerosis (TSC). About 25% of individuals with TSC have autism and 40%-50% meet diagnostic criteria within the autistic spectrum disorders.

4/1/2016
S
icon
S

Increased from S to S

Description

Mutations in TSC2 cause the autosomal dominant disorder tuberous sclerosis (TSC). About 25% of individuals with TSC have autism and 40%-50% meet diagnostic criteria within the autistic spectrum disorders.

Reports Added
[Association of INPP1, PIK3CG, and TSC2 gene variants with autistic disorder: implications for phosphatidylinositol signalling in autism.2003] [Oligogenic heterozygosity in individuals with high-functioning autism spectrum disorders.2011] [Sporadic autism exomes reveal a highly interconnected protein network of de novo mutations.2012] [Lack of association of rare functional variants in TSC1/TSC2 genes with autism spectrum disorder.2013] [Performance comparison of bench-top next generation sequencers using microdroplet PCR-based enrichment for targeted sequencing in patients with aut...2013] [High-throughput sequencing of mGluR signaling pathway genes reveals enrichment of rare variants in autism.2012] [Autism and tuberous sclerosis.1998] [Interaction between hamartin and tuberin, the TSC1 and TSC2 gene products.1998] [Tsc tumour suppressor proteins antagonize amino-acid-TOR signalling.2002] [Neuroepileptic correlates of autistic symptomatology in tuberous sclerosis.2004] [Regulation of neuronal morphology and function by the tumor suppressors Tsc1 and Tsc2.2005] [Reversal of learning deficits in a Tsc2 mouse model of tuberous sclerosis.2008] [Tuberous sclerosis complex proteins control axon formation.2008] [ARD1 stabilization of TSC2 suppresses tumorigenesis through the mTOR signaling pathway.2010] [Identification of regions critical for the integrity of the TSC1-TSC2-TBC1D7 complex.2014] [Loss of mTOR-dependent macroautophagy causes autistic-like synaptic pruning deficits.2014] [Excess of rare, inherited truncating mutations in autism.2015] [Next-generation sequencing using a pre-designed gene panel for the molecular diagnosis of congenital disorders in pediatric patients.2015] [Low load for disruptive mutations in autism genes and their biased transmission.2015] [Everolimus improves neuropsychiatric symptoms in a patient with tuberous sclerosis carrying a novel TSC2 mutation.2016]
1/1/2016
S
icon
S

Increased from S to S

Description

Mutations in TSC2 cause the autosomal dominant disorder tuberous sclerosis (TSC). About 25% of individuals with TSC have autism and 40%-50% meet diagnostic criteria within the autistic spectrum disorders.

Reports Added
[Association of INPP1, PIK3CG, and TSC2 gene variants with autistic disorder: implications for phosphatidylinositol signalling in autism.2003] [Oligogenic heterozygosity in individuals with high-functioning autism spectrum disorders.2011] [Sporadic autism exomes reveal a highly interconnected protein network of de novo mutations.2012] [Lack of association of rare functional variants in TSC1/TSC2 genes with autism spectrum disorder.2013] [Performance comparison of bench-top next generation sequencers using microdroplet PCR-based enrichment for targeted sequencing in patients with aut...2013] [High-throughput sequencing of mGluR signaling pathway genes reveals enrichment of rare variants in autism.2012] [Autism and tuberous sclerosis.1998] [Interaction between hamartin and tuberin, the TSC1 and TSC2 gene products.1998] [Tsc tumour suppressor proteins antagonize amino-acid-TOR signalling.2002] [Neuroepileptic correlates of autistic symptomatology in tuberous sclerosis.2004] [Regulation of neuronal morphology and function by the tumor suppressors Tsc1 and Tsc2.2005] [Reversal of learning deficits in a Tsc2 mouse model of tuberous sclerosis.2008] [Tuberous sclerosis complex proteins control axon formation.2008] [ARD1 stabilization of TSC2 suppresses tumorigenesis through the mTOR signaling pathway.2010] [Identification of regions critical for the integrity of the TSC1-TSC2-TBC1D7 complex.2014] [Loss of mTOR-dependent macroautophagy causes autistic-like synaptic pruning deficits.2014] [Excess of rare, inherited truncating mutations in autism.2015] [Next-generation sequencing using a pre-designed gene panel for the molecular diagnosis of congenital disorders in pediatric patients.2015] [Low load for disruptive mutations in autism genes and their biased transmission.2015]
4/1/2015
S
icon
S

Increased from S to S

Description

Mutations in TSC2 cause the autosomal dominant disorder tuberous sclerosis (TSC). About 25% of individuals with TSC have autism and 40%-50% meet diagnostic criteria within the autistic spectrum disorders.

7/1/2014
No data
icon
S

Increased from No data to S

Description

Mutations in TSC2 cause the autosomal dominant disorder tuberous sclerosis (TSC). About 25% of individuals with TSC have autism and 40%-50% meet diagnostic criteria within the autistic spectrum disorders.

Reports Added
[Interaction between hamartin and tuberin, the TSC1 and TSC2 gene products.1998] [Autism and tuberous sclerosis.1998] [Tsc tumour suppressor proteins antagonize amino-acid-TOR signalling.2002] [Association of INPP1, PIK3CG, and TSC2 gene variants with autistic disorder: implications for phosphatidylinositol signalling in autism.2003] [Neuroepileptic correlates of autistic symptomatology in tuberous sclerosis.2004] [Regulation of neuronal morphology and function by the tumor suppressors Tsc1 and Tsc2.2005] [Reversal of learning deficits in a Tsc2 mouse model of tuberous sclerosis.2008] [Tuberous sclerosis complex proteins control axon formation.2008] [ARD1 stabilization of TSC2 suppresses tumorigenesis through the mTOR signaling pathway.2010] [Oligogenic heterozygosity in individuals with high-functioning autism spectrum disorders.2011] [Sporadic autism exomes reveal a highly interconnected protein network of de novo mutations.2012] [High-throughput sequencing of mGluR signaling pathway genes reveals enrichment of rare variants in autism.2012] [Lack of association of rare functional variants in TSC1/TSC2 genes with autism spectrum disorder.2013] [Performance comparison of bench-top next generation sequencers using microdroplet PCR-based enrichment for targeted sequencing in patients with aut...2013] [Identification of regions critical for the integrity of the TSC1-TSC2-TBC1D7 complex.2014] [Loss of mTOR-dependent macroautophagy causes autistic-like synaptic pruning deficits.2014]
4/1/2014
No data
icon
S

Increased from No data to S

Description

Mutations in TSC2 cause the autosomal dominant disorder tuberous sclerosis (TSC). About 25% of individuals with TSC have autism and 40%-50% meet diagnostic criteria within the autistic spectrum disorders.

Krishnan Probability Score

Score 0.44870913166388

Ranking 11448/25841 scored genes


[Show Scoring Methodology]
Krishnan and colleagues generated probability scores genome-wide by using a machine learning approach on a human brain-specific gene network. The method was first presented in Nat Neurosci 19, 1454-1462 (2016), and scores for more than 25,000 RefSeq genes can be accessed in column G of supplementary table 3 (see: http://www.nature.com/neuro/journal/v19/n11/extref/nn.4353-S5.xlsx). A searchable browser, with the ability to view networks of associated ASD risk genes, can be found at asd.princeton.edu.
ExAC Score

Score 0.99999998343251

Ranking 149/18225 scored genes


[Show Scoring Methodology]
The Exome Aggregation Consortium (ExAC) is a summary database of 60,706 exomes that has been widely used to estimate 'constraint' on mutation for individual genes. It was introduced by Lek et al. Nature 536, 285-291 (2016), and the ExAC browser can be found at exac.broadinstitute.org. The pLI score was developed as measure of intolerance to loss-of- function mutation. A pLI > 0.9 is generally viewed as highly constrained, and thus any loss-of- function mutations in autism in such a gene would be more likely to confer risk. For a full list of pLI scores see: ftp://ftp.broadinstitute.org/pub/ExAC_release/release0.3.1/functional_gene_constraint/fordist_cle aned_exac_nonTCGA_z_pli_rec_null_data.txt
Iossifov Probability Score

Score 0.965

Ranking 66/239 scored genes


[Show Scoring Methodology]
Supplementary dataset S2 in the paper by Iossifov et al. (PNAS 112, E5600-E5607 (2015)) lists 239 genes with a probability of at least 0.8 of being associated with autism risk (column I). This probability metric combines the evidence from de novo likely-gene- disrupting and missense mutations and assesses it against the background mutation rate in unaffected individuals from the University of Washington’s Exome Variant Sequence database (evs.gs.washington.edu/EVS/). The list of probability scores can be found here: www.pnas.org/lookup/suppl/doi:10.1073/pnas.1516376112/- /DCSupplemental/pnas.1516376112.sd02.xlsx
Sanders TADA Score

Score 0.73326661355522

Ranking 1401/18665 scored genes


[Show Scoring Methodology]
The TADA score ('Transmission and De novo Association') was introduced by He et al. PLoS Genet 9(8):e1003671 (2013), and is a statistic that integrates evidence from both de novo and transmitted mutations. It forms the basis for the claim of 65 individual genes being strongly associated with autism risk at a false discovery rate of 0.1 (Sanders et al. Neuron 87, 1215-1233 (2015)). The calculated TADA score for 18,665 RefSeq genes can be found in column P of Supplementary Table 6 in the Sanders et al. paper (the column headed 'tadaFdrAscSscExomeSscAgpSmallDel'), which represents a combined analysis of exome data and small de novo deletions (see www.cell.com/cms/attachment/2038545319/2052606711/mmc7.xlsx).
Zhang D Score

Score 0.34792152642383

Ranking 2047/20870 scored genes


[Show Scoring Methodology]
The DAMAGES score (disease-associated mutation analysis using gene expression signatures), or D score, was developed to combine evidence from de novo loss-of- function mutation with evidence from cell-type- specific gene expression in the mouse brain (specifically translational profiles of 24 specific mouse CNS cell types isolated from 6 different brain regions). Genes with positive D scores are more likely to be associated with autism risk, with higher-confidence genes having higher D scores. This statistic was first presented by Zhang & Shen (Hum Mutat 38, 204- 215 (2017), and D scores for more than 20,000 RefSeq genes can be found in column M in supplementary table 2 from that paper.
CNVs associated with TSC2(1 CNVs)
16p13.3 73 Deletion-Duplication 103  /  544
Interaction Table
Interactor Symbol Interactor Name Interactor Organism Interactor Type Entrez ID Uniprot ID
4-Sep septin 4 Human Protein Binding 5414 O43236
AMPK AMP-activated protein kinase alpha subunit Fruit Fly Protein Modification 43904 O18645
ATPsynd ATP synthase subunit d, mitochondrial Fruit Fly Direct Regulation 42291 Q24251
CRB3 crumbs homolog 3 (Drosophila) Human Protein Binding 92359 Q9BUF7
PIP4ks Phosphatidylinositol 5-phosphate 4-kinase type-2 gamma Mouse Direct Regulation 117150 Q91XU3
SERPINI1 serpin peptidase inhibitor, clade I (neuroserpin), member 1 Human Protein Binding 5274 Q99574
SPERT spermatid associated Human Protein Binding 220082 Q8NA61
SRCRB4D scavenger receptor cysteine rich domain containing, group B (4 domains) Human Protein Binding 136853 Q8WTU2
Submit New Gene

Report an Error