TSC2tuberous sclerosis 2
Autism Reports / Total Reports
37 / 71Rare Variants / Common Variants
132 / 1Aliases
TSC2, LAM, TSC4, FLJ43106Associated Syndromes
-Chromosome Band
16p13.3Associated Disorders
DD/NDD, ID, EP, EPS, ASDRelevance to Autism
Mutations in TSC2 cause the autosomal dominant disorder tuberous sclerosis (TSC). About 25% of individuals with TSC have autism and 40%-50% meet diagnostic criteria within the autistic spectrum disorders (Smalley et al., 1998). Schaaf et al., 2011 and Kelleher et al., 2012 identified a number of TSC2 missense variants in ASD probands that were not observed in control populations. Rare de novo and inherited missense variants in TSC2 have been identified in ASD probands from the Simons Simplex Collection (ORoak et al., 2012; Bahl et al., 2013; Iossifov et al., 2014), as well as in ASD probands from the Autism Clinical and Genetic Resources in China (ACGC) cohort (Wang et al., 2016). Targeted gene panel screening of a clinical population of 100 children with ASD from the Connecticut Childrens Medical Center Autism Neurogenetics Program in Kalsner et al., 2016 identified 18 rare TSC2 variants in ASD cases (18.0%) compared to 9.8% in the ExAC database (P = 0.0062); the statistical enrichment of rare TSC2 variants in ASD cases remained significant after multiple comparisons correction. Addtional de novo loss-of-function variants and potentially damaging missense variants in the TSC2 gene were reported in ASD probands from the Autism Sequencing Consortium, the MSSNG cohort, and the SPARK cohort in Zhou et al., 2022; a two-stage analysis of rare de novo and inherited coding variants in 42,607 ASD cases, including 35,130 new cases from the SPARK cohort, in this report identified TSC2 as a gene reaching exome-wide significance (P < 2.5E-06).
Molecular Function
The product of this gene is believed to be a tumor suppressor and is able to stimulate specific GTPases.
External Links
SFARI Genomic Platforms
Reports related to TSC2 (71 Reports)
| # | Type | Title | Author, Year | Autism Report | Associated Disorders |
|---|---|---|---|---|---|
| 1 | Highly Cited | Tsc tumour suppressor proteins antagonize amino-acid-TOR signalling | Gao X , et al. (2002) | No | - |
| 2 | Positive Association | Association of INPP1, PIK3CG, and TSC2 gene variants with autistic disorder: implications for phosphatidylinositol signalling in autism | Serajee FJ , et al. (2003) | Yes | - |
| 3 | Recent Recommendation | Neuroepileptic correlates of autistic symptomatology in tuberous sclerosis | Bolton PF (2004) | No | - |
| 4 | Recent Recommendation | Regulation of neuronal morphology and function by the tumor suppressors Tsc1 and Tsc2 | Tavazoie SF , et al. (2005) | No | - |
| 5 | Recent Recommendation | Reversal of learning deficits in a Tsc2+/- mouse model of tuberous sclerosis | Ehninger D , et al. (2008) | No | - |
| 6 | Recent Recommendation | Tuberous sclerosis complex proteins control axon formation | Choi YJ , et al. (2008) | No | - |
| 7 | Recent Recommendation | ARD1 stabilization of TSC2 suppresses tumorigenesis through the mTOR signaling pathway | Kuo HP , et al. (2010) | No | - |
| 8 | Support | Oligogenic heterozygosity in individuals with high-functioning autism spectrum disorders | Schaaf CP , et al. (2011) | Yes | - |
| 9 | Support | Sporadic autism exomes reveal a highly interconnected protein network of de novo mutations | O'Roak BJ , et al. (2012) | Yes | - |
| 10 | Support | High-throughput sequencing of mGluR signaling pathway genes reveals enrichment of rare variants in autism | Kelleher RJ 3rd , et al. (2012) | Yes | - |
| 11 | Negative Association | Lack of association of rare functional variants in TSC1/TSC2 genes with autism spectrum disorder | Bahl S , et al. (2013) | Yes | - |
| 12 | Support | Performance comparison of bench-top next generation sequencers using microdroplet PCR-based enrichment for targeted sequencing in patients with autism spectrum disorder | Koshimizu E , et al. (2013) | Yes | ID, epilepsy |
| 13 | Recent Recommendation | Identification of regions critical for the integrity of the TSC1-TSC2-TBC1D7 complex | Santiago Lima AJ , et al. (2014) | No | - |
| 14 | Recent Recommendation | Loss of mTOR-dependent macroautophagy causes autistic-like synaptic pruning deficits | Tang G , et al. (2014) | No | - |
| 15 | Support | Excess of rare, inherited truncating mutations in autism | Krumm N , et al. (2015) | Yes | - |
| 16 | Recent Recommendation | Low load for disruptive mutations in autism genes and their biased transmission | Iossifov I , et al. (2015) | Yes | - |
| 17 | Support | Next-generation sequencing using a pre-designed gene panel for the molecular diagnosis of congenital disorders in pediatric patients | Lim EC , et al. (2015) | No | MCAs |
| 18 | Support | Everolimus improves neuropsychiatric symptoms in a patient with tuberous sclerosis carrying a novel TSC2 mutation | Hwang SK , et al. (2016) | No | ASD, DD, epilepsy |
| 19 | Support | De novo genic mutations among a Chinese autism spectrum disorder cohort | Wang T , et al. (2016) | Yes | - |
| 20 | Support | Targeted sequencing identifies 91 neurodevelopmental-disorder risk genes with autism and developmental-disability biases | Stessman HA , et al. (2017) | Yes | - |
| 21 | Support | Somatic Mutations in TSC1 and TSC2 Cause Focal Cortical Dysplasia | Lim JS , et al. (2017) | No | - |
| 22 | Recent Recommendation | Genetic testing including targeted gene panel in a diverse clinical population of children with autism spectrum disorder: Findings and implications | Kalsner L , et al. (2017) | Yes | - |
| 23 | Support | Diagnostic exome sequencing of syndromic epilepsy patients in clinical practice | Tumien B , et al. (2017) | No | DD, specific learning disability |
| 24 | Recent Recommendation | Purkinje cells derived from TSC patients display hypoexcitability and synaptic deficits associated with reduced FMRP levels and reversed by rapamycin | Sundberg M , et al. (2018) | No | - |
| 25 | Recent Recommendation | Regionally specific TSC1 and TSC2 gene expression in tuberous sclerosis complex | Li Y , et al. (2018) | No | - |
| 26 | Support | Targeted resequencing of 358 candidate genes for autism spectrum disorder in a Chinese cohort reveals diagnostic potential and genotype-phenotype correlations | Zhou WZ , et al. (2019) | Yes | - |
| 27 | Support | Neurological Diseases With Autism Spectrum Disorder: Role of ASD Risk Genes | Xiong J , et al. (2019) | Yes | Tuberous sclerosis complex, epilepsy/seizures |
| 28 | Support | Inherited and De Novo Genetic Risk for Autism Impacts Shared Networks | Ruzzo EK , et al. (2019) | Yes | - |
| 29 | Support | Autism risk in offspring can be assessed through quantification of male sperm mosaicism | Breuss MW , et al. (2019) | Yes | - |
| 30 | Support | Rare genetic susceptibility variants assessment in autism spectrum disorder: detection rate and practical use | Husson T , et al. (2020) | Yes | - |
| 31 | Support | Utility of clinical exome sequencing in a complex Emirati pediatric cohort | Mahfouz NA et al. (2020) | Yes | - |
| 32 | Support | Next-Generation Sequencing in Korean Children With Autism Spectrum Disorder and Comorbid Epilepsy | Lee J et al. (2020) | Yes | Epilepsy/seizures, tuberous sclerosis |
| 33 | Support | - | Zou D et al. (2021) | No | - |
| 34 | Support | - | Hisatsune C et al. (2021) | No | - |
| 35 | Support | - | Takanezawa Y et al. (2021) | No | - |
| 36 | Support | - | Pagani M et al. (2021) | Yes | - |
| 37 | Support | - | Chen S et al. (2021) | Yes | Epilepsy/seizures |
| 38 | Support | - | Ferreira H et al. (2022) | Yes | - |
| 39 | Support | - | Joly F et al. (2022) | No | - |
| 40 | Support | - | Kútna V et al. (2022) | Yes | - |
| 41 | Support | - | Verberne EA et al. (2022) | No | - |
| 42 | Support | - | Marcogliese PC et al. (2022) | Yes | - |
| 43 | Support | - | Chuan Z et al. (2022) | No | ID |
| 44 | Recent Recommendation | - | Zhou X et al. (2022) | Yes | - |
| 45 | Support | - | Granak S et al. (2022) | Yes | - |
| 46 | Support | - | Shimelis H et al. (2023) | No | BPD, depressive disorder, epilepsy/seizures |
| 47 | Support | - | Kashii H et al. (2023) | Yes | - |
| 48 | Support | - | Sanchis-Juan A et al. (2023) | No | - |
| 49 | Support | - | Karthika Ajit Valaparambil et al. () | No | - |
| 50 | Support | - | Luigi Vetri et al. (2024) | No | - |
| 51 | Support | - | Omri Bar et al. (2024) | Yes | ID |
| 52 | Support | - | Christine Chin-Jung Hsieh et al. (2024) | No | ASD |
| 53 | Support | - | Magdalena Badura-Stronka et al. (2024) | No | - |
| 54 | Support | - | Alessia Romagnolo et al. (2024) | No | - |
| 55 | Support | - | Olga Doszyn et al. (2024) | Yes | - |
| 56 | Support | - | Karen Lob et al. () | Yes | Epilepsy/seizures |
| 57 | Support | - | Hosneara Akter et al. () | No | ASD, epilepsy/seizures |
| 58 | Support | - | Guihua Lai et al. (2024) | No | - |
| 59 | Support | - | Chengyan Li et al. (2024) | No | - |
| 60 | Support | - | Paola Granata et al. (2024) | Yes | - |
| 61 | Support | - | Mary-Bronwen L Chalkley et al. () | No | - |
| 62 | Support | - | Pauline Martin et al. () | No | - |
| 63 | Support | - | Antonia Ramme et al. (2025) | Yes | - |
| 64 | Support | - | Mariana Lapo Pais et al. (2025) | Yes | - |
| 65 | Support | - | Helena Ferreira et al. (2025) | Yes | - |
| 66 | Support | - | Congcong Chen et al. () | Yes | - |
| 67 | Support | - | Gabriela Repiská et al. (2025) | Yes | - |
| 68 | Support | - | Ruohao Wu et al. (2025) | Yes | - |
| 69 | Support | - | Silvia Guerrera et al. (2026) | Yes | - |
| 70 | Highly Cited | Interaction between hamartin and tuberin, the TSC1 and TSC2 gene products | van Slegtenhorst M , et al. (1998) | No | - |
| 71 | Primary | Autism and tuberous sclerosis | Smalley SL (1998) | No | ASD |
Rare Variants (132)
| Status | Allele Change | Residue Change | Variant Type | Inheritance Pattern | Parental Transmission | Family Type | PubMed ID | Author, Year |
|---|---|---|---|---|---|---|---|---|
| - | - | - | - | - | - | 9813776 | Smalley SL (1998) | |
| - | - | copy_number_loss | Familial | Maternal | - | 39136901 | Karen Lob et al. () | |
| c.2838-122G>A | - | intron_variant | Unknown | - | - | 32477112 | Lee J et al. (2020) | |
| CCTT>C | - | inframe_deletion | Unknown | - | - | 29271092 | Kalsner L , et al. (2017) | |
| c.599+1G>A | - | splice_site_variant | Unknown | - | - | 34145886 | Zou D et al. (2021) | |
| c.1839+1G>T | - | splice_site_variant | Unknown | - | - | 34145886 | Zou D et al. (2021) | |
| c.2639+2T>C | - | splice_site_variant | Unknown | - | - | 34145886 | Zou D et al. (2021) | |
| c.775-1G>C | - | splice_site_variant | De novo | - | - | 35982159 | Zhou X et al. (2022) | |
| c.2353C>T | p.Gln785Ter | stop_gained | Unknown | - | - | 34145886 | Zou D et al. (2021) | |
| c.849-3T>G | - | splice_region_variant | Unknown | - | - | 34145886 | Zou D et al. (2021) | |
| c.1444-1G>A | - | splice_site_variant | De novo | - | - | 35982159 | Zhou X et al. (2022) | |
| c.1957A>T | p.Arg653Ter | stop_gained | De novo | - | - | 35982159 | Zhou X et al. (2022) | |
| c.4639G>A | p.Val1547Ile | missense_variant | - | - | - | 28215400 | Lim JS , et al. (2017) | |
| G>T | - | intergenic_variant | De novo | - | Multiplex | 40738258 | Congcong Chen et al. () | |
| c.4662+1G>A | - | splice_site_variant | De novo | - | - | 29286531 | Tumien B , et al. (2017) | |
| c.4494-2A>C | p.? | splice_site_variant | De novo | - | - | 41127290 | Ruohao Wu et al. (2025) | |
| CCTT>C | - | inframe_deletion | Familial | Maternal | - | 29271092 | Kalsner L , et al. (2017) | |
| c.1443+1G>A | - | splice_site_variant | Unknown | - | - | 35253369 | Verberne EA et al. (2022) | |
| c.2089T>G | p.Leu697Val | missense_variant | De novo | - | - | 35982159 | Zhou X et al. (2022) | |
| c.2636C>T | p.Ser879Phe | missense_variant | De novo | - | - | 35982159 | Zhou X et al. (2022) | |
| c.2742G>C | p.Lys914Asn | missense_variant | De novo | - | - | 35982159 | Zhou X et al. (2022) | |
| c.632C>T | p.Ser211Phe | missense_variant | Unknown | - | - | 35571021 | Chuan Z et al. (2022) | |
| c.3412C>T | p.Arg1138Ter | stop_gained | Unknown | - | - | 36475376 | Shimelis H et al. (2023) | |
| c.4537G>A | p.Glu1513Lys | missense_variant | De novo | - | - | 35982159 | Zhou X et al. (2022) | |
| c.4856T>C | p.Phe1619Ser | missense_variant | De novo | - | - | 35982159 | Zhou X et al. (2022) | |
| c.2377G>A | p.Glu793Lys | missense_variant | De novo | - | - | 27824329 | Wang T , et al. (2016) | |
| c.1168A>T | p.Thr390Ser | missense_variant | Unknown | - | - | 35571021 | Chuan Z et al. (2022) | |
| c.4183C>T | p.Gln1395Ter | stop_gained | Unknown | - | - | 35253369 | Verberne EA et al. (2022) | |
| c.1839+6G>A | - | intron_variant | - | - | Multiplex | 22558107 | Kelleher RJ 3rd , et al. (2012) | |
| c.5069-8C>T | - | intron_variant | - | - | Multiplex | 22558107 | Kelleher RJ 3rd , et al. (2012) | |
| c.3284+1G>A | - | splice_site_variant | Familial | Paternal | - | 34145886 | Zou D et al. (2021) | |
| c.5126C>T | p.Pro1709Leu | missense_variant | Unknown | - | - | 35571021 | Chuan Z et al. (2022) | |
| c.5323A>T | p.Lys1775Ter | stop_gained | De novo | - | - | 28191889 | Stessman HA , et al. (2017) | |
| c.*5G>A | - | 3_prime_UTR_variant | - | - | Multiplex | 22558107 | Kelleher RJ 3rd , et al. (2012) | |
| c.583A>G | p.Ile195Val | missense_variant | De novo | - | - | 29271092 | Kalsner L , et al. (2017) | |
| c.*26G>A | - | 3_prime_UTR_variant | - | - | Multiplex | 22558107 | Kelleher RJ 3rd , et al. (2012) | |
| c.1318G>A | p.Gly440Ser | missense_variant | Unknown | - | - | 29271092 | Kalsner L , et al. (2017) | |
| c.1747G>A | p.Ala583Thr | missense_variant | Unknown | - | - | 29271092 | Kalsner L , et al. (2017) | |
| c.2035G>A | p.Val679Met | missense_variant | Unknown | - | - | 29271092 | Kalsner L , et al. (2017) | |
| c.2133G>T | p.Glu711Asp | missense_variant | Unknown | - | - | 39342494 | Hosneara Akter et al. () | |
| c.2510T>C | p.Leu837Pro | missense_variant | Unknown | - | - | 39342494 | Hosneara Akter et al. () | |
| c.600-1G>A | - | splice_site_variant | De novo | - | Simplex | 31873310 | Breuss MW , et al. (2019) | |
| c.4744_4746del | p.Ile1582del | inframe_deletion | Unknown | - | - | 32477112 | Lee J et al. (2020) | |
| c.5065A>G | p.Lys1689Glu | missense_variant | Unknown | - | - | 29271092 | Kalsner L , et al. (2017) | |
| c.5359G>A | p.Gly1787Ser | missense_variant | Unknown | - | - | 29271092 | Kalsner L , et al. (2017) | |
| c.5172G>T | p.Gln1724His | missense_variant | Unknown | - | - | 39342494 | Hosneara Akter et al. () | |
| c.1572dupC | p.Asn525fs | frameshift_variant | Unknown | - | - | 39439447 | Guihua Lai et al. (2024) | |
| c.4678G>A | p.Ala1560Thr | missense_variant | De novo | - | - | 38256219 | Luigi Vetri et al. (2024) | |
| c.2838-122G>A | - | intron_variant | Unknown | - | Simplex | 37541188 | Sanchis-Juan A et al. (2023) | |
| c.2044G>C | p.Gly682Arg | missense_variant | De novo | - | Simplex | 35982159 | Zhou X et al. (2022) | |
| c.2586G>A | p.Ala862= | synonymous_variant | De novo | - | Simplex | 35982159 | Zhou X et al. (2022) | |
| c.1318G>A | p.Gly440Ser | missense_variant | Unknown | - | - | 39654053 | Paola Granata et al. (2024) | |
| c.2475del | p.Leu826TrpfsTer3 | frameshift_variant | De novo | - | - | 35982159 | Zhou X et al. (2022) | |
| c.4470G>C | p.Glu1490Asp | missense_variant | De novo | - | Simplex | 35982159 | Zhou X et al. (2022) | |
| c.5378G>A | p.Arg1793Gln | missense_variant | Unknown | - | - | 39654053 | Paola Granata et al. (2024) | |
| c.4589dup | p.Val1531GlyfsTer35 | frameshift_variant | Unknown | - | - | 34145886 | Zou D et al. (2021) | |
| c.1864C>T | p.Arg622Trp | missense_variant | Familial | Paternal | - | 34800434 | Chen S et al. (2021) | |
| c.1643G>T | p.Arg548Met | missense_variant | De novo | - | Simplex | 25961944 | Krumm N , et al. (2015) | |
| c.148A>G | p.Met50Val | missense_variant | Unknown | - | Simplex | 21624971 | Schaaf CP , et al. (2011) | |
| c.1939G>A | p.Asp647Asn | missense_variant | Familial | Paternal | - | 27824329 | Wang T , et al. (2016) | |
| c.2182del | p.Cys728AlafsTer43 | frameshift_variant | Unknown | - | - | 35571021 | Chuan Z et al. (2022) | |
| c.4285G>T | p.Ala1429Ser | missense_variant | Familial | - | Simplex | 23514105 | Bahl S , et al. (2013) | |
| c.919C>G | p.His307Asp | missense_variant | Familial | Maternal | - | 30763456 | Zhou WZ , et al. (2019) | |
| c.3100G>A | p.Val1034Ile | missense_variant | Familial | Maternal | - | 27824329 | Wang T , et al. (2016) | |
| c.1864C>T | p.Arg622Trp | missense_variant | Familial | Paternal | - | 31031587 | Xiong J , et al. (2019) | |
| c.886G>A | p.Val296Met | missense_variant | Familial | Paternal | - | 29286531 | Tumien B , et al. (2017) | |
| c.1378G>A | p.Ala460Thr | missense_variant | Unknown | - | Simplex | 21624971 | Schaaf CP , et al. (2011) | |
| c.1609C>T | p.Arg537Cys | missense_variant | Unknown | - | Simplex | 21624971 | Schaaf CP , et al. (2011) | |
| c.1816A>G | p.Ile606Val | missense_variant | Unknown | - | Simplex | 21624971 | Schaaf CP , et al. (2011) | |
| c.2712C>G | p.Phe904Leu | missense_variant | Unknown | - | Simplex | 21624971 | Schaaf CP , et al. (2011) | |
| c.1754G>A | p.Arg585His | missense_variant | Unknown | - | Simplex | 32382396 | Mahfouz NA et al. (2020) | |
| c.433G>A | p.Ala145Thr | missense_variant | - | - | Multiplex | 22558107 | Kelleher RJ 3rd , et al. (2012) | |
| c.618C>T | p.Cys206= | synonymous_variant | - | - | Multiplex | 22558107 | Kelleher RJ 3rd , et al. (2012) | |
| c.2859dup | p.Lys954GlnfsTer6 | frameshift_variant | Unknown | - | - | 36475376 | Shimelis H et al. (2023) | |
| c.3293C>T | p.Pro1098Leu | missense_variant | Unknown | - | Simplex | 21624971 | Schaaf CP , et al. (2011) | |
| c.4106G>A | p.Arg1369Gln | missense_variant | Unknown | - | Simplex | 21624971 | Schaaf CP , et al. (2011) | |
| c.4273G>A | p.Gly1425Arg | missense_variant | Unknown | - | Simplex | 21624971 | Schaaf CP , et al. (2011) | |
| c.4738C>T | p.Arg1580Trp | missense_variant | De novo | - | Simplex | 22495309 | O'Roak BJ , et al. (2012) | |
| c.1292C>T | p.Ala431Val | missense_variant | - | - | Multiplex | 22558107 | Kelleher RJ 3rd , et al. (2012) | |
| c.1912G>A | p.Val638Met | missense_variant | - | - | Multiplex | 22558107 | Kelleher RJ 3rd , et al. (2012) | |
| c.2155T>C | p.Tyr719His | missense_variant | - | - | Multiplex | 22558107 | Kelleher RJ 3rd , et al. (2012) | |
| c.2621C>T | p.Pro874Leu | missense_variant | - | - | Multiplex | 22558107 | Kelleher RJ 3rd , et al. (2012) | |
| c.1143G>A | p.Arg381= | synonymous_variant | - | - | Multiplex | 22558107 | Kelleher RJ 3rd , et al. (2012) | |
| c.2086_2087del | p.Cys696LeufsTer6 | frameshift_variant | De novo | - | - | 35982159 | Zhou X et al. (2022) | |
| c.1070C>T | p.Ala357Val | missense_variant | Familial | Paternal | - | 29271092 | Kalsner L , et al. (2017) | |
| c.1747G>A | p.Ala583Thr | missense_variant | Familial | Maternal | - | 29271092 | Kalsner L , et al. (2017) | |
| c.1865G>A | p.Arg622Gln | missense_variant | Familial | Paternal | - | 29271092 | Kalsner L , et al. (2017) | |
| c.1946T>C | p.Met649Thr | missense_variant | Familial | Maternal | - | 29271092 | Kalsner L , et al. (2017) | |
| c.2153G>C | p.Arg718Pro | missense_variant | Familial | Paternal | - | 29271092 | Kalsner L , et al. (2017) | |
| c.2032G>A | p.Ala678Thr | missense_variant | Unknown | - | Unknown | 24066114 | Koshimizu E , et al. (2013) | |
| c.3252C>G | p.Asp1084Glu | missense_variant | - | - | Multiplex | 22558107 | Kelleher RJ 3rd , et al. (2012) | |
| c.3827C>T | p.Ser1276Phe | missense_variant | - | - | Multiplex | 22558107 | Kelleher RJ 3rd , et al. (2012) | |
| c.3914C>T | p.Pro1305Leu | missense_variant | - | - | Multiplex | 22558107 | Kelleher RJ 3rd , et al. (2012) | |
| c.3974G>A | p.Gly1325Asp | missense_variant | - | - | Multiplex | 22558107 | Kelleher RJ 3rd , et al. (2012) | |
| c.4051G>A | p.Glu1351Lys | missense_variant | - | - | Multiplex | 22558107 | Kelleher RJ 3rd , et al. (2012) | |
| c.4316G>A | p.Gly1439Asp | missense_variant | - | - | Multiplex | 22558107 | Kelleher RJ 3rd , et al. (2012) | |
| c.4460C>G | p.Ser1487Cys | missense_variant | - | - | Multiplex | 22558107 | Kelleher RJ 3rd , et al. (2012) | |
| c.3126G>T | p.Pro1042= | synonymous_variant | - | - | Multiplex | 22558107 | Kelleher RJ 3rd , et al. (2012) | |
| c.4341C>T | p.Ser1447= | synonymous_variant | - | - | Multiplex | 22558107 | Kelleher RJ 3rd , et al. (2012) | |
| c.5028G>A | p.Leu1676= | synonymous_variant | - | - | Multiplex | 22558107 | Kelleher RJ 3rd , et al. (2012) | |
| c.5175G>A | p.Val1725= | synonymous_variant | - | - | Multiplex | 22558107 | Kelleher RJ 3rd , et al. (2012) | |
| c.4678G>A | p.Ala1560Thr | missense_variant | Unknown | - | - | 40869941 | Gabriela Repiská et al. (2025) | |
| c.5317C>T | p.His1773Tyr | missense_variant | Unknown | - | - | 40869941 | Gabriela Repiská et al. (2025) | |
| c.5238_5255del | p.His1746_Arg1751del | inframe_deletion | De novo | - | - | 35982159 | Zhou X et al. (2022) | |
| c.4285G>T | p.Ala1429Ser | missense_variant | Familial | Maternal | - | 29271092 | Kalsner L , et al. (2017) | |
| c.5359G>A | p.Gly1787Ser | missense_variant | Familial | Maternal | - | 29271092 | Kalsner L , et al. (2017) | |
| c.5413G>A | p.Glu1805Lys | missense_variant | Familial | Paternal | - | 29271092 | Kalsner L , et al. (2017) | |
| c.190A>G | p.Ile64Val | missense_variant | Familial | Paternal | Simplex | 23514105 | Bahl S , et al. (2013) | |
| c.454C>G | p.His152Asp | missense_variant | Familial | Maternal | Simplex | 23514105 | Bahl S , et al. (2013) | |
| c.4538_4548del | p.Glu1513AlafsTer7 | frameshift_variant | De novo | - | - | 30763456 | Zhou WZ , et al. (2019) | |
| c.4663-7_4663-1delCCCACAG | - | splice_site_variant | Unknown | - | - | 41716258 | Silvia Guerrera et al. (2026) | |
| c.5025_5032dup | p.Tyr1678CysfsTer151 | frameshift_variant | De novo | - | - | 35571021 | Chuan Z et al. (2022) | |
| c.1597A>C | p.Lys533Gln | missense_variant | Familial | Maternal | Simplex | 23514105 | Bahl S , et al. (2013) | |
| c.2861A>G | p.Lys954Arg | missense_variant | Familial | Paternal | Simplex | 23514105 | Bahl S , et al. (2013) | |
| c.2950G>C | p.Glu984Gln | missense_variant | Familial | Paternal | Simplex | 23514105 | Bahl S , et al. (2013) | |
| c.3202del | p.Thr1068LeufsTer2 | frameshift_variant | Unknown | - | Unknown | 26666243 | Lim EC , et al. (2015) | |
| c.4912_4914del | p.Lys1638del | inframe_deletion | De novo | - | Simplex | 39439447 | Guihua Lai et al. (2024) | |
| c.4672G>A | p.Glu1558Lys | missense_variant | Unknown | - | - | 37943464 | Karthika Ajit Valaparambil et al. () | |
| c.2070C>G | p.Phe690Leu | missense_variant | Familial | Maternal | Simplex | 38256266 | Omri Bar et al. (2024) | |
| c.1597A>C | p.Lys533Gln | missense_variant | Familial | Maternal | Simplex | 21624971 | Schaaf CP , et al. (2011) | |
| c.2950G>C | p.Glu984Gln | missense_variant | Familial | Paternal | Simplex | 21624971 | Schaaf CP , et al. (2011) | |
| c.3422C>T | p.Ala1141Val | missense_variant | Familial | Paternal | Simplex | 21624971 | Schaaf CP , et al. (2011) | |
| c.5094C>A | p.Ser1698Arg | missense_variant | Familial | Maternal | Simplex | 21624971 | Schaaf CP , et al. (2011) | |
| c.3023_3026del | p.Val1008AlafsTer7 | frameshift_variant | De novo | - | Simplex | 32094338 | Husson T , et al. (2020) | |
| C>CCAGCGGGTAGGGAATATGGGGCTCCCT | - | inframe_insertion | Familial | Paternal | - | 29271092 | Kalsner L , et al. (2017) | |
| c.880G>A | p.Gly294Arg | missense_variant | De novo | - | Simplex | 38328757 | Magdalena Badura-Stronka et al. (2024) | |
| c.5068+2T>C | - | splice_site_variant | Familial | Paternal | Multiplex | 38328757 | Magdalena Badura-Stronka et al. (2024) | |
| c.3846_3854del | p.Ser1282_Gly1285delinsArg | inframe_deletion | De novo | - | Simplex | 21624971 | Schaaf CP , et al. (2011) | |
| c.2636C>T | p.Ser879Phe | missense_variant | De novo | - | Multiplex (monozygotic twins) | 31398340 | Ruzzo EK , et al. (2019) | |
| c.538_539del | p.Leu180GlyfsTer8 | frameshift_variant | Familial | - | Multi-generational | 27216612 | Hwang SK , et al. (2016) | |
| c.5332_5387del | p.Ala1778HisfsTer89 | frameshift_variant | Familial | Maternal | Multi-generational | 39528574 | Chengyan Li et al. (2024) | |
| c.2032G>A | p.Ala678Thr | missense_variant | Familial (1 case); unknown (1 case) | Maternal (1 case) | Simplex | 21624971 | Schaaf CP , et al. (2011) |
Common Variants (1)
| Status | Allele Change | Residue Change | Variant Type | Inheritance Pattern | Paternal Transmission | Family Type | PubMed ID | Author, Year |
|---|---|---|---|---|---|---|---|---|
| c.482-348A>G;c.755-348A>G;c.644-348A>G;c.551-348A>G | C/T | intron_variant | - | - | - | 14627686 | Serajee FJ , et al. (2003) |
SFARI Gene score
High Confidence, Syndromic

Score Delta: Score remained at 1S
criteria met
See SFARI Gene'scoring criteriaWe considered a rigorous statistical comparison between cases and controls, yielding genome-wide statistical significance, with independent replication, to be the strongest possible evidence for a gene. These criteria were relaxed slightly for category 2.
The syndromic category includes mutations that are associated with a substantial degree of increased risk and consistently linked to additional characteristics not required for an ASD diagnosis. If there is independent evidence implicating a gene in idiopathic ASD, it will be listed as "#S" (e.g., 2S, 3S, etc.). If there is no such independent evidence, the gene will be listed simply as "S."
4/1/2020

Score remained at 1
Description
Mutations in TSC2 cause the autosomal dominant disorder tuberous sclerosis (TSC). About 25% of individuals with TSC have autism and 40%-50% meet diagnostic criteria within the autistic spectrum disorders (Smalley et al., 1998). Schaaf et al., 2011 and Kelleher et al., 2012 identified a number of TSC2 missense variants in ASD probands that were not observed in control populations. Rare de novo and inherited missense variants in TSC2 have been identified in ASD probands from the Simons Simplex Collection (ORoak et al., 2012; Bahl et al., 2013; Iossifov et al., 2014), as well as in ASD probands from the Autism Clinical and Genetic Resources in China (ACGC) cohort (Wang et al., 2016). Targeted gene panel screening of a clinical population of 100 children with ASD from the Connecticut Childrens Medical Center Autism Neurogenetics Program in Kalsner et al., 2016 identified 18 rare variants in ASD cases (18.0%) compared to 9.8% in the ExAC database (P = 0.0062); the statistical enrichment of rare TSC2 variants in ASD cases remained significant after multiple comparisons correction.
1/1/2020

Score remained at 1
Description
Mutations in TSC2 cause the autosomal dominant disorder tuberous sclerosis (TSC). About 25% of individuals with TSC have autism and 40%-50% meet diagnostic criteria within the autistic spectrum disorders (Smalley et al., 1998). Schaaf et al., 2011 and Kelleher et al., 2012 identified a number of TSC2 missense variants in ASD probands that were not observed in control populations. Rare de novo and inherited missense variants in TSC2 have been identified in ASD probands from the Simons Simplex Collection (ORoak et al., 2012; Bahl et al., 2013; Iossifov et al., 2014), as well as in ASD probands from the Autism Clinical and Genetic Resources in China (ACGC) cohort (Wang et al., 2016). Targeted gene panel screening of a clinical population of 100 children with ASD from the Connecticut Childrens Medical Center Autism Neurogenetics Program in Kalsner et al., 2016 identified 18 rare variants in ASD cases (18.0%) compared to 9.8% in the ExAC database (P = 0.0062); the statistical enrichment of rare TSC2 variants in ASD cases remained significant after multiple comparisons correction.
10/1/2019

Decreased from 3S to 1
New Scoring Scheme
Description
Mutations in TSC2 cause the autosomal dominant disorder tuberous sclerosis (TSC). About 25% of individuals with TSC have autism and 40%-50% meet diagnostic criteria within the autistic spectrum disorders (Smalley et al., 1998). Schaaf et al., 2011 and Kelleher et al., 2012 identified a number of TSC2 missense variants in ASD probands that were not observed in control populations. Rare de novo and inherited missense variants in TSC2 have been identified in ASD probands from the Simons Simplex Collection (ORoak et al., 2012; Bahl et al., 2013; Iossifov et al., 2014), as well as in ASD probands from the Autism Clinical and Genetic Resources in China (ACGC) cohort (Wang et al., 2016). Targeted gene panel screening of a clinical population of 100 children with ASD from the Connecticut Childrens Medical Center Autism Neurogenetics Program in Kalsner et al., 2016 identified 18 rare variants in ASD cases (18.0%) compared to 9.8% in the ExAC database (P = 0.0062); the statistical enrichment of rare TSC2 variants in ASD cases remained significant after multiple comparisons correction.
Reports Added
[New Scoring Scheme]7/1/2019

Decreased from 3S to 3S
Description
Mutations in TSC2 cause the autosomal dominant disorder tuberous sclerosis (TSC). About 25% of individuals with TSC have autism and 40%-50% meet diagnostic criteria within the autistic spectrum disorders (Smalley et al., 1998). Schaaf et al., 2011 and Kelleher et al., 2012 identified a number of TSC2 missense variants in ASD probands that were not observed in control populations. Rare de novo and inherited missense variants in TSC2 have been identified in ASD probands from the Simons Simplex Collection (ORoak et al., 2012; Bahl et al., 2013; Iossifov et al., 2014), as well as in ASD probands from the Autism Clinical and Genetic Resources in China (ACGC) cohort (Wang et al., 2016). Targeted gene panel screening of a clinical population of 100 children with ASD from the Connecticut Childrens Medical Center Autism Neurogenetics Program in Kalsner et al., 2016 identified 18 rare variants in ASD cases (18.0%) compared to 9.8% in the ExAC database (P = 0.0062); the statistical enrichment of rare TSC2 variants in ASD cases remained significant after multiple comparisons correction.
4/1/2019

Decreased from 3S to 3S
Description
Mutations in TSC2 cause the autosomal dominant disorder tuberous sclerosis (TSC). About 25% of individuals with TSC have autism and 40%-50% meet diagnostic criteria within the autistic spectrum disorders (Smalley et al., 1998). Schaaf et al., 2011 and Kelleher et al., 2012 identified a number of TSC2 missense variants in ASD probands that were not observed in control populations. Rare de novo and inherited missense variants in TSC2 have been identified in ASD probands from the Simons Simplex Collection (ORoak et al., 2012; Bahl et al., 2013; Iossifov et al., 2014), as well as in ASD probands from the Autism Clinical and Genetic Resources in China (ACGC) cohort (Wang et al., 2016). Targeted gene panel screening of a clinical population of 100 children with ASD from the Connecticut Childrens Medical Center Autism Neurogenetics Program in Kalsner et al., 2016 identified 18 rare variants in ASD cases (18.0%) compared to 9.8% in the ExAC database (P = 0.0062); the statistical enrichment of rare TSC2 variants in ASD cases remained significant after multiple comparisons correction.
1/1/2019

Decreased from 3S to 3S
Description
Mutations in TSC2 cause the autosomal dominant disorder tuberous sclerosis (TSC). About 25% of individuals with TSC have autism and 40%-50% meet diagnostic criteria within the autistic spectrum disorders (Smalley et al., 1998). Schaaf et al., 2011 and Kelleher et al., 2012 identified a number of TSC2 missense variants in ASD probands that were not observed in control populations. Rare de novo and inherited missense variants in TSC2 have been identified in ASD probands from the Simons Simplex Collection (ORoak et al., 2012; Bahl et al., 2013; Iossifov et al., 2014), as well as in ASD probands from the Autism Clinical and Genetic Resources in China (ACGC) cohort (Wang et al., 2016). Targeted gene panel screening of a clinical population of 100 children with ASD from the Connecticut Childrens Medical Center Autism Neurogenetics Program in Kalsner et al., 2016 identified 18 rare variants in ASD cases (18.0%) compared to 9.8% in the ExAC database (P = 0.0062); the statistical enrichment of rare TSC2 variants in ASD cases remained significant after multiple comparisons correction.
7/1/2018

Increased from S to 3S
Description
Mutations in TSC2 cause the autosomal dominant disorder tuberous sclerosis (TSC). About 25% of individuals with TSC have autism and 40%-50% meet diagnostic criteria within the autistic spectrum disorders (Smalley et al., 1998). Schaaf et al., 2011 and Kelleher et al., 2012 identified a number of TSC2 missense variants in ASD probands that were not observed in control populations. Rare de novo and inherited missense variants in TSC2 have been identified in ASD probands from the Simons Simplex Collection (ORoak et al., 2012; Bahl et al., 2013; Iossifov et al., 2014), as well as in ASD probands from the Autism Clinical and Genetic Resources in China (ACGC) cohort (Wang et al., 2016). Targeted gene panel screening of a clinical population of 100 children with ASD from the Connecticut Childrens Medical Center Autism Neurogenetics Program in Kalsner et al., 2016 identified 18 rare variants in ASD cases (18.0%) compared to 9.8% in the ExAC database (P = 0.0062); the statistical enrichment of rare TSC2 variants in ASD cases remained significant after multiple comparisons correction.
1/1/2017

Increased from S to S
Description
Mutations in TSC2 cause the autosomal dominant disorder tuberous sclerosis (TSC). About 25% of individuals with TSC have autism and 40%-50% meet diagnostic criteria within the autistic spectrum disorders.
10/1/2016

Increased from S to S
Description
Mutations in TSC2 cause the autosomal dominant disorder tuberous sclerosis (TSC). About 25% of individuals with TSC have autism and 40%-50% meet diagnostic criteria within the autistic spectrum disorders.
4/1/2016

Increased from S to S
Description
Mutations in TSC2 cause the autosomal dominant disorder tuberous sclerosis (TSC). About 25% of individuals with TSC have autism and 40%-50% meet diagnostic criteria within the autistic spectrum disorders.
Reports Added
[Association of INPP1, PIK3CG, and TSC2 gene variants with autistic disorder: implications for phosphatidylinositol signalling in autism.2003] [Oligogenic heterozygosity in individuals with high-functioning autism spectrum disorders.2011] [Sporadic autism exomes reveal a highly interconnected protein network of de novo mutations.2012] [Lack of association of rare functional variants in TSC1/TSC2 genes with autism spectrum disorder.2013] [Performance comparison of bench-top next generation sequencers using microdroplet PCR-based enrichment for targeted sequencing in patients with aut...2013] [High-throughput sequencing of mGluR signaling pathway genes reveals enrichment of rare variants in autism.2012] [Autism and tuberous sclerosis.1998] [Interaction between hamartin and tuberin, the TSC1 and TSC2 gene products.1998] [Tsc tumour suppressor proteins antagonize amino-acid-TOR signalling.2002] [Neuroepileptic correlates of autistic symptomatology in tuberous sclerosis.2004] [Regulation of neuronal morphology and function by the tumor suppressors Tsc1 and Tsc2.2005] [Reversal of learning deficits in a Tsc2 mouse model of tuberous sclerosis.2008] [Tuberous sclerosis complex proteins control axon formation.2008] [ARD1 stabilization of TSC2 suppresses tumorigenesis through the mTOR signaling pathway.2010] [Identification of regions critical for the integrity of the TSC1-TSC2-TBC1D7 complex.2014] [Loss of mTOR-dependent macroautophagy causes autistic-like synaptic pruning deficits.2014] [Excess of rare, inherited truncating mutations in autism.2015] [Next-generation sequencing using a pre-designed gene panel for the molecular diagnosis of congenital disorders in pediatric patients.2015] [Low load for disruptive mutations in autism genes and their biased transmission.2015] [Everolimus improves neuropsychiatric symptoms in a patient with tuberous sclerosis carrying a novel TSC2 mutation.2016]1/1/2016

Increased from S to S
Description
Mutations in TSC2 cause the autosomal dominant disorder tuberous sclerosis (TSC). About 25% of individuals with TSC have autism and 40%-50% meet diagnostic criteria within the autistic spectrum disorders.
Reports Added
[Association of INPP1, PIK3CG, and TSC2 gene variants with autistic disorder: implications for phosphatidylinositol signalling in autism.2003] [Oligogenic heterozygosity in individuals with high-functioning autism spectrum disorders.2011] [Sporadic autism exomes reveal a highly interconnected protein network of de novo mutations.2012] [Lack of association of rare functional variants in TSC1/TSC2 genes with autism spectrum disorder.2013] [Performance comparison of bench-top next generation sequencers using microdroplet PCR-based enrichment for targeted sequencing in patients with aut...2013] [High-throughput sequencing of mGluR signaling pathway genes reveals enrichment of rare variants in autism.2012] [Autism and tuberous sclerosis.1998] [Interaction between hamartin and tuberin, the TSC1 and TSC2 gene products.1998] [Tsc tumour suppressor proteins antagonize amino-acid-TOR signalling.2002] [Neuroepileptic correlates of autistic symptomatology in tuberous sclerosis.2004] [Regulation of neuronal morphology and function by the tumor suppressors Tsc1 and Tsc2.2005] [Reversal of learning deficits in a Tsc2 mouse model of tuberous sclerosis.2008] [Tuberous sclerosis complex proteins control axon formation.2008] [ARD1 stabilization of TSC2 suppresses tumorigenesis through the mTOR signaling pathway.2010] [Identification of regions critical for the integrity of the TSC1-TSC2-TBC1D7 complex.2014] [Loss of mTOR-dependent macroautophagy causes autistic-like synaptic pruning deficits.2014] [Excess of rare, inherited truncating mutations in autism.2015] [Next-generation sequencing using a pre-designed gene panel for the molecular diagnosis of congenital disorders in pediatric patients.2015] [Low load for disruptive mutations in autism genes and their biased transmission.2015]4/1/2015

Increased from S to S
Description
Mutations in TSC2 cause the autosomal dominant disorder tuberous sclerosis (TSC). About 25% of individuals with TSC have autism and 40%-50% meet diagnostic criteria within the autistic spectrum disorders.
7/1/2014

Increased from No data to S
Description
Mutations in TSC2 cause the autosomal dominant disorder tuberous sclerosis (TSC). About 25% of individuals with TSC have autism and 40%-50% meet diagnostic criteria within the autistic spectrum disorders.
Reports Added
[Interaction between hamartin and tuberin, the TSC1 and TSC2 gene products.1998] [Autism and tuberous sclerosis.1998] [Tsc tumour suppressor proteins antagonize amino-acid-TOR signalling.2002] [Association of INPP1, PIK3CG, and TSC2 gene variants with autistic disorder: implications for phosphatidylinositol signalling in autism.2003] [Neuroepileptic correlates of autistic symptomatology in tuberous sclerosis.2004] [Regulation of neuronal morphology and function by the tumor suppressors Tsc1 and Tsc2.2005] [Reversal of learning deficits in a Tsc2 mouse model of tuberous sclerosis.2008] [Tuberous sclerosis complex proteins control axon formation.2008] [ARD1 stabilization of TSC2 suppresses tumorigenesis through the mTOR signaling pathway.2010] [Oligogenic heterozygosity in individuals with high-functioning autism spectrum disorders.2011] [Sporadic autism exomes reveal a highly interconnected protein network of de novo mutations.2012] [High-throughput sequencing of mGluR signaling pathway genes reveals enrichment of rare variants in autism.2012] [Lack of association of rare functional variants in TSC1/TSC2 genes with autism spectrum disorder.2013] [Performance comparison of bench-top next generation sequencers using microdroplet PCR-based enrichment for targeted sequencing in patients with aut...2013] [Identification of regions critical for the integrity of the TSC1-TSC2-TBC1D7 complex.2014] [Loss of mTOR-dependent macroautophagy causes autistic-like synaptic pruning deficits.2014]4/1/2014

Increased from No data to S
Description
Mutations in TSC2 cause the autosomal dominant disorder tuberous sclerosis (TSC). About 25% of individuals with TSC have autism and 40%-50% meet diagnostic criteria within the autistic spectrum disorders.
Krishnan Probability Score
Score 0.44870913166388
Ranking 11448/25841 scored genes
[Show Scoring Methodology]
ExAC Score
Score 0.99999998343251
Ranking 149/18225 scored genes
[Show Scoring Methodology]
Iossifov Probability Score
Score 0.965
Ranking 66/239 scored genes
[Show Scoring Methodology]
Sanders TADA Score
Score 0.73326661355522
Ranking 1401/18665 scored genes
[Show Scoring Methodology]
Zhang D Score
Score 0.34792152642383
Ranking 2047/20870 scored genes
[Show Scoring Methodology]
CNVs associated with TSC2(1 CNVs)
Sort By:
| 16p13.3 | 73 | Deletion-Duplication | 103 / 544 |
Interactome
- Protein Binding
- DNA Binding
- RNA Binding
- Protein Modification
- Direct Regulation
- ASD-Linked Genes
Interaction Table
| Interactor Symbol | Interactor Name | Interactor Organism | Interactor Type | Entrez ID | Uniprot ID |
|---|---|---|---|---|---|
| 4-Sep | septin 4 | Human | Protein Binding | 5414 | O43236 |
| AMPK | AMP-activated protein kinase alpha subunit | Fruit Fly | Protein Modification | 43904 | O18645 |
| ATPsynd | ATP synthase subunit d, mitochondrial | Fruit Fly | Direct Regulation | 42291 | Q24251 |
| CRB3 | crumbs homolog 3 (Drosophila) | Human | Protein Binding | 92359 | Q9BUF7 |
| PIP4ks | Phosphatidylinositol 5-phosphate 4-kinase type-2 gamma | Mouse | Direct Regulation | 117150 | Q91XU3 |
| SERPINI1 | serpin peptidase inhibitor, clade I (neuroserpin), member 1 | Human | Protein Binding | 5274 | Q99574 |
| SPERT | spermatid associated | Human | Protein Binding | 220082 | Q8NA61 |
| SRCRB4D | scavenger receptor cysteine rich domain containing, group B (4 domains) | Human | Protein Binding | 136853 | Q8WTU2 |