HELP     Sign In
Search

Relevance to Autism

Studies have identified rare mutations in the ANKRD11 gene with autism.

Molecular Function

Transcription factor that may recruit HDACs to the p160 coactivators/nuclear receptor complex to inhibit ligand-dependent transactivation. Defects in ANKRD11 are the cause of KBG syndrome (KBGS) [MIM:148050], a syndrome characterized by macrodontia of the upper central incisors, distinctive craniofacial findings, short stature, skeletal anomalies, and neurologic involvement that includes global developmental delay, seizures, and intellectual disability.

External Links

        

References

Type
Title
Type of Disorder
Associated Disorders
Author, Year
Primary
Structural variation of chromosomes in autism spectrum disorder.
ASD
Support
Haploinsufficiency of ANKRD11 causes mild cognitive impairment, short stature and minor dysmorphisms.
ID
ADHD
Support
Large-scale discovery of novel genetic causes of developmental disorders.
ASD, DD, ID
Support
Identification of ANKRD11 and ZNF778 as candidate genes for autism and variable cognitive impairment in the novel 16q24.3 microdeletion syndrome.
ASD
Support
The contribution of de novo coding mutations to autism spectrum disorder.
ASD
Support
De novo insertions and deletions of predominantly paternal origin are associated with autism spectrum disorder.
Support
Efficient strategy for the molecular diagnosis of intellectual disability using targeted high-throughput sequencing.
ID
Support
Massively parallel sequencing of patients with intellectual disability, congenital anomalies and/or autism spectrum disorders with a targeted gene panel.
DD, ID, ASD
MCA
Support
Mutations in ANKRD11 cause KBG syndrome, characterized by intellectual disability, skeletal malformations, and macrodontia.
ID
Support
Whole exome sequencing in females with autism implicates novel and candidate genes.
ASD
Highly Cited
Identification of a novel family of ankyrin repeats containing cofactors for p160 nuclear receptor coactivators.
Recent recommendation
Further delineation of the KBG syndrome phenotype caused by ANKRD11 aberrations.
KBG syndrome
ASD, ID, ADHD, epilepsy
Recent Recommendation
Identification of ANKRD11 as a p53 coactivator.
Recent Recommendation
Ankyrin repeats-containing cofactors interact with ADA3 and modulate its co-activator function.
Recent Recommendation
Subcellular localization of ankyrin repeats cofactor-1 regulates its corepressor activity.
Recent Recommendation
Ankrd11 is a chromatin regulator involved in autism that is essential for neural development.

Rare

Variant ID
Variant Type
Allele Change
Residue Change
Inheritance Pattern
Inheritance Association
Family Type
Author, Year
 GEN011R001 
 copy_number_loss 
 N/A 
 N/A 
 De novo 
  
  
 GEN011R002 
 copy_number_loss 
 N/A 
 N/A 
 De novo 
  
  
 GEN011R003 
 copy_number_loss 
 N/A 
 N/A 
 De novo 
  
  
 GEN011R004 
 copy_number_loss 
 N/A 
 N/A 
 De novo 
  
  
 GEN011R005 
 copy_number_loss 
 N/A 
 N/A 
 De novo 
  
 Simplex 
 GEN011R006 
 splice_site_variant 
 c.7570-1G>C 
 Glu2524_Lys2525del 
 Familial 
 Paternal 
 Multi-generational 
 GEN011R007 
 frameshift_variant 
 c.2305delT 
 p.Ser769GlnfsTer8 
 De novo 
  
 Simplex 
 GEN011R008 
 stop_gained 
 c.7189C>T 
 p.Gln2397Ter 
 De novo 
  
 Simplex 
 GEN011R009 
 frameshift_variant 
 c.5953_5954delCA 
 p.Gln1985GlufsTer46 
 De novo 
  
 Simplex 
 GEN011R010 
 frameshift_variant 
 c.6071_6084delCGTACGCTCTGCCC 
 p.Pro2024ArgfsTer3 
 De novo 
  
 Simplex 
 GEN011R011 
 copy_number_loss 
  
  
 De novo 
  
 Simplex 
 GEN011R012 
 copy_number_loss 
  
  
 De novo 
  
 Simplex 
 GEN011R013 
 missense_variant 
 C>T 
 p.Pro2290Sser 
 Familial 
 Maternal 
  
 GEN011R014 
 frameshift_variant 
 CTTTG>C 
  
 De novo 
  
 Simplex 
 GEN011R015 
 frameshift_variant 
 del(TGTTT) 
  
 De novo 
  
 Simplex 
 GEN011R016 
 frameshift_variant 
 c.7481dup 
 p.Pro2495fs 
 Familial 
 Maternal 
 Multi-generational 
 GEN011R017 
 frameshift_variant 
 c.4391_4392del 
 p.Lys1464fs 
 De novo 
  
  
 GEN011R018 
 frameshift_variant 
 c.6184del 
 p.Leu2062fs 
 De novo 
  
  
 GEN011R019 
 frameshift_variant 
 c.3123_3126del 
 p.Ile1042fs 
 De novo 
  
  
 GEN011R020 
 frameshift_variant 
 c.1460_1463del 
 p.Glu487fs 
 Unknown 
  
  
 GEN011R021 
 frameshift_variant 
 c.1903_1907del 
 p.Lys635fs 
 De novo 
  
  
 GEN011R022 
 stop_gained 
 c.3832A>T 
 p.Lys1278Ter 
 Familial 
  
 Multi-generational 
 GEN011R023 
 stop_gained 
 c.2751dup 
 p.Glu918Ter 
 De novo 
  
  
 GEN011R024 
 frameshift_variant 
 c.3382_3383del 
 p.Asp1128fs 
 De novo 
  
  
 GEN011R025 
 frameshift_variant 
 c.1903_1907del 
 p.Lys635fs 
 De novo 
  
  
 GEN011R026 
 frameshift_variant 
 c.6513dup 
 p.Gly2172fs 
 De novo 
  
  
 GEN011R027 
 stop_gained 
 c.1318C>T 
 p.Arg440Ter 
 Familial 
  
 Multi-generational 
 GEN011R028 
 frameshift_variant 
 CTGTTT/CT 
  
 De novo 
  
 Simplex 
 GEN011R029 
 frameshift_variant 
 CTTTTT/C 
  
 De novo 
  
 Simplex 
 GEN011R030 
 frameshift_variant 
 CTT/C 
  
 De novo 
  
 Simplex 
 GEN011R031 
 frameshift_variant 
 CTTTTT/C 
  
 De novo 
  
 Simplex 
 GEN011R032 
 frameshift_variant 
 GTGTTTTGTTTT/GTGTTTT 
  
 De novo 
  
 Simplex 
 GEN011R033 
 stop_gained 
 G/A 
 R/Ter 
 De novo 
  
 Simplex 
 GEN011R034 
 frameshift_variant 
 TC/T 
  
 De novo 
  
 Simplex 
 GEN011R035 
 frameshift_variant 
 TTCCTCCTTCTCCTGGAGGCCGTCCGTCCTC/TTCCT 
  
 De novo 
  
 Simplex 
 GEN011R036 
 missense_variant 
 C>G 
 p.Thr461Arg 
 Unknown 
  
 Multiplex 
 GEN011R037 
 missense_variant 
 c.4083C>A 
 p.His1363Gln 
 Familial 
 Maternal 
 Multiplex 

Common

No Common Variants Available



Model Summary

Identification of a novel genetic regulator of bone homeostasis.

External Links

AllenBrainAtlas   MGI Logo  Entrez Gene

References

Type
Title
Author, Year
Primary
An ENU-induced mutation in the Ankrd11 gene results in an osteopenia-like phenotype in the mouse mutant Yoda.
Additional
Ankrd11 is a chromatin regulator involved in autism that is essential for neural development.

ANKRD11_1_YODA_HM

Model Type: Genetic
Model Genotype: Homozygous
Mutation: Chemically induced mutagenesis utilizing N-ethyl-N-nitosourea (ENU) resulting in a G/C to A/T transition which leads to a nonconvervative substitution of lysine for glutamine in exon 11 of the Ankrd11 gene - Yoda mutation
Allele Type: Chemical Mutation
Strain of Origin: BALB/cCrlAnn
Genetic Background: C3H/HeH
ES Cell Line: Not Specified
Mutant ES Cell Line: Not Specified
Model Source: Not Specified

ANKRD11_2_YODA_HT

Model Type: Genetic
Model Genotype: Heterozygous
Mutation: Chemically induced mutagenesis utilizing N-ethyl-N-nitosourea (ENU) resulting in a G/C to A/T transition which leads to a nonconvervative substitution of lysine for glutamine in exon 11 of the Ankrd11 gene - Yoda mutation
Allele Type: Chemical Mutation
Strain of Origin: BALB/cCrlAnn
Genetic Background: C3H/HeH
ES Cell Line: Not Specified
Mutant ES Cell Line: Not Specified
Model Source: Not Specified

ANKRD11_3_KD

Model Type: Genetic
Model Genotype: Other
Mutation: In utero electroporation of E13/E14 cortices with Ankrd11 and EGFP small hairpin RNAs
Allele Type: Targeted (Knockdown)
Strain of Origin: CD1
Genetic Background: CD1
ES Cell Line: Not Specified
Mutant ES Cell Line: Not Specified
Model Source: Not Specified

ANKRD11_1_YODA_HM

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
Mortality/lethality1
Increased
Description: Embryonic lethality: Decreased size and failed to turn. Presence of allantoic remnants
Exp Paradigm: General observations
 General observations
 E9.5
 Not Reported: Circadian sleep/wake cycle ,   Communications ,   Emotion ,   Homeostasis ,   Immune response ,   Learning & memory ,   Maternal behavior ,   Molecular profile ,   Motor phenotype ,   Neuroanatomy / Ultrastructure / Cytoarchitecture ,   Neurophysiology ,   Repetitive behavior ,   Seizure ,   Sensory ,   Social behavior ,  

ANKRD11_2_YODA_HT

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
General locomotor activity: Ambulatory activity2
Decreased
Description: Decreased time traveling, but no change in velocity
Exp Paradigm: Open field test
 Open field test
 26 weeks
Neuronal differentiation and specification in the brain2
Decreased
Description: Decreased NeuN-positive BrdU cells in the SGZ of the dentate gyrus
Exp Paradigm: BrdU tracer injection in dentate gyrus 1 month prior; Immunohistochemistry: NeuN, BrdU
 Immunohistochemistry
 26 weeks
Neuronal migration2
Abnormal
Description: Mislocalized cells expressing BrdU, increased in IZ and decreased in CP
Exp Paradigm: BrdU tracer injection at E13.5; Immunohistochemistry: BrdU
 Immunohistochemistry
 E18.5
Neuronal differentiation and specification in the brain2
Decreased
Description: Decreased NeuN-positive BrdU cells in the olfactory bulb
Exp Paradigm: BrdU tracer injection in olfactory bulb 1 month prior; Immunohistochemistry: NeuN
 Immunohistochemistry
 26 weeks
Neuronal differentiation and specification in the brain2
Decreased
Description: Decresed number of cells expressing layer-specific marker Satb2 and BrdU
Exp Paradigm: BrdU tracer injection at E13.5; Immunohistochemistry: BrdU, Satb2
 Immunohistochemistry
 E18.5
Neuronal migration2
Abnormal
Description: Mislocalized cells expressing layer-specific markers Satb2 and Tbr1, mostly in SVZ/VZ
Exp Paradigm: Immunohistochemistry: Satb2, Tbr1
 Immunohistochemistry
 E18.5
Self grooming: perseveration2
Increased
Description: Increased grooming behavior when placed in a novel cage
Exp Paradigm: Grooming behavior assessments
 Grooming behavior assessments
 26 weeks
Social memory2
Decreased
Description: No significant preference for novel social target compared to wild type
Exp Paradigm: Three-chamber social approach test
 Three-chamber social approach test: social novelty
 26 weeks
Social approach2
Decreased
Description: No significant preference for social target compared to wild type
Exp Paradigm: Three-chamber social approach test
 Three-chamber social approach test: sociability
 26 weeks
Developmental trajectory1
Decreased
Description: Decreased cortical bone area, periosteal perimeter, and endosteal perimeter
Exp Paradigm: Female Mice: Bone Histomorphometry
 Histomorphometry
 65 weeks
Developmental trajectory1
Abnormal
Description: No difference in cancellous bone mass; No difference in dynamic histomorphometric bone parameters at the proximal region; Decreased parameters at distal region; Decreased tissue volume and bone surface feferents
Exp Paradigm: Bone histomorphometry
 Bone histomorphometry
 Unreported
Skeletal development: craniofacial1
Abnormal
Description: Abnormal Cranial bone morphology: Incomplete closure of the interfrontal suture; Decreased interdigitation pattern of the frontonasal suture; abnormal nasal bone morphology
Exp Paradigm: Alizarin red S and Alcian blue staining of skulls
 Histology: alcian blue & alizarin red staining
 Unreported
Developmental trajectory1
Decreased
Description: Decreased Bone Mineral Density (BMD) and Bone mineral content (BMC) in excised femora, tibiae, lumbar vertebrae (L1-L6), and cortical components; Spinal kyphosis.
Exp Paradigm: Dual-energy X-ray absorptiometry (DXA) analysis of whole body followed by peripheral quantitative computed tomography (pQCT)
 Dual-energy X-ray absorptiometry for bone mineral density measurement
 12-65 weeks
Developmental trajectory1
Decreased
Description: Decreased number of osteoclasts
Exp Paradigm: Female Mice: Measurement from histological sections of tibiae
 Histology
 65 weeks
Size/growth1
Decreased
Description: Decreased weight and body length
Exp Paradigm: General observations
 General observations
 Unreported
Skeletal development: craniofacial1
Abnormal
Description: Shorter, wider faces: Decreased nasal and frontal bone length; Increased skull width and parietal bone length.
Exp Paradigm: General Observation; Cranial measurements using hand calipers
 General observations; Cranial measurements
 Unreported
Cell proliferation2
Decreased
Description: Decreased Sox2-positive BrdU cells in the SGZ of the dentate gyrus, decreased doublecortin-positive cells (neuroblasts)
Exp Paradigm: BrdU tracer injection in the dentate gyrus 24 h prior; Immunohistochemistry: BrdU, Sox2, doublecortin
 Immunohistochemistry
 26 weeks
Cell proliferation2
Decreased
Description: Decreased BrdU-positive cells in the SVZ and decreased Sox2-positive BrdU cells (neural progenitor cells)
Exp Paradigm: BrdU tracer intraventricular injection 24 h prior; Immunohistochemistry: BrdU, Sox2
 Immunohistochemistry
 26 weeks
Chromatin modification2
Increased
Description: Increased acetylation of histones H3 and H4
Exp Paradigm: Western blot
 Western blot
 26 weeks
Cell proliferation2
Decreased
Description: Decreased Ki67-positive radial precursors in the SVZ that are also BrdU-positive
Exp Paradigm: BrdU tracer injection at E13.5; Immunohistochemistry: Ki67, BrdU
 Immunohistochemistry
 E18.5
Developmental trajectory1
 No Change
 Histomorphometry
 65 weeks
Developmental trajectory1
 No Change
 Histology
 65 weeks
Bioactive compound levels1
 No Change
 Blood chemistry
 Unreported
Cell senescence2
 No Change
 Immunohistochemistry
 E18.5
Neuronal migration2
 No Change
 Immunohistochemistry
 E18.5
 Not Reported: Circadian sleep/wake cycle ,   Communications ,   Emotion ,   Homeostasis ,   Immune response ,   Learning & memory ,   Maternal behavior ,   Motor phenotype ,   Neuroanatomy / Ultrastructure / Cytoarchitecture ,   Neurophysiology ,   Repetitive behavior ,   Seizure ,   Sensory ,   Social behavior ,  

ANKRD11_3_KD

Category
Entity
Quantity
Experimental Paradigm
Age at Testing
Neuronal differentiation and specification in the brain1
Decreased
Description: Decreased number of cells expressing layer-specific marker Satb2
Exp Paradigm: Immunohistochemistry: Satb2
 Immunohistochemistry
 P3
Neuronal differentiation and specification in the brain1
Decreased
Description: Decresed number of cells expressing layer-specific marker Satb2
Exp Paradigm: Immunohistochemistry: Satb2
 Immunohistochemistry
 E16-E17
Neuronal migration1
Abnormal
Description: Mislocalized cells expressing layer-specific marker Tbr1
Exp Paradigm: Immunohistochemistry: Tbr1
 Immunohistochemistry
 E16-E17
Neuronal differentiation and specification in the brain1
Decreased
Description: Decreased number of cells expressing neuronal marker HuD, mislocalized with fewer in the CP
Exp Paradigm: Immunohistochemistry: HuD
 Immunohistochemistry
 E16-E17
Neuronal migration1
Decreased
Description: Increased number of cells in SVZ/VZ, decreased number in CP
Exp Paradigm: Immunohistochemistry: EGFP
 Immunohistochemistry
 E16-E17
Neuronal migration1
Abnormal
Description: Mislocalized cells expressing layer-specific markers Satb2 and Tbr1
Exp Paradigm: Immunohistochemistry: Satb2, Tbr1
 Immunohistochemistry
 P3
Cell proliferation1
Decreased
Description: Decreased radial precursor proliferation index Ki67/Pax6 ratio; decreased number of mitotic cells expressing phospho-histone H3
Exp Paradigm: Immunohistochemistry: Ki67, Pax6, phospho-histone H3
 Immunohistochemistry
 E16-E17
 Not Reported:


Interactor Symbol Interactor Name Interactor Organism Entrez ID Uniprot ID Interaction Type Evidence Reference
CHD8 chromodomain helicase DNA binding protein 8 57680 Q9HCK8 CHIP-seq
Cotney J 2015
HDAC3 Histone deacetylase 3 8841 O15379 GST; IP/WB
Zhang A 2004
HDAC4 histone deacetylase 4 9759 P56524 GST; IP/WB
Zhang A 2004
HDAC5 Histone deacetylase 5 10014 Q9UQL6 GST; IP/WB
Zhang A 2004
NCOA2 nuclear receptor coactivator 2 10499 Q15596 GST
Zhang A 2004
NCOA3 nuclear receptor coactivator 3 8202 Q9Y6Q9 Y2H; GST
Zhang A 2004
SRC v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian) 6714 P12931 GST
Zhang A 2004
TADA3 transcriptional adaptor 3 10474 O75528 Y2H; GST; IP/WB
Li CW 2008
TOP3B topoisomerase (DNA) III beta 8940 O95985 HITS-CLIP
Xu D 2013
TP53 tumor protein p53 7157 P04637 GST; IP/WB
Neilsen PM 2008
FMR1 fragile X mental retardation 1 14265 P35922 HITS-CLIP
Darnell JC 2011

HELP