ARXaristaless related homeobox
Autism Reports / Total Reports
9 / 27Rare Variants / Common Variants
57 / 0Aliases
ARX, aristaless related homeobox, ISSX, PRTS, MRX36, MRX43, MRX54, MRXS1Associated Syndromes
-Chromosome Band
Xp21.3Associated Disorders
DD/NDD, ID, EPS, ASDGenetic Category
Rare Single Gene Mutation, SyndromicRelevance to Autism
This gene has been associated with syndromic autism, where a subpopulation of individuals with a given syndrome develop autism. For example, a number of studies have shown that mutations in the ARX gene are identified with a diverse spectrum of disease that includes cognitive impairment, epilepsy and severe cortical malformations.
Molecular Function
This gene is a homeobox-containing gene expressed during development. The encoded protein is a transcription factor required for normal brain development.
External Links
SFARI Genomic Platforms
Reports related to ARX (27 Reports)
# | Type | Title | Author, Year | Autism Report | Associated Disorders |
---|---|---|---|---|---|
1 | Highly Cited | ARX, a novel Prd-class-homeobox gene highly expressed in the telencephalon, is mutated in X-linked mental retardation | Bienvenu T , et al. (2002) | No | - |
2 | Highly Cited | Infantile spasms, dystonia, and other X-linked phenotypes caused by mutations in Aristaless related homeobox gene, ARX | Strmme P , et al. (2002) | No | - |
3 | Highly Cited | Variable expression of mental retardation, autism, seizures, and dystonic hand movements in two families with an identical ARX gene mutation | Turner G , et al. (2002) | No | - |
4 | Highly Cited | Mutation of ARX causes abnormal development of forebrain and testes in mice and X-linked lissencephaly with abnormal genitalia in humans | Kitamura K , et al. (2002) | No | - |
5 | Primary | The ARX story (epilepsy, mental retardation, autism, and cerebral malformations): one gene leads to many phenotypes | Sherr EH (2003) | Yes | - |
6 | Recent Recommendation | ARX: a gene for all seasons | Gcz J , et al. (2006) | No | - |
7 | Support | Oligogenic heterozygosity in individuals with high-functioning autism spectrum disorders | Schaaf CP , et al. (2011) | Yes | - |
8 | Support | Novel mutation in ARX associated with early hand preference and a mild phenotype | Kuwaik GA , et al. (2012) | No | - |
9 | Support | A regulatory path associated with X-linked intellectual disability and epilepsy links KDM5C to the polyalanine expansions in ARX | Poeta L , et al. (2012) | No | - |
10 | Support | Identification of risk genes for autism spectrum disorder through copy number variation analysis in Austrian families | Egger G , et al. (2014) | Yes | - |
11 | Support | The contribution of de novo coding mutations to autism spectrum disorder | Iossifov I et al. (2014) | Yes | - |
12 | Support | Diagnostic Targeted Resequencing in 349 Patients with Drug-Resistant Pediatric Epilepsies Identifies Causative Mutations in 30 Different Genes | Parrini E , et al. (2016) | No | - |
13 | Support | Genomic diagnosis for children with intellectual disability and/or developmental delay | Bowling KM , et al. (2017) | No | Epilepsy/seizures |
14 | Recent Recommendation | ARX polyalanine expansion mutations lead to migration impediment in the rostral cortex coupled with a developmental deficit of calbindin-positive cortical GABAergic interneurons | Lee K , et al. (2017) | No | - |
15 | Support | Diagnostic exome sequencing of syndromic epilepsy patients in clinical practice | Tumien B , et al. (2017) | No | - |
16 | Support | The combination of whole-exome sequencing and copy number variation sequencing enables the diagnosis of rare neurological disorders | Jiao Q , et al. (2019) | Yes | - |
17 | Support | Neurological Diseases With Autism Spectrum Disorder: Role of ASD Risk Genes | Xiong J , et al. (2019) | Yes | ID, epilepsy/seizures |
18 | Support | Constraint and conservation of paired-type homeodomains predicts the clinical outcome of missense variants of uncertain significance | Thai MHN et al. (2020) | No | ASD, epilepsy/seizures |
19 | Support | - | Liu L et al. (2021) | No | ASD, DD |
20 | Support | - | Zou D et al. (2021) | No | - |
21 | Support | - | Rasheed M et al. (2021) | No | - |
22 | Support | - | Chen S et al. (2021) | Yes | DD, ID |
23 | Support | - | Chuan Z et al. (2022) | No | DD |
24 | Support | - | Zhou X et al. (2022) | Yes | - |
25 | Support | - | Iskandar K et al. (2023) | Yes | - |
26 | Support | - | Ko YJ et al. (2023) | No | - |
27 | Support | - | Mathilde Gras et al. (2024) | No | ASD, ADHD |
Rare Variants (57)
Status | Allele Change | Residue Change | Variant Type | Inheritance Pattern | Parental Transmission | Family Type | PubMed ID | Author, Year |
---|---|---|---|---|---|---|---|---|
- | - | copy_number_loss | - | - | - | 14631200 | Sherr EH (2003) | |
- | - | copy_number_gain | De novo | - | - | 24643514 | Egger G , et al. (2014) | |
c.994C>T | p.Arg332Cys | missense_variant | - | - | - | 14631200 | Sherr EH (2003) | |
c.1058C>T | p.Pro353Leu | missense_variant | - | - | - | 14631200 | Sherr EH (2003) | |
c.333ins21 | Add 7 Alas | inframe_insertion | - | - | - | 14631200 | Sherr EH (2003) | |
c.370G>T | p.Glu124Ter | stop_gained | Unknown | - | - | 34145886 | Zou D et al. (2021) | |
c.790del | p.Arg264GlyfsTer61 | frameshift_variant | - | - | - | 14631200 | Sherr EH (2003) | |
c.1399G>T | p.Gly467Ter | stop_gained | De novo | - | - | 35571021 | Chuan Z et al. (2022) | |
c.490A>G | p.Gln163Arg | missense_variant | - | - | - | 11971879 | Bienvenu T , et al. (2002) | |
c.856G>A | p.Gly286Ser | missense_variant | - | - | - | 11971879 | Bienvenu T , et al. (2002) | |
c.591C>A | p.Gly197%3D | synonymous_variant | De novo | - | - | 35982159 | Zhou X et al. (2022) | |
c.487C>T | p.Gln163Ter | stop_gained | De novo | - | - | 37879892 | Mathilde Gras et al. (2024) | |
c.521C>A | p.Ser174Ter | stop_gained | De novo | - | - | 37879892 | Mathilde Gras et al. (2024) | |
c.1111C>T | p.Arg371Ter | stop_gained | De novo | - | - | 37879892 | Mathilde Gras et al. (2024) | |
c.1349C>A | p.Ser450Ter | stop_gained | De novo | - | - | 37879892 | Mathilde Gras et al. (2024) | |
c.1621G>T | p.Glu541Ter | stop_gained | Familial | Maternal | - | 37645600 | Ko YJ et al. (2023) | |
c.196G>A | p.Gly66Ser | missense_variant | De novo | - | Simplex | 37645600 | Ko YJ et al. (2023) | |
c.304ins(GCG)2 | p.(115A2) | inframe_insertion | Unknown | - | - | 34800434 | Chen S et al. (2021) | |
c.1058C>T | p.Pro353Leu | missense_variant | De novo | - | - | 27864847 | Parrini E , et al. (2016) | |
c.1151G>A | p.Arg384His | missense_variant | De novo | - | Simplex | 33951346 | Liu L et al. (2021) | |
c.1469C>T | p.Pro490Leu | missense_variant | De novo | - | Simplex | 33951346 | Liu L et al. (2021) | |
c.989G>A | p.Arg330His | missense_variant | Familial | Maternal | - | 37645600 | Ko YJ et al. (2023) | |
c.202C>A | p.Pro68Thr | missense_variant | Familial | Maternal | - | 34800434 | Chen S et al. (2021) | |
c.1120G>T | p.Val374Phe | missense_variant | De novo | - | - | 37879892 | Mathilde Gras et al. (2024) | |
c.1124G>T | p.Trp375Leu | missense_variant | De novo | - | - | 37879892 | Mathilde Gras et al. (2024) | |
c.1139G>A | p.Arg380Gln | missense_variant | De novo | - | - | 37879892 | Mathilde Gras et al. (2024) | |
c.121dup | p.Met41AsnfsTer29 | frameshift_variant | De novo | - | - | 30945278 | Jiao Q , et al. (2019) | |
c.202C>A | p.Pro68Thr | missense_variant | Familial | Maternal | - | 31031587 | Xiong J , et al. (2019) | |
c.1150C>T | p.Arg384Cys | missense_variant | De novo | - | Simplex | 32383243 | Thai MHN et al. (2020) | |
c.667A>C | p.Thr223Pro | missense_variant | Unknown | - | Simplex | 21624971 | Schaaf CP , et al. (2011) | |
c.835G>A | p.Ala279Thr | missense_variant | De novo | - | Simplex | 25363768 | Iossifov I et al. (2014) | |
c.166A>G | p.Ser56Gly | missense_variant | Familial | Maternal | - | 28554332 | Bowling KM , et al. (2017) | |
c.1441_1447dup | p.Arg483IlefsTer51 | frameshift_variant | De novo | - | - | 35571021 | Chuan Z et al. (2022) | |
c.518dup | p.Ser174ValfsTer64 | frameshift_variant | De novo | - | - | 37879892 | Mathilde Gras et al. (2024) | |
c.1579_1582del | p.Arg527AlafsTer5 | frameshift_variant | De novo | - | - | 29286531 | Tumien B , et al. (2017) | |
c.1117C>T | p.Gln373Ter | stop_gained | Familial | Maternal | Simplex | 12379852 | Kitamura K , et al. (2002) | |
c.1191del | p.Leu398CysfsTer65 | frameshift_variant | De novo | - | - | 37879892 | Mathilde Gras et al. (2024) | |
c.1109C>T | p.Ala370Val | missense_variant | Familial | Maternal | Simplex | 32383243 | Thai MHN et al. (2020) | |
c.201_204del | p.Pro68ArgfsTer99 | frameshift_variant | De novo | - | - | 37879892 | Mathilde Gras et al. (2024) | |
c.1449-1_1456del | - | frameshift_variant | Familial | Maternal | Multiplex | 34452636 | Rasheed M et al. (2021) | |
c.304insGCGGCG | Add 2 Alas | inframe_insertion | Familial | Maternal | - | 11971879 | Bienvenu T , et al. (2002) | |
c.1206del | p.Pro403ArgfsTer60 | frameshift_variant | De novo | - | Simplex | 36845779 | Iskandar K et al. (2023) | |
c.995G>A | p.Arg332His | missense_variant | Familial | Maternal | Simplex | 12379852 | Kitamura K , et al. (2002) | |
c.1372del | p.Ala458ArgfsTer5 | frameshift_variant | Unknown | - | Simplex | 12379852 | Kitamura K , et al. (2002) | |
c.428_451dupGGGCCGCCGCGGCAGCCGCGGCCG | p.Gly143_Ala150dup | inframe_insertion | - | - | - | 14631200 | Sherr EH (2003) | |
c.1028T>A | p.Leu343Gln | missense_variant | Familial | Maternal | Multiplex | 12379852 | Kitamura K , et al. (2002) | |
c.424_455del | p.Ala142ArgfsTer85 | frameshift_variant | Unknown | - | Simplex | 12379852 | Kitamura K , et al. (2002) | |
c.1188_1189insC | p.Gly397ArgfsTer135 | frameshift_variant | Unknown | - | Simplex | 12379852 | Kitamura K , et al. (2002) | |
c.1112G>A | p.Arg371Gln | missense_variant | Familial | Maternal | Extended multiplex | 32383243 | Thai MHN et al. (2020) | |
c.792del | p.Arg265AlafsTer60 | frameshift_variant | Familial | Maternal | Simplex | 12379852 | Kitamura K , et al. (2002) | |
c.98T>C | p.Leu33Pro | missense_variant | Familial | Maternal | Multi-generational | 11971879 | Bienvenu T , et al. (2002) | |
c.1002_1007delinsTGTACCA | p.Phe335ValfsTer197 | frameshift_variant | De novo | - | - | 28554332 | Bowling KM , et al. (2017) | |
c.430_431insGCCGCCGCGGCAGCCGCGGCCGGG | p.Gly143_Ala144insGlyArgArgGlySerArgGlyArg | inframe_insertion | - | - | - | 14631200 | Sherr EH (2003) | |
c.428_451dupGGGCCGCCGCGGCAGCCGCGGCCG | p.Gly143_Ala150dup | inframe_insertion | De novo | - | Simplex | 11971879 | Bienvenu T , et al. (2002) | |
c.428_451dupGGGCCGCCGCGGCAGCCGCGGCCG | p.Gly143_Ala150dup | inframe_insertion | Familial | Maternal | - | 11971879 | Bienvenu T , et al. (2002) | |
c.428_451dupGGGCCGCCGCGGCAGCCGCGGCCG | p.Gly143_Ala150dup | inframe_insertion | Familial | Maternal | Multi-generational | 11971879 | Bienvenu T , et al. (2002) | |
c.441_442insAGCCGCGGCCGCGGCCGCCGCGGC | p.Ala147_Ala148insSerArgGlyArgGlyArgArgGly | inframe_insertion | Familial | Maternal | Multiplex | 22922607 | Kuwaik GA , et al. (2012) |
Common Variants
No common variants reported.
SFARI Gene score
High Confidence, Syndromic
Score Delta: Score remained at 1S
criteria met
See SFARI Gene'scoring criteriaWe considered a rigorous statistical comparison between cases and controls, yielding genome-wide statistical significance, with independent replication, to be the strongest possible evidence for a gene. These criteria were relaxed slightly for category 2.
The syndromic category includes mutations that are associated with a substantial degree of increased risk and consistently linked to additional characteristics not required for an ASD diagnosis. If there is independent evidence implicating a gene in idiopathic ASD, it will be listed as "#S" (e.g., 2S, 3S, etc.). If there is no such independent evidence, the gene will be listed simply as "S."
4/1/2021
Score remained at 1
Description
Mutations in ARX cause a spectrum of ARX- associated disorders, including X-linked mental retardation, X-linked infantile spasms and X-linked lissencephaly with ambiguous genitalia. A proportion of individuals with each of these disorders also has autism spectrum disorder. Category 4 evidence for the role of ARX in idiopathic evidence includes two studies in which the authors screened for ARX mutations in individuals with autism. In one study of 226 males with ASD+ID, no mutations were found (Chase et al. 2007). In another study, two families each carried a 24-bp duplication in ARX, and three individuals had autism or autistic features in addition to epilepsy or ID.
4/1/2020
Score remained at 1
Description
Mutations in ARX cause a spectrum of ARX- associated disorders, including X-linked mental retardation, X-linked infantile spasms and X-linked lissencephaly with ambiguous genitalia. A proportion of individuals with each of these disorders also has autism spectrum disorder. Category 4 evidence for the role of ARX in idiopathic evidence includes two studies in which the authors screened for ARX mutations in individuals with autism. In one study of 226 males with ASD+ID, no mutations were found (Chase et al. 2007). In another study, two families each carried a 24-bp duplication in ARX, and three individuals had autism or autistic features in addition to epilepsy or ID.
10/1/2019
Increased from S to 1
New Scoring Scheme
Description
Mutations in ARX cause a spectrum of ARX- associated disorders, including X-linked mental retardation, X-linked infantile spasms and X-linked lissencephaly with ambiguous genitalia. A proportion of individuals with each of these disorders also has autism spectrum disorder. Category 4 evidence for the role of ARX in idiopathic evidence includes two studies in which the authors screened for ARX mutations in individuals with autism. In one study of 226 males with ASD+ID, no mutations were found (Chase et al. 2007). In another study, two families each carried a 24-bp duplication in ARX, and three individuals had autism or autistic features in addition to epilepsy or ID.
Reports Added
[New Scoring Scheme]4/1/2019
Increased from S to S
Description
Mutations in ARX cause a spectrum of ARX- associated disorders, including X-linked mental retardation, X-linked infantile spasms and X-linked lissencephaly with ambiguous genitalia. A proportion of individuals with each of these disorders also has autism spectrum disorder. Category 4 evidence for the role of ARX in idiopathic evidence includes two studies in which the authors screened for ARX mutations in individuals with autism. In one study of 226 males with ASD+ID, no mutations were found (Chase et al. 2007). In another study, two families each carried a 24-bp duplication in ARX, and three individuals had autism or autistic features in addition to epilepsy or ID.
7/1/2017
Increased from S to S
Description
Mutations in ARX cause a spectrum of ARX- associated disorders, including X-linked mental retardation, X-linked infantile spasms and X-linked lissencephaly with ambiguous genitalia. A proportion of individuals with each of these disorders also has autism spectrum disorder. Category 4 evidence for the role of ARX in idiopathic evidence includes two studies in which the authors screened for ARX mutations in individuals with autism. In one study of 226 males with ASD+ID, no mutations were found (Chase et al. 2007). In another study, two families each carried a 24-bp duplication in ARX, and three individuals had autism or autistic features in addition to epilepsy or ID.
4/1/2017
Increased from S to S
Description
Mutations in ARX cause a spectrum of ARX- associated disorders, including X-linked mental retardation, X-linked infantile spasms and X-linked lissencephaly with ambiguous genitalia. A proportion of individuals with each of these disorders also has autism spectrum disorder. Category 4 evidence for the role of ARX in idiopathic evidence includes two studies in which the authors screened for ARX mutations in individuals with autism. In one study of 226 males with ASD+ID, no mutations were found (Chase et al. 2007). In another study, two families each carried a 24-bp duplication in ARX, and three individuals had autism or autistic features in addition to epilepsy or ID.
Reports Added
[The ARX story (epilepsy, mental retardation, autism, and cerebral malformations): one gene leads to many phenotypes.2003] [Oligogenic heterozygosity in individuals with high-functioning autism spectrum disorders.2011] [Identification of risk genes for autism spectrum disorder through copy number variation analysis in Austrian families.2014] [Novel mutation in ARX associated with early hand preference and a mild phenotype.2012] [ARX, a novel Prd-class-homeobox gene highly expressed in the telencephalon, is mutated in X-linked mental retardation.2002] [Mutation of ARX causes abnormal development of forebrain and testes in mice and X-linked lissencephaly with abnormal genitalia in humans.2002] [Infantile spasms, dystonia, and other X-linked phenotypes caused by mutations in Aristaless related homeobox gene, ARX.2002] [Variable expression of mental retardation, autism, seizures, and dystonic hand movements in two families with an identical ARX gene mutation.2002] [ARX: a gene for all seasons.2006] [A regulatory path associated with X-linked intellectual disability and epilepsy links KDM5C to the polyalanine expansions in ARX.2012] [The contribution of de novo coding mutations to autism spectrum disorder2014] [Diagnostic Targeted Resequencing in 349 Patients with Drug-Resistant Pediatric Epilepsies Identifies Causative Mutations in 30 Different Genes.2016] [Genomic diagnosis for children with intellectual disability and/or developmental delay.2017]1/1/2017
Increased from S to S
Description
Mutations in ARX cause a spectrum of ARX- associated disorders, including X-linked mental retardation, X-linked infantile spasms and X-linked lissencephaly with ambiguous genitalia. A proportion of individuals with each of these disorders also has autism spectrum disorder. Category 4 evidence for the role of ARX in idiopathic evidence includes two studies in which the authors screened for ARX mutations in individuals with autism. In one study of 226 males with ASD+ID, no mutations were found (Chase et al. 2007). In another study, two families each carried a 24-bp duplication in ARX, and three individuals had autism or autistic features in addition to epilepsy or ID.
1/1/2016
Increased from S to S
Description
Mutations in ARX cause a spectrum of ARX- associated disorders, including X-linked mental retardation, X-linked infantile spasms and X-linked lissencephaly with ambiguous genitalia. A proportion of individuals with each of these disorders also has autism spectrum disorder. Category 4 evidence for the role of ARX in idiopathic evidence includes two studies in which the authors screened for ARX mutations in individuals with autism. In one study of 226 males with ASD+ID, no mutations were found (Chase et al. 2007). In another study, two families each carried a 24-bp duplication in ARX, and three individuals had autism or autistic features in addition to epilepsy or ID.
Reports Added
[The ARX story (epilepsy, mental retardation, autism, and cerebral malformations): one gene leads to many phenotypes.2003] [Oligogenic heterozygosity in individuals with high-functioning autism spectrum disorders.2011] [Identification of risk genes for autism spectrum disorder through copy number variation analysis in Austrian families.2014] [Novel mutation in ARX associated with early hand preference and a mild phenotype.2012] [ARX, a novel Prd-class-homeobox gene highly expressed in the telencephalon, is mutated in X-linked mental retardation.2002] [Mutation of ARX causes abnormal development of forebrain and testes in mice and X-linked lissencephaly with abnormal genitalia in humans.2002] [Infantile spasms, dystonia, and other X-linked phenotypes caused by mutations in Aristaless related homeobox gene, ARX.2002] [Variable expression of mental retardation, autism, seizures, and dystonic hand movements in two families with an identical ARX gene mutation.2002] [ARX: a gene for all seasons.2006] [A regulatory path associated with X-linked intellectual disability and epilepsy links KDM5C to the polyalanine expansions in ARX.2012] [The contribution of de novo coding mutations to autism spectrum disorder2014]4/1/2015
Increased from S to S
Description
Mutations in ARX cause a spectrum of ARX- associated disorders, including X-linked mental retardation, X-linked infantile spasms and X-linked lissencephaly with ambiguous genitalia. A proportion of individuals with each of these disorders also has autism spectrum disorder. Category 4 evidence for the role of ARX in idiopathic evidence includes two studies in which the authors screened for ARX mutations in individuals with autism. In one study of 226 males with ASD+ID, no mutations were found (Chase et al. 2007). In another study, two families each carried a 24-bp duplication in ARX, and three individuals had autism or autistic features in addition to epilepsy or ID.
4/1/2014
Increased from No data to S
Description
Mutations in ARX cause a spectrum of ARX- associated disorders, including X-linked mental retardation, X-linked infantile spasms and X-linked lissencephaly with ambiguous genitalia. A proportion of individuals with each of these disorders also has autism spectrum disorder. Category 4 evidence for the role of ARX in idiopathic evidence includes two studies in which the authors screened for ARX mutations in individuals with autism. In one study of 226 males with ASD+ID, no mutations were found (Chase et al. 2007). In another study, two families each carried a 24-bp duplication in ARX, and three individuals had autism or autistic features in addition to epilepsy or ID.
Krishnan Probability Score
Score 0.41594966117007
Ranking 21412/25841 scored genes
[Show Scoring Methodology]
ExAC Score
Score 0.75306908332634
Ranking 4196/18225 scored genes
[Show Scoring Methodology]
Sanders TADA Score
Score 0.9183935086211
Ranking 8814/18665 scored genes
[Show Scoring Methodology]
Zhang D Score
Score 0.095186436387251
Ranking 6236/20870 scored genes
[Show Scoring Methodology]
External PIN Data
Interactome
Notice: due to the large number of ARX's protein interactions, this visualization has been limited to connections with genes present in the SFARI Gene database.
- Protein Binding
- DNA Binding
- RNA Binding
- Protein Modification
- Direct Regulation
- ASD-Linked Genes
Interaction Table
Interactor Symbol | Interactor Name | Interactor Organism | Interactor Type | Entrez ID | Uniprot ID |
---|---|---|---|---|---|
0610010F05Rik | RIKEN cDNA 0610010F05 gene | Mouse | DNA Binding | 71675 | Q68FF0 |
1100001G20Rik | RIKEN cDNA 1100001G20 gene | Mouse | DNA Binding | 66107 | Q8BTE6 |
1300001I01Rik | RIKEN cDNA 1300001I01 gene | Mouse | DNA Binding | 74148 | Q5SW19 |
1700007G11Rik | RIKEN cDNA 1700007G11 gene | Mouse | DNA Binding | 75784 | Q810M1 |
1700018B24Rik | RIKEN cDNA 1700018B24 gene | Mouse | DNA Binding | 66332 | N/A |
1700019O17Rik | RIKEN cDNA 1700019O17 gene | Mouse | DNA Binding | 71863 | Q9DA60 |
1700020N01Rik | RIKEN cDNA 1700020N01 gene | Mouse | DNA Binding | 67692 | N/A |
1700034H14Rik | RIKEN cDNA 1700034H14 gene | Mouse | DNA Binding | 67105 | Q3THX0 |
1700123K08Rik | RIKEN cDNA 1700123K08 gene | Mouse | DNA Binding | 76658 | Q9D991 |
2310046O06Rik | RIKEN cDNA 2310046O06 gene | Mouse | DNA Binding | 78323 | Q14DQ1 |
2310057J18Rik | RIKEN cDNA 2310057J18 gene | Mouse | DNA Binding | 67719 | Q8C6C9 |
2410066E13Rik | RIKEN cDNA 2410066E13 gene | Mouse | DNA Binding | 68235 | Q9CR65 |
2610020H08Rik | RIKEN cDNA 2610020H08 gene | Mouse | DNA Binding | 434234 | Q7TSF9 |
2610318N02Rik | RIKEN cDNA 2610318N02 gene | Mouse | DNA Binding | 70458 | Q80VT5 |
2810428I15Rik | RIKEN cDNA 2810428I15 gene | Mouse | DNA Binding | 66462 | Q9CYZ6 |
2900092E17Rik | RIKEN cDNA 2900092E17 gene | Mouse | DNA Binding | 67278 | Q99L02 |
4632428N05Rik | RIKEN cDNA 4632428N05 gene | Mouse | DNA Binding | 74048 | E9PUF5 |
4921511H03Rik | RIKEN cDNA 4921511H03 gene | Mouse | DNA Binding | 70920 | Q9D5W8 |
4921539E11Rik | RIKEN cDNA 4921539E11 gene | Mouse | DNA Binding | 70941 | Q9D5Q8 |
4930471M23Rik | RIKEN cDNA 4930471M23 gene | Mouse | DNA Binding | 74919 | Q8VE96 |
4930591A17Rik | RIKEN cDNA 4930591A17 gene | Mouse | DNA Binding | 68175 | Q9CQH6 |
4933409G03Rik | RIKEN cDNA 4933409G03 gene | Mouse | DNA Binding | 227998 | Q8C5U0 |
4933411K20Rik | RIKEN cDNA 4933411K20 gene | Mouse | DNA Binding | 66756 | Q6ZPR1 |
5033414D02Rik | RIKEN cDNA 5033414D02 gene | Mouse | DNA Binding | 67759 | Q9D3P8 |
5830403L16Rik | RIKEN cDNA 5830403L16 gene | Mouse | DNA Binding | 240817 | Q208S0 |
6430598A04Rik | RIKEN cDNA 6430598A04 gene | Mouse | DNA Binding | 243300 | Q6PFX7 |
6530418L21Rik | RIKEN cDNA 6530418L21 gene | Mouse | DNA Binding | 109050 | Q80VY2 |
9430020K01Rik | RIKEN cDNA 9430020K01 gene | Mouse | DNA Binding | 240185 | B7ZN02 |
9430023L20Rik | RIKEN cDNA 9430023L20 gene | Mouse | DNA Binding | 68118 | Q9D8Z6 |
9930021D14Rik | BRICHOS domain containing 5 | Mouse | DNA Binding | 319259 | Q8BV89 |
A530053G22Rik | RIKEN cDNA A530053G22 gene | Mouse | DNA Binding | 208079 | N/A |
A930005I04Rik | RIKEN cDNA A930005I04 gene | Mouse | DNA Binding | 403174 | Q8BIL2 |
Aasdhppt | aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase | Mouse | DNA Binding | 67618 | Q9CQF6 |
Abca5 | ATP-binding cassette, sub-family A (ABC1), member 5 | Mouse | DNA Binding | 217265 | A2AEP4 |
Abhd1 | abhydrolase domain containing 1 | Mouse | DNA Binding | 57742 | Q9QZC8 |
Abhd11 | abhydrolase domain containing 11 | Mouse | DNA Binding | 68758 | D3YYK0 |
Abhd12 | abhydrolase domain containing 12 | Mouse | DNA Binding | 76192 | Q99LR1 |
Acbd4 | acyl-Coenzyme A binding domain containing 4 | Mouse | DNA Binding | 67131 | Q80X94 |
Accn5 | amiloride-sensitive cation channel 5, intestinal | Mouse | DNA Binding | 58170 | Q9R0Y1 |
Ace | angiotensin I converting enzyme (peptidyl-dipeptidase A) 1 | Mouse | DNA Binding | 11421 | A2A688 |
Acot10 | acyl-CoA thioesterase 10 | Mouse | DNA Binding | 64833 | Q32MW3 |
Actr3 | ARP3 actin-related protein 3 | Mouse | DNA Binding | 74117 | Q3ULF7 |
Acvrl1 | activin A receptor, type II-like 1 | Mouse | DNA Binding | 11482 | Q61288 |
Adamts8 | a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 8 | Mouse | DNA Binding | 30806 | F8VQ15 |
Adora3 | adenosine A3 receptor | Mouse | DNA Binding | 11542 | Q497R5 |
Aebp1 | AE binding protein 1 | Mouse | DNA Binding | 11568 | Q640N1 |
Aen | apoptosis enhancing nuclease | Mouse | DNA Binding | 68048 | Q9CZI9 |
AES | amino-terminal enhancer of split | Human | Protein Binding | 166 | Q08117 |
Afp | alpha fetoprotein | Mouse | DNA Binding | 11576 | P02772 |
Ahi1 | Abelson helper integration site 1 | Mouse | DNA Binding | 52906 | Q8K3E5 |
AI118078 | expressed sequence AI118078 | Mouse | DNA Binding | 244886 | B1B1B2 |
AI413582 | expressed sequence AI413582 | Mouse | DNA Binding | 106672 | Q3V2N7 |
AI597479 | expressed sequence AI597479 | Mouse | DNA Binding | 98404 | Q922M7 |
Aimp1 | aminoacyl tRNA synthetase complex-interacting multifunctional protein 1 | Mouse | DNA Binding | 13722 | Q3UZG4 |
Alad | aminolevulinate, delta-, dehydratase | Mouse | DNA Binding | 17025 | P10518 |
Aldh1b1 | aldehyde dehydrogenase 1 family, member B1 | Mouse | DNA Binding | 72535 | B1AWX7 |
Aldh8a1 | aldehyde dehydrogenase 8 family, member A1 | Mouse | DNA Binding | 237320 | Q8BH00 |
Alg2 | asparagine-linked glycosylation 2 (alpha-1,3-mannosyltransferase) | Mouse | DNA Binding | 56737 | Q9DBE8 |
Alk | anaplastic lymphoma kinase | Mouse | DNA Binding | 11682 | P97793 |
Alkbh2 | alkB, alkylation repair homolog 2 (E. coli) | Mouse | DNA Binding | 231642 | Q6P6J4 |
Als2cr12 | amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 12 (human) | Mouse | DNA Binding | 108812 | Q8BVM7 |
Amd1 | S-adenosylmethionine decarboxylase 1 | Mouse | DNA Binding | 11702 | P31154 |
Ampd2 | adenosine monophosphate deaminase 2 | Mouse | DNA Binding | 109674 | Q9DBT5 |
Ank1 | ankyrin 1, erythroid | Mouse | DNA Binding | 11733 | Q02357 |
Ankk1 | ankyrin 1, erythroid | Mouse | DNA Binding | 11733 | Q02357 |
Ankrd22 | ankyrin repeat domain 22 | Mouse | DNA Binding | 52024 | Q9D3J5 |
Ankrd7 | ankyrin repeat domain 7 | Mouse | DNA Binding | 75196 | Q9D504 |
Ano4 | anoctamin 4 | Mouse | DNA Binding | 320091 | D3Z1D8 |
Anxa10 | annexin A10 | Mouse | DNA Binding | 26359 | Q9QZ10 |
Aox4 | aldehyde oxidase 4 | Mouse | DNA Binding | 71872 | Q3TYQ9 |
Ap2a1 | adaptor protein complex AP-2, alpha 1 subunit | Mouse | DNA Binding | 11771 | P17426 |
Apoa1 | apolipoprotein A-I | Mouse | DNA Binding | 11806 | Q00623 |
Arhgap5 | Rho GTPase activating protein 5 | Mouse | DNA Binding | 11855 | E9PYT0 |
Arhgef38 | Rho guanine nucleotide exchange factor (GEF) 38 | Mouse | DNA Binding | 77669 | Q80VK6 |
Arid4b | AT rich interactive domain 4B (RBP1-like) | Mouse | DNA Binding | 94246 | A2CG63 |
Arid5a | AT rich interactive domain 5A (MRF1-like) | Mouse | DNA Binding | 214855 | Q3U108 |
Armcx2 | armadillo repeat containing, X-linked 2 | Mouse | DNA Binding | 67416 | Q6A058 |
Arntl | aryl hydrocarbon receptor nuclear translocator-like | Mouse | DNA Binding | 11865 | Q9WTL8 |
As3mt | arsenic (+3 oxidation state) methyltransferase | Mouse | DNA Binding | 57344 | Q91WU5 |
Asl | argininosuccinate lyase | Mouse | DNA Binding | 109900 | Q91YI0 |
Aspdh | aspartate dehydrogenase domain containing | Mouse | DNA Binding | 68352 | Q9DCQ2 |
Aspm | asp (abnormal spindle)-like, microcephaly associated (Drosophila) | Mouse | DNA Binding | 12316 | Q4G1G9 |
Atg2b | ATG2 autophagy related 2 homolog B (S. cerevisiae) | Mouse | DNA Binding | 76559 | Q80XK6 |
Atg4c | autophagy related 4C, cysteine peptidase | Mouse | DNA Binding | 242557 | Q3UYA5 |
Atg5 | autophagy related 5 | Mouse | DNA Binding | 11793 | Q99J83 |
Atl2 | atlastin GTPase 2 | Mouse | DNA Binding | 56298 | Q6PA06 |
Atp13a4 | ATPase type 13A4 | Mouse | DNA Binding | 224079 | E9QPP7 |
Atp5j | ATP synthase, H+ transporting, mitochondrial F0 complex, subunit F | Mouse | DNA Binding | 11957 | P97450 |
Atp6v0e | ATPase, H+ transporting, lysosomal V0 subunit E | Mouse | DNA Binding | 11974 | Q9CQD8 |
Atp7a | ATPase, Cu++ transporting, alpha polypeptide | Mouse | DNA Binding | 11977 | Q64430 |
Atrnl1 | attractin like 1 | Mouse | DNA Binding | 226255 | Q6A051 |
Atrx | alpha thalassemia/mental retardation syndrome X-linked homolog (human) | Mouse | DNA Binding | 22589 | Q61687 |
AU040320 | expressed sequence AU040320 | Mouse | DNA Binding | 100317 | Q8K135 |
Axdnd1 | axonemal dynein light chain domain containing 1 | Mouse | DNA Binding | 77352 | Q3UZ57 |
B3gnt7 | UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 7 | Mouse | DNA Binding | 227327 | Q8K0J2 |
B4galt1 | UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 | Mouse | DNA Binding | 14595 | P15535 |
Bahd1 | bromo adjacent homology domain containing 1 | Mouse | DNA Binding | 228536 | Q497V6 |
Batf | basic leucine zipper transcription factor, ATF-like | Mouse | DNA Binding | 53314 | O35284 |
Bbs12 | Bardet-Biedl syndrome 12 (human) | Mouse | DNA Binding | 241950 | Q5SUD9 |
BC003331 | cDNA sequence BC003331 | Mouse | DNA Binding | 226499 | Q4PJX1 |
BC005537 | cDNA sequence BC005537 | Mouse | DNA Binding | 79555 | Q3TVJ4 |
BC030476 | cDNA sequence BC030476 | Mouse | DNA Binding | 239368 | Q8K0S2 |
BC031181 | cDNA sequence BC031181 | Mouse | DNA Binding | 407819 | Q91WE4 |
BC094916 | cDNA sequence BC094916 | Mouse | DNA Binding | 545384 | Q504N7 |
Bhlhb5 | basic helix-loop-helix family, member e22 | Mouse | DNA Binding | 59058 | Q8C6A8 |
Bivm | basic, immunoglobulin-like variable motif containing | Mouse | DNA Binding | 246229 | Q8CBX9 |
Brd1 | bromodomain containing 1 | Mouse | DNA Binding | 223770 | A7MCW6 |
Brd2 | bromodomain containing 2 | Mouse | DNA Binding | 14312 | B2RS09 |
Brms1 | breast cancer metastasis-suppressor 1 | Mouse | DNA Binding | 107392 | Q547N0 |
Brs3 | bombesin-like receptor 3 | Mouse | DNA Binding | 12209 | B1AVC6 |
Btd | biotinidase | Mouse | DNA Binding | 26363 | Q8CIF4 |
Btg4 | B cell translocation gene 4 | Mouse | DNA Binding | 56057 | Q925T9 |
Btn1a1 | butyrophilin, subfamily 1, member A1 | Mouse | DNA Binding | 12231 | Q3UM26 |
C1ql3 | C1q-like 3 | Mouse | DNA Binding | 227580 | B0LXL6 |
C8b | complement component 8, beta polypeptide | Mouse | DNA Binding | 110382 | B1ASJ7 |
Cacna2d1 | calcium channel, voltage-dependent, alpha2/delta subunit 1 | Mouse | DNA Binding | 12293 | O08532 |
Cacng4 | calcium channel, voltage-dependent, gamma subunit 4 | Mouse | DNA Binding | 54377 | A2AAU2 |
Cadm3 | cell adhesion molecule 3 | Mouse | DNA Binding | 94332 | Q99N28 |
Calcr | calcitonin receptor | Mouse | DNA Binding | 12311 | Q3UUL9 |
Caln1 | calneuron 1 | Mouse | DNA Binding | 140904 | Q542R1 |
Calu | calumenin | Mouse | DNA Binding | 12321 | O35887 |
Car11 | carbonic anhydrase 11 | Mouse | DNA Binding | 12348 | O70354 |
Car3 | carbonic anhydrase 3 | Mouse | DNA Binding | 12350 | P16015 |
Casd1 | CAS1 domain containing 1 | Mouse | DNA Binding | 213819 | Q7TN73 |
Casq1 | calsequestrin 1 | Mouse | DNA Binding | 12372 | O09165 |
Catsperb | cation channel, sperm-associated, beta | Mouse | DNA Binding | 271036 | A2RTF1 |
Cav1 | caveolin 1, caveolae protein | Mouse | DNA Binding | 12389 | P49817 |
Cblc | Casitas B-lineage lymphoma c | Mouse | DNA Binding | 80794 | G3X9U0 |
Cby1 | chibby homolog 1 (Drosophila) | Mouse | DNA Binding | 73739 | Q9D1C2 |
Ccdc101 | coiled-coil domain containing 101 | Mouse | DNA Binding | 75565 | Q9DA08 |
Ccdc104 | coiled-coil domain containing 104 | Mouse | DNA Binding | 216618 | Q8C6E0 |
Ccdc106 | coiled-coil domain containing 106 | Mouse | DNA Binding | 232821 | Q3ULM0 |
Ccdc21 | coiled-coil domain containing 21 | Mouse | DNA Binding | 70012 | A2A9K2 |
Ccdc28a | coiled-coil domain containing 28A | Mouse | DNA Binding | 215814 | Q3UFK1 |
Ccdc32 | coiled-coil domain containing 32 | Mouse | DNA Binding | 269336 | Q3UHY7 |
Ccdc60 | coiled-coil domain containing 60 | Mouse | DNA Binding | 269693 | Q8C4J0 |
Cchcr1 | coiled-coil alpha-helical rod protein 1 | Mouse | DNA Binding | 240084 | Q3TWA2 |
Cckbr | cholecystokinin B receptor | Mouse | DNA Binding | 12426 | P56481 |
Ccl2 | chemokine (C-C motif) ligand 2 | Mouse | DNA Binding | 20296 | P10148 |
Ccr10 | chemokine (C-C motif) receptor 10 | Mouse | DNA Binding | 12777 | Q9JL21 |
Ccrl2 | chemokine (C-C motif) receptor-like 2 | Mouse | DNA Binding | 54199 | O35457 |
Cct6a | chaperonin containing Tcp1, subunit 6a (zeta) | Mouse | DNA Binding | 12466 | P80317 |
Cd177 | CD177 antigen | Mouse | DNA Binding | 68891 | Q8R2S8 |
Cd274 | CD274 antigen | Mouse | DNA Binding | 60533 | Q3U472 |
Cd2ap | CD2-associated protein | Mouse | DNA Binding | 12488 | Q9JLQ0 |
Cd84 | CD84 antigen | Mouse | DNA Binding | 12523 | Q18PI6 |
Cdh2 | cadherin 2 | Mouse | DNA Binding | 12558 | P15116 |
Cdk17 | cyclin-dependent kinase 17 | Mouse | DNA Binding | 237459 | Q8K0D0 |
Cdkn1a | cyclin-dependent kinase inhibitor 1A (P21) | Mouse | DNA Binding | 12575 | P39689 |
Cdkn2aip | CDKN2A interacting protein | Mouse | DNA Binding | 70925 | Q8BI72 |
Cdkn2c | cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4) | Mouse | DNA Binding | 12580 | B1ASP9 |
Ceacam9 | carcinoembryonic antigen-related cell adhesion molecule 9 | Mouse | DNA Binding | 26368 | Q78T27 |
Cenpc1 | centromere protein C1 | Mouse | DNA Binding | 12617 | P49452 |
Cep135 | centrosomal protein 135 | Mouse | DNA Binding | 381644 | Q6P5D4 |
Ces1g | carboxylesterase 1G | Mouse | DNA Binding | 12623 | Q3UW56 |
Cfh | complement component factor h | Mouse | DNA Binding | 12628 | E9Q8I0 |
Cggbp1 | CGG triplet repeat binding protein 1 | Mouse | DNA Binding | 106143 | A6X966 |
Chchd6 | coiled-coil-helix-coiled-coil-helix domain containing 6 | Mouse | DNA Binding | 66098 | E9Q4M4 |
Chga | chromogranin A | Mouse | DNA Binding | 12652 | P26339 |
Chmp1b | charged multivesicular body protein 1B | Mouse | DNA Binding | 67064 | Q99LU0 |
Chn1 | chimerin (chimaerin) 1 | Mouse | DNA Binding | 108699 | Q91V57 |
Chrng | cholinergic receptor, nicotinic, gamma polypeptide | Mouse | DNA Binding | 11449 | F8VQK4 |
Chtf18 | CTF18, chromosome transmission fidelity factor 18 | Mouse | DNA Binding | 214901 | Q8BIW9 |
Clca6 | chloride channel calcium activated 6 | Mouse | DNA Binding | 99663 | G3X8Z1 |
Clec1b | C-type lectin domain family 1, member b | Mouse | DNA Binding | 56760 | Q9JL99 |
Clec9a | C-type lectin domain family 9, member a | Mouse | DNA Binding | 232414 | Q8BRU4 |
Cma1 | chymase 1, mast cell | Mouse | DNA Binding | 17228 | A4QPC5 |
Cnn2 | calponin 2 | Mouse | DNA Binding | 12798 | Q08093 |
Cntn1 | contactin 1 | Mouse | DNA Binding | 12805 | P12960 |
Col10a1 | collagen, type X, alpha 1 | Mouse | DNA Binding | 12813 | Q05306 |
Col6a2 | collagen, type VI, alpha 2 | Mouse | DNA Binding | 12834 | Q02788 |
Cotl1 | coactosin-like 1 (Dictyostelium) | Mouse | DNA Binding | 72042 | Q544F6 |
Cox17 | cytochrome c oxidase, subunit XVII assembly protein homolog (yeast) | Mouse | DNA Binding | 12856 | P56394 |
Cox7a2l | cytochrome c oxidase subunit VIIa polypeptide 2-like | Mouse | DNA Binding | 20463 | E9PZS8 |
Cox7b2 | cytochrome c oxidase subunit VIIb2 | Mouse | DNA Binding | 78174 | Q9D2H1 |
Cox8b | cytochrome c oxidase, subunit VIIIb | Mouse | DNA Binding | 12869 | P48772 |
Cpeb1 | cytoplasmic polyadenylation element binding protein 1 | Mouse | DNA Binding | 12877 | P70166 |
Cpne2 | copine II | Mouse | DNA Binding | 234577 | P59108 |
Cpsf1 | cleavage and polyadenylation specific factor 1 | Mouse | DNA Binding | 94230 | Q9EPU4 |
Crb1 | crumbs homolog 1 (Drosophila) | Mouse | DNA Binding | 170788 | Q8VHS2 |
Creb3l1 | cAMP responsive element binding protein 3-like 1 | Mouse | DNA Binding | 26427 | Q9Z125 |
Crtac1 | cartilage acidic protein 1 | Mouse | DNA Binding | 72832 | Q8R555 |
Cry2 | cryptochrome 2 (photolyase-like) | Mouse | DNA Binding | 12953 | Q9R194 |
Cryge | crystallin, gamma E | Mouse | DNA Binding | 12968 | Q03740 |
Csn1s1 | casein alpha s1 | Mouse | DNA Binding | 12990 | P19228 |
Cst13 | cystatin 13 | Mouse | DNA Binding | 69294 | A2APW3 |
Cst7 | cystatin F (leukocystatin) | Mouse | DNA Binding | 13011 | O89098 |
Cstf2t | cleavage stimulation factor, 3' pre-RNA subunit 2, tau | Mouse | DNA Binding | 83410 | Q8C7E9 |
Ctnna2 | catenin (cadherin associated protein), alpha 2 | Mouse | DNA Binding | 12386 | Q61301 |
Ctr9 | Ctr9, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae) | Mouse | DNA Binding | 22083 | Q05CJ7 |
Cuedc2 | CUE domain containing 2 | Mouse | DNA Binding | 67116 | Q9CXX9 |
Cwc22 | CWC22 spliceosome-associated protein homolog (S. cerevisiae) | Mouse | DNA Binding | 80744 | B1AYU5 |
cwh43 | cell wall biogenesis 43 C-terminal homolog (S. cerevisiae) | Mouse | DNA Binding | 231293 | Q91YL7 |
Cxcl10 | chemokine (C-X-C motif) ligand 10 | Mouse | DNA Binding | 15945 | P17515 |
Cxcl11 | chemokine (C-X-C motif) ligand 11 | Mouse | DNA Binding | 56066 | Q9JHH5 |
Cxcr2 | chemokine (C-X-C motif) receptor 2 | Mouse | DNA Binding | 12765 | P35343 |
Cxcr7 | chemokine (C-X-C motif) receptor 7 | Mouse | DNA Binding | 12778 | P56485 |
Cxxc4 | CXXC finger 4 | Mouse | DNA Binding | 319478 | Q6NXI8 |
Cxxc5 | CXXC finger 5 | Mouse | DNA Binding | 67393 | Q91WA4 |
Cyb5r4 | cytochrome b5 reductase 4 | Mouse | DNA Binding | 266690 | Q3TDX8 |
Cybb | cytochrome b-245, beta polypeptide | Mouse | DNA Binding | 13058 | Q3U6G0 |
Cyp1b1 | cytochrome P450, family 1, subfamily b, polypeptide 1 | Mouse | DNA Binding | 13078 | Q64429 |
Cyp26b1 | cytochrome P450, family 26, subfamily b, polypeptide 1 | Mouse | DNA Binding | 232174 | Q811W2 |
Cyp2b10 | cytochrome P450, family 2, subfamily b, polypeptide 10 | Mouse | DNA Binding | 13088 | Q9WUD0 |
Cyp2c55 | cytochrome P450, family 2, subfamily c, polypeptide 55 | Mouse | DNA Binding | 72082 | Q9D816 |
Cyp2c66 | cytochrome P450, family 2, subfamily c, polypeptide 66 | Mouse | DNA Binding | 69888 | Q5GLZ0 |
Cyp2r1 | cytochrome P450, family 2, subfamily r, polypeptide 1 | Mouse | DNA Binding | 244209 | Q32MW1 |
CYTIP | cytohesin 1 interacting protein | Human | Protein Binding | 9595 | O60759 |
D10Jhu81e | DNA segment, Chr 10, Johns Hopkins University 81 expressed | Mouse | DNA Binding | 28295 | Q9D172 |
D19Ertd737e | DNA segment, Chr 19, ERATO Doi 737, expressed | Mouse | DNA Binding | 76539 | Q8C6C7 |
Dbndd2 | dysbindin (dystrobrevin binding protein 1) domain containing 2 | Mouse | DNA Binding | 52840 | Q330P7 |
Dbnl | Drebrin-like | Mouse | DNA Binding | 13169 | Q62418 |
Dcaf13 | DDB1 and CUL4 associated factor 13 | Mouse | DNA Binding | 223499 | Q6PAC3 |
Dcun1d1 | DCN1, defective in cullin neddylation 1, domain containing 1 (S. cerevisiae) | Mouse | DNA Binding | 114893 | Q9QZ73 |
Ddit4 | DNA-damage-inducible transcript 4 | Mouse | DNA Binding | 74747 | B7ZNP9 |
Defb2 | defensin beta 2 | Mouse | DNA Binding | 13215 | P82020 |
Defb29 | defensin beta 29 | Mouse | DNA Binding | 75400 | A3KGR0 |
Defb50 | defensin beta 50 | Mouse | DNA Binding | 387334 | Q6TU36 |
Depdc6 | DEP domain containing MTOR-interacting protein | Mouse | DNA Binding | 97998 | B2ZRS7 |
Derl3 | Der1-like domain family, member 3 | Mouse | DNA Binding | 70377 | Q14C34 |
Dgkz | diacylglycerol kinase zeta | Mouse | DNA Binding | 104418 | Q80UP3 |
Dhx37 | DEAH (Asp-Glu-Ala-His) box polypeptide 37 | Mouse | DNA Binding | 208144 | Q6NZL1 |
Dip2b | DIP2 disco-interacting protein 2 homolog B (Drosophila) | Mouse | DNA Binding | 239667 | Q3UH60 |
Dmp1 | dentin matrix protein 1 | Mouse | DNA Binding | 13406 | O55188 |
Dmrt3 | doublesex and mab-3 related transcription factor 3 | Mouse | DNA Binding | 240590 | Q80WT2 |
Dmrta2 | doublesex and mab-3 related transcription factor like family A2 | Mouse | DNA Binding | 242620 | A2A9A2 |
Dmrtc1a | DMRT-like family C1a | Mouse | DNA Binding | 70887 | B1AX34 |
DNM2 | dynamin 2 | Human | Protein Binding | 1785 | P50570 |
Doc2b | double C2, beta | Mouse | DNA Binding | 13447 | P70169 |
Dok6 | docking protein 6 | Mouse | DNA Binding | 623279 | Q2MHE5 |
Dpm2 | dolichol-phosphate (beta-D) mannosyltransferase 2 | Mouse | DNA Binding | 13481 | Q545R7 |
Dppa3 | developmental pluripotency-associated 3 | Mouse | DNA Binding | 73708 | Q8QZY3 |
Dpyd | dihydropyrimidine dehydrogenase | Mouse | DNA Binding | 99586 | Q8CHR6 |
Dpys | dihydropyrimidinase | Mouse | DNA Binding | 64705 | Q9EQF5 |
Drap1 | Dr1 associated protein 1 (negative cofactor 2 alpha) | Mouse | DNA Binding | 66556 | Q4FJW2 |
Dusp11 | dual specificity phosphatase 11 (RNA/RNP complex 1-interacting) | Mouse | DNA Binding | 72102 | Q6NXK5 |
Dusp19 | dual specificity phosphatase 19 | Mouse | DNA Binding | 68082 | Q99N12 |
Ebf3 | early B-cell factor 3 | Mouse | DNA Binding | 13593 | O08791 |
Eda | ectodysplasin-A | Mouse | DNA Binding | 13607 | O54693 |
Eda2r | ectodysplasin A2 receptor | Mouse | DNA Binding | 245527 | Q8BX35 |
Ednra | endothelin receptor type A | Mouse | DNA Binding | 13617 | Q61614 |
Efcab8 | EF-hand calcium binding domain 8 | Mouse | DNA Binding | 329541 | Q8C9R9 |
Efnb3 | ephrin B3 | Mouse | DNA Binding | 13643 | O35393 |
Efs | embryonal Fyn-associated substrate | Mouse | DNA Binding | 13644 | Q64355 |
Egfl6 | EGF-like-domain, multiple 6 | Mouse | DNA Binding | 54156 | Q9JJZ5 |
Eif2ak3 | eukaryotic translation initiation factor 2 alpha kinase 3 | Mouse | DNA Binding | 13666 | E9QQ30 |
Eif4a2 | eukaryotic translation initiation factor 4A2 | Mouse | DNA Binding | 13682 | E9Q561 |
Eif5 | eukaryotic translation initiation factor 5 | Mouse | DNA Binding | 217869 | P59325 |
Emc7 | ER membrane protein complex subunit 7 | Mouse | DNA Binding | 73024 | Q14C26 |
Endog | endonuclease G | Mouse | DNA Binding | 13804 | O08600 |
Enpp4 | ectonucleotide pyrophosphatase/phosphodiesterase 4 | Mouse | DNA Binding | 224794 | B8JJY5 |
Eomes | eomesodermin homolog (Xenopus laevis) | Mouse | DNA Binding | 13813 | O54839 |
Epb4.1l1 | erythrocyte protein band 4.1-like 1 | Mouse | DNA Binding | 13821 | Q8C8P2 |
Epgn | epithelial mitogen | Mouse | DNA Binding | 71920 | Q0VEB7 |
Epha3 | Eph receptor A3 | Mouse | DNA Binding | 13837 | Q8BRB1 |
Ephb1 | Eph receptor B1 | Mouse | DNA Binding | 270190 | Q8CA63 |
Ephx2 | epoxide hydrolase 2, cytoplasmic | Mouse | DNA Binding | 13850 | P34914 |
Epyc | epiphycan | Mouse | DNA Binding | 13516 | P70186 |
Ermn | ermin, ERM-like protein | Mouse | DNA Binding | 77767 | Q5EBJ4 |
Esam1 | endothelial cell-specific adhesion molecule | Mouse | DNA Binding | 69524 | Q3U102 |
Espn | espin | Mouse | DNA Binding | 56226 | Q9DD12 |
Esx1 | extraembryonic, spermatogenesis, homeobox 1 | Mouse | DNA Binding | 13984 | O88933 |
Esyt3 | extended synaptotagmin-like protein 3 | Mouse | DNA Binding | 272636 | Q5DTI8 |
Ets2 | E26 avian leukemia oncogene 2, 3' domain | Mouse | DNA Binding | 23872 | P15037 |
Evx2 | even skipped homeotic gene 2 homolog | Mouse | DNA Binding | 14029 | A2ASM4 |
Exosc4 | exosome component 4 | Mouse | DNA Binding | 109075 | Q542B0 |
Fa2h | fatty acid 2-hydroxylase | Mouse | DNA Binding | 338521 | Q5MPP0 |
Fam107b | family with sequence similarity 107, member B | Mouse | DNA Binding | 66540 | Q3TGF2 |
Fam124b | family with sequence similarity 124, member B | Mouse | DNA Binding | 241128 | Q8BLQ0 |
Fam160a1 | family with sequence similarity 160, member A1 | Mouse | DNA Binding | 229488 | Q505K2 |
Fam26f | family with sequence similarity 26, member F | Mouse | DNA Binding | 215900 | Q8C9E8 |
Fam45A | family with sequence similarity 45, member A | Mouse | DNA Binding | 67894 | Q9D8N2 |
Fam50a | family with sequence similarity 50, member A | Mouse | DNA Binding | 108160 | Q9WV03 |
Fam53b | family with sequence similarity 53, member B | Mouse | DNA Binding | 77938 | Q8BGR5 |
Fam83g | family with sequence similarity 83, member G | Mouse | DNA Binding | 69640 | Q5SWY7 |
Fap | fibroblast activation protein | Mouse | DNA Binding | 14089 | A2AS87 |
Fbf1 | Fas (TNFRSF6) binding factor 1 | Mouse | DNA Binding | 217335 | A2A870 |
Fbxo15 | F-box protein 15 | Mouse | DNA Binding | 50764 | Q3TJW2 |
Fbxo40 | F-box protein 40 | Mouse | DNA Binding | 207215 | P62932 |
Fbxw4 | F-box and WD-40 domain protein 4 | Mouse | DNA Binding | 30838 | Q9JMJ2 |
Fcamr | Fc receptor, IgA, IgM, high affinity | Mouse | DNA Binding | 64435 | Q2TB54 |
Fcna | ficolin A | Mouse | DNA Binding | 14133 | O70165 |
Fert2 | fer (fms/fps related) protein kinase, testis specific 2 | Mouse | DNA Binding | 14158 | P70451 |
Fev | FEV (ETS oncogene family) | Mouse | DNA Binding | 260298 | Q8QZW2 |
Fgf20 | fibroblast growth factor 20 | Mouse | DNA Binding | 80857 | Q9ESL9 |
Fgf4 | fibroblast growth factor 4 | Mouse | DNA Binding | 14175 | P11403 |
Fgfbp3 | fibroblast growth factor binding protein 3 | Mouse | DNA Binding | 72514 | Q1HCM0 |
Fgfr1op2 | FGFR1 oncogene partner 2 | Mouse | DNA Binding | 67529 | Q9CRA9 |
Fgfr2 | fibroblast growth factor receptor 2 | Mouse | DNA Binding | 14183 | E9QK53 |
Fgr | Gardner-Rasheed feline sarcoma viral (Fgr) oncogene homolog | Mouse | DNA Binding | 14191 | P14234 |
Fhad1 | forkhead-associated (FHA) phosphopeptide binding domain 1 | Mouse | DNA Binding | 329977 | A6PWD2 |
Fibcd1 | fibrinogen C domain containing 1 | Mouse | DNA Binding | 98970 | A2AV25 |
Fignl1 | fidgetin-like 1 | Mouse | DNA Binding | 60530 | Q8BPY9 |
Fmnl1 | formin-like 1 | Mouse | DNA Binding | 57778 | A2AB61 |
Fnip1 | folliculin interacting protein 1 | Mouse | DNA Binding | 216742 | Q68FD7 |
Fosb | FBJ osteosarcoma oncogene B | Mouse | DNA Binding | 14282 | A2RSD4 |
Foxa1 | forkhead box A1 | Mouse | DNA Binding | 15375 | P35582 |
Foxb2 | forkhead box B2 | Mouse | DNA Binding | 14240 | B9EII5 |
Foxf1a | forkhead box F1 | Mouse | DNA Binding | 15227 | Q61080 |
Foxn4 | forkhead box N4 | Mouse | DNA Binding | 116810 | Q8K3Q3 |
Frem2 | Fras1 related extracellular matrix protein 2 | Mouse | DNA Binding | 242022 | Q6NVD0 |
Fryl | furry homolog-like (Drosophila) | Mouse | DNA Binding | 72313 | F8VQ05 |
Fut7 | fucosyltransferase 7 | Mouse | DNA Binding | 14347 | E2D0W5 |
Fxyd6 | FXYD domain-containing ion transport regulator 6 | Mouse | DNA Binding | 59095 | Q9D164 |
Gab3 | growth factor receptor bound protein 2-associated protein 3 | Mouse | DNA Binding | 210710 | Q8BSM5 |
Gabrb3 | gamma-aminobutyric acid (GABA) A receptor, subunit beta 3 | Mouse | DNA Binding | 14402 | P63080 |
Gabre | gamma-aminobutyric acid (GABA) A receptor, subunit epsilon | Mouse | DNA Binding | 14404 | A2AMW3 |
Gad2 | glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa) | Mouse | DNA Binding | 14417 | P48320 |
Galnt14 | UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 14 | Mouse | DNA Binding | 71685 | Q08EC9 |
Galntl6 | UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6 | Mouse | DNA Binding | 270049 | E5D8G1 |
Gapdhs | glyceraldehyde-3-phosphate dehydrogenase, spermatogenic | Mouse | DNA Binding | 14447 | Q64467 |
Gata3 | GATA binding protein 3 | Mouse | DNA Binding | 14462 | P23772 |
Gbp6 | guanylate binding protein 7 | Mouse | DNA Binding | 229900 | Q91Z40 |
Gdf1 | growth differentiation factor 1 | Mouse | DNA Binding | 14559 | A2RT05 |
Gfi1b | growth factor independent 1B | Mouse | DNA Binding | 14582 | B7ZNH2 |
Ggcx | gamma-glutamyl carboxylase | Mouse | DNA Binding | 56316 | B2RS80 |
Ghdc | GH3 domain containing | Mouse | DNA Binding | 80860 | Q99J23 |
Ghrh | growth hormone releasing hormone | Mouse | DNA Binding | 14601 | P16043 |
Gimap8 | GTPase, IMAP family member 8 | Mouse | DNA Binding | 243374 | Q75N62 |
Gjb2 | gap junction protein, beta 2 | Mouse | DNA Binding | 14619 | Q00977 |
Gjd4 | gap junction protein, delta 4 | Mouse | DNA Binding | 225152 | Q8BSD4 |
Glra3 | glycine receptor, alpha 3 subunit | Mouse | DNA Binding | 110304 | G5E811 |
Glt25d2 | glycosyltransferase 25 domain containing 2 | Mouse | DNA Binding | 269132 | Q6NVG7 |
Gm1673 | predicted gene 1673 | Mouse | DNA Binding | 381633 | Q3UR78 |
Gm382 | predicted gene 382 | Mouse | DNA Binding | 211208 | B1AXN3 |
Gm4793 | predicted gene 4793 | Mouse | DNA Binding | 215714 | N/A |
Gm4861 | predicted gene 4861 | Mouse | DNA Binding | 229862 | Q8C5A4 |
Gm5094 | predicted gene 5094 | Mouse | DNA Binding | 328839 | N/A |
Gm5635 | predicted gene 5635 | Mouse | DNA Binding | 434729 | Q3SXD2 |
Gm6377 | predicted gene 6377 | Mouse | DNA Binding | 622976 | Q8BHV4 |
Gm711 | predicted gene 711 | Mouse | DNA Binding | 279029 | Q80YS9 |
Gm784 | fibronectin type III domain containing 3C1 | Mouse | DNA Binding | 333564 | Q6DFV6 |
Gm973 | predicted gene 973 | Mouse | DNA Binding | 381260 | E9Q295 |
Gm996 | predicted gene 996 | Mouse | DNA Binding | 381353 | A2AJA9 |
Gmds | GDP-mannose 4, 6-dehydratase | Mouse | DNA Binding | 218138 | Q8K0C9 |
Gnai1 | guanine nucleotide binding protein (G protein), alpha inhibiting 1 | Mouse | DNA Binding | 14677 | B2RSH2 |
Gnao1 | guanine nucleotide binding protein, alpha O | Mouse | DNA Binding | 14681 | P18872 |
Gng11 | guanine nucleotide binding protein (G protein), gamma 11 | Mouse | DNA Binding | 66066 | P61953 |
Gng13 | guanine nucleotide binding protein (G protein), gamma 13 | Mouse | DNA Binding | 64337 | Q9JMF3 |
Gnl2 | guanine nucleotide binding protein-like 2 (nucleolar) | Mouse | DNA Binding | 230737 | Q3V3N5 |
Gnmt | glycine N-methyltransferase | Mouse | DNA Binding | 14711 | A9C489 |
Gpatch2 | G patch domain containing 2 | Mouse | DNA Binding | 67769 | Q7TQC7 |
Gpd1 | glycerol-3-phosphate dehydrogenase 1 (soluble) | Mouse | DNA Binding | 14555 | P13707 |
Gpr21 | G protein-coupled receptor 21 | Mouse | DNA Binding | 338346 | Q8BX79 |
Gpr26 | G protein-coupled receptor 26 | Mouse | DNA Binding | 233919 | Q0VBG4 |
Gpr37 | G protein-coupled receptor 37 | Mouse | DNA Binding | 14763 | Q9QY42 |
Gpr50 | G-protein-coupled receptor 50 | Mouse | DNA Binding | 14765 | O88495 |
Gpsm1 | G-protein signalling modulator 1 (AGS3-like, C. elegans) | Mouse | DNA Binding | 67839 | Q6IR34 |
Gria1 | glutamate receptor, ionotropic, AMPA1 (alpha 1) | Mouse | DNA Binding | 14799 | P23818 |
Gria3 | glutamate receptor, ionotropic, AMPA3 (alpha 3) | Mouse | DNA Binding | 53623 | A2VDF5 |
Grm1 | glutamate receptor, metabotropic 1 | Mouse | DNA Binding | 14816 | P97772 |
Gss | glutathione synthetase | Mouse | DNA Binding | 14854 | P51855 |
Gstk1 | glutathione S-transferase kappa 1 | Mouse | DNA Binding | 76263 | Q9DCM2 |
Gtf2b | general transcription factor IIB | Mouse | DNA Binding | 229906 | P62915 |
Gtlf3b | predicted gene, Gm16515 | Mouse | DNA Binding | 24083 | Q9DBW3 |
Gvin1 | GTPase, very large interferon inducible 1 | Mouse | DNA Binding | 74558 | Q80SU7 |
H2-Q8 | histocompatibility 2, Q region locus 8 | Mouse | DNA Binding | 15019 | P79567 |
Hao1 | hydroxyacid oxidase 1, liver | Mouse | DNA Binding | 15112 | Q3UEE8 |
Haus3 | HAUS augmin-like complex, subunit 3 | Mouse | DNA Binding | 231123 | Q8QZX2 |
Haus5 | HAUS augmin-like complex, subunit 5 | Mouse | DNA Binding | 71909 | Q9D786 |
Hbp1 | high mobility group box transcription factor 1 | Mouse | DNA Binding | 73389 | E9Q1A8 |
Hc | hemolytic complement | Mouse | DNA Binding | 15139 | P06684 |
Hcrtr1 | hypocretin (orexin) receptor 1 | Mouse | DNA Binding | 230777 | P58307 |
Hdgfl1 | hepatoma derived growth factor-like 1 | Mouse | DNA Binding | 15192 | Q2VPR5 |
Hepacam2 | HEPACAM family member 2 | Mouse | DNA Binding | 101202 | Q4VAH7 |
Heph | hephaestin | Mouse | DNA Binding | 15203 | Q9Z0Z4 |
Hist1h2bc | histone cluster 1, H2bc | Mouse | DNA Binding | 68024 | Q6ZWY9 |
Hist1h4h | histone cluster 1, H4h | Mouse | DNA Binding | 69386 | P62806 |
Hist2h3c1 | histone cluster 2, H3c1 | Mouse | DNA Binding | 15077 | P84228 |
Hivep1 | human immunodeficiency virus type I enhancer binding protein 1 | Mouse | DNA Binding | 110521 | Q03172 |
Hmcn1 | hemicentin 1 | Mouse | DNA Binding | 545370 | D3YXG0 |
Hmgb3 | high mobility group box 3 | Mouse | DNA Binding | 15354 | O54879 |
Hmgn3 | high mobility group nucleosomal binding domain 3 | Mouse | DNA Binding | 94353 | Q9DCB1 |
Hnrpf | heterogeneous nuclear ribonucleoprotein F | Mouse | DNA Binding | 98758 | Q9Z2X1 |
Hpn | hepsin | Mouse | DNA Binding | 15451 | O35453 |
Hps5 | Hermansky-Pudlak syndrome 5 homolog (human) | Mouse | DNA Binding | 246694 | P59438 |
Hr | hairless | Mouse | DNA Binding | 15460 | Q61645 |
Hs3st1 | heparan sulfate (glucosamine) 3-O-sulfotransferase 1 | Mouse | DNA Binding | 15476 | O35310 |
Hs3st3a1 | heparan sulfate (glucosamine) 3-O-sulfotransferase 3A1 | Mouse | DNA Binding | 15478 | Q52KJ0 |
Hsf2 | heat shock factor 2 | Mouse | DNA Binding | 15500 | P38533 |
Hspa4l | heat shock protein 4 like | Mouse | DNA Binding | 18415 | P48722 |
Hspb3 | heat shock protein 3 | Mouse | DNA Binding | 56534 | Q9QZ57 |
Htatip2 | HIV-1 tat interactive protein 2, homolog (human) | Mouse | DNA Binding | 53415 | Q9Z2G9 |
Htr7 | 5-hydroxytryptamine (serotonin) receptor 7 | Mouse | DNA Binding | 15566 | P32304 |
Hyal1 | hyaluronoglucosaminidase 1 | Mouse | DNA Binding | 15586 | Q91ZJ9 |
Id2 | inhibitor of DNA binding 2 | Mouse | DNA Binding | 15902 | P41136 |
Ido1 | indoleamine 2,3-dioxygenase 1 | Mouse | DNA Binding | 15930 | P28776 |
Ifna1 | interferon alpha 1 | Mouse | DNA Binding | 15962 | P01572 |
Ifna9 | interferon alpha 9 | Mouse | DNA Binding | 15972 | B1AWY7 |
Ifnb1 | interferon beta 1, fibroblast | Mouse | DNA Binding | 15977 | P01575 |
Ift46 | intraflagellar transport 46 | Mouse | DNA Binding | 76568 | Q9DB07 |
Igf1 | insulin-like growth factor 1 | Mouse | DNA Binding | 16000 | E9PU89 |
Igsf21 | immunoglobulin superfamily, member 21 | Mouse | DNA Binding | 230868 | Q7TNR6 |
Il18rap | interleukin 18 receptor accessory protein | Mouse | DNA Binding | 16174 | Q0VBK3 |
Il1f5 | interleukin 1 family, member 5 (delta) | Mouse | DNA Binding | 54450 | A2AIA9 |
Inpp5k | inositol polyphosphate 5-phosphatase K | Mouse | DNA Binding | 19062 | Q5ND43 |
Ipo13 | importin 13 | Mouse | Protein Binding | 230673 | Q8K0C1 |
Ipo4 | importin 4 | Mouse | Protein Binding | 75751 | Q8VI75 |
Ipo9 | importin 9 | Mouse | Protein Binding | 226432 | Q91YE6 |
Iqub | IQ motif and ubiquitin domain containing | Mouse | DNA Binding | 214704 | Q8CDK3 |
Irs1 | insulin receptor substrate 1 | Mouse | DNA Binding | 16367 | P35569 |
ISL1 | ISL LIM homeobox 1 | Human | DNA Binding | 3670 | P61371 |
Itgav | integrin alpha V | Mouse | DNA Binding | 16410 | P43406 |
Itgb1bp1 | integrin beta 1 binding protein 1 | Mouse | DNA Binding | 16413 | O35671 |
Itgb3bp | integrin beta 3 binding protein (beta3-endonexin) | Mouse | DNA Binding | 67733 | B1AZQ7 |
Itm2c | integral membrane protein 2C | Mouse | DNA Binding | 64294 | Q91VK4 |
Iws1 | IWS1 homolog (S. cerevisiae) | Mouse | DNA Binding | 73473 | Q8C1D8 |
Izumo1 | izumo sperm-egg fusion 1 | Mouse | DNA Binding | 73456 | Q9D9J7 |
Jph4 | junctophilin 4 | Mouse | DNA Binding | 319984 | Q80WT0 |
Kank3 | KN motif and ankyrin repeat domains 3 | Mouse | DNA Binding | 80880 | Q9Z1P7 |
Kansl3 | KAT8 regulatory NSL complex subunit 3 | Mouse | DNA Binding | 226976 | A2RSY1 |
Kbtbd8 | kelch repeat and BTB (POZ) domain containing 8 | Mouse | DNA Binding | 243574 | Q3UQV5 |
Kcna5 | potassium voltage-gated channel, shaker-related subfamily, member 5 | Mouse | DNA Binding | 16493 | Q61762 |
Kcnab1 | potassium voltage-gated channel, shaker-related subfamily, beta member 1 | Mouse | DNA Binding | 16497 | P63143 |
Kcnab3 | potassium voltage-gated channel, shaker-related subfamily, beta member 3 | Mouse | DNA Binding | 16499 | Q8C439 |
Kcne3 | potassium voltage-gated channel, Isk-related subfamily, gene 3 | Mouse | DNA Binding | 57442 | Q545H9 |
Kcnj14 | potassium inwardly-rectifying channel, subfamily J, member 14 | Mouse | DNA Binding | 211480 | Q8JZN3 |
Kcnt1 | potassium channel, subfamily T, member 1 | Mouse | DNA Binding | 227632 | Q6ZPR4 |
Kctd19 | potassium channel tetramerisation domain containing 19 | Mouse | DNA Binding | 279499 | Q562E2 |
Kctd4 | potassium channel tetramerisation domain containing 4 | Mouse | DNA Binding | 67516 | Q9D7X1 |
Kctd5 | potassium channel tetramerisation domain containing 5 | Mouse | DNA Binding | 69259 | Q8VC57 |
Khdrbs2 | KH domain containing, RNA binding, signal transduction associated 2 | Mouse | DNA Binding | 170771 | Q9WU01 |
Kif26b | kinesin family member 26B | Mouse | DNA Binding | 269152 | B0G0X9 |
Kirrel3 | kin of IRRE like 3 (Drosophila) | Mouse | DNA Binding | 67703 | Q8BR86 |
Kl | klotho | Mouse | DNA Binding | 16591 | O35082 |
Klf10 | Kruppel-like factor 10 | Mouse | DNA Binding | 21847 | O89091 |
Klf13 | Kruppel-like factor 13 | Mouse | DNA Binding | 50794 | Q9JJZ6 |
Klf9 | Kruppel-like factor 9 | Mouse | DNA Binding | 16601 | Q8CEC4 |
Klhl15 | kelch-like 15 (Drosophila) | Mouse | DNA Binding | 236904 | Q3TEP6 |
Klhl22 | kelch-like 22 (Drosophila) | Mouse | DNA Binding | 224023 | Q99JN2 |
Klk1b11 | kallikrein 1-related peptidase b11 | Mouse | DNA Binding | 16613 | P15946 |
Klrc1 | killer cell lectin-like receptor subfamily C, member 1 | Mouse | DNA Binding | 16641 | Q9Z202 |
Krcc1 | lysine-rich coiled-coil 1 | Mouse | DNA Binding | 57896 | Q99JT5 |
Krt222 | keratin 222 | Mouse | DNA Binding | 268481 | Q8CCX5 |
Krt40 | keratin 40 | Mouse | DNA Binding | 406221 | Q6IFX3 |
Krt78 | keratin 78 | Mouse | DNA Binding | 332131 | E9Q0F0 |
Krtap6-2 | keratin associated protein 6-2 | Mouse | DNA Binding | 16701 | O08884 |
Ksr2 | kinase suppressor of ras 2 | Mouse | DNA Binding | 333050 | Q3UVC0 |
Lamc2 | laminin, gamma 2 | Mouse | DNA Binding | 16782 | G5E874 |
Lamtor3 | late endosomal/lysosomal adaptor, MAPK and MTOR activator 3 | Mouse | DNA Binding | 56692 | O88653 |
Lbxcor1 | SKI family transcriptional corepressor 1 | Mouse | DNA Binding | 207667 | Q8BX46 |
Lce1e | late cornified envelope 1E | Mouse | DNA Binding | 68694 | Q9D139 |
Lcn12 | lipocalin 12 | Mouse | DNA Binding | 77701 | Q2TA58 |
Lenep | lens epithelial protein | Mouse | DNA Binding | 57275 | Q543C4 |
Lgi1 | leucine-rich repeat LGI family, member 1 | Mouse | DNA Binding | 56839 | Q9JIA1 |
Lhx5 | LIM homeobox protein 5 | Mouse | DNA Binding | 16873 | P61375 |
Lhx6 | LIM/homeobox protein Lhx6 | Mouse | Protein Binding | 16874 | Q9R1R0 |
Limch1 | LIM and calponin homology domains 1 | Mouse | DNA Binding | 77569 | Q3UH68 |
Lingo1 | leucine rich repeat and Ig domain containing 1 | Mouse | DNA Binding | 235402 | Q9D1T0 |
Lmnb2 | lamin B2 | Mouse | DNA Binding | 16907 | P21619 |
Lmo1 | LIM domain only 1 | Mouse | DNA Binding | 109594 | Q924W9 |
Lmo3 | LIM domain only 3 | Mouse | DNA Binding | 109593 | Q8BZL8 |
Lmo4 | LIM domain only 4 | Mouse | DNA Binding | 16911 | P61969 |
Lnp | limb and neural patterns | Mouse | DNA Binding | 69605 | A2ASL8 |
Lpar4 | lysophosphatidic acid receptor 4 | Mouse | DNA Binding | 78134 | Q8BLG2 |
Lpp | LIM domain containing preferred translocation partner in lipoma | Mouse | DNA Binding | 210126 | Q8BFW7 |
Lrrc18 | leucine rich repeat containing 18 | Mouse | DNA Binding | 67580 | Q9CQ07 |
Lrrc26 | leucine rich repeat containing 26 | Mouse | DNA Binding | 227618 | Q91W20 |
Lrrc3 | leucine rich repeat containing 3 | Mouse | DNA Binding | 237387 | P59034 |
Lrrc49 | leucine rich repeat containing 49 | Mouse | DNA Binding | 102747 | G5E8R5 |
Lrrc8a | leucine rich repeat containing 8A | Mouse | DNA Binding | 241296 | Q80WG5 |
Lrrc8d | leucine rich repeat containing 8D | Mouse | DNA Binding | 231549 | Q8BGR2 |
Lrrd1 | leucine rich repeats and death domain containing 1 | Mouse | DNA Binding | 242838 | Q8C0R9 |
Lrrtm2 | leucine rich repeat transmembrane neuronal 2 | Mouse | DNA Binding | 107065 | Q8BGA3 |
Lsm5 | LSM5 homolog, U6 small nuclear RNA associated (S. cerevisiae) | Mouse | DNA Binding | 66373 | P62322 |
Maf | avian musculoaponeurotic fibrosarcoma (v-maf) AS42 oncogene homolog | Mouse | DNA Binding | 17132 | P54843 |
Mafa | v-maf musculoaponeurotic fibrosarcoma oncogene family, protein A (avian) | Mouse | DNA Binding | 378435 | Q8CF90 |
Mamdc2 | MAM domain containing 2 | Mouse | DNA Binding | 71738 | Q8CG85 |
Man1a2 | mannosidase, alpha, class 1A, member 2 | Mouse | DNA Binding | 17156 | A2A724 |
Manea | mannosidase, endo-alpha | Mouse | DNA Binding | 242362 | Q6NXH2 |
Mark3 | MAP/microtubule affinity-regulating kinase 3 | Mouse | DNA Binding | 17169 | Q03141 |
Mark4 | MAP/microtubule affinity-regulating kinase 4 | Mouse | DNA Binding | 232944 | Q8CIP4 |
Mbd3l2 | methyl-CpG binding domain protein 3-like 2 | Mouse | DNA Binding | 234988 | Q3UXB0 |
Mbip | MAP3K12 binding inhibitory protein 1 | Mouse | DNA Binding | 217588 | Q99LQ1 |
Mboat1 | membrane bound O-acyltransferase domain containing 1 | Mouse | DNA Binding | 218121 | Q8BH98 |
Mc2r | melanocortin 2 receptor | Mouse | DNA Binding | 17200 | Q544P9 |
Mcm4 | minichromosome maintenance deficient 4 homolog (S. cerevisiae) | Mouse | DNA Binding | 17217 | P49717 |
Mdfi | MyoD family inhibitor | Mouse | DNA Binding | 17240 | P70331 |
Me3 | malic enzyme 3, NADP(+)-dependent, mitochondrial | Mouse | DNA Binding | 109264 | Q8BMF3 |
Meg3 | maternally expressed 3 (non-protein coding) | Mouse | DNA Binding | 17263 | Q8CCV7 |
Meis1 | Meis homeobox 1 | Mouse | DNA Binding | 17268 | Q60954 |
Mep1a | meprin 1 alpha | Mouse | DNA Binding | 17287 | P28825 |
Mesdc2 | mesoderm development candidate 2 | Mouse | DNA Binding | 67943 | Q9ERE7 |
Mett10d | methyltransferase like 16 | Mouse | DNA Binding | 67493 | Q9CQG2 |
Mett5d1 | methyltransferase like 15 | Mouse | DNA Binding | 76894 | Q9DCL4 |
Mfsd12 | major facilitator superfamily domain containing 12 | Mouse | DNA Binding | 73822 | Q3U481 |
Mid2 | midline 2 | Mouse | DNA Binding | 23947 | B1AVF4 |
Miox | myo-inositol oxygenase | Mouse | DNA Binding | 56727 | Q9QXN5 |
Mlip | muscular LMNA-interacting protein | Mouse | DNA Binding | 69642 | Q5FW52 |
Mlxip | MLX interacting protein | Mouse | DNA Binding | 208104 | G5E8D8 |
Mmp9 | matrix metallopeptidase 9 | Mouse | DNA Binding | 17395 | P41245 |
Mnat1 | menage a trois 1 | Mouse | DNA Binding | 17420 | P51949 |
Mpv17 | MpV17 mitochondrial inner membrane protein | Mouse | DNA Binding | 17527 | P19258 |
Mro | maestro | Mouse | DNA Binding | 71263 | E9PUF9 |
Mrpl27 | mitochondrial ribosomal protein L27 | Mouse | DNA Binding | 94064 | Q5SUY2 |
Mrps22 | mitochondrial ribosomal protein S22 | Mouse | DNA Binding | 64655 | Q9CXW2 |
Msx2 | homeobox, msh-like 2 | Mouse | DNA Binding | 17702 | Q03358 |
Msx3 | homeobox, msh-like 3 | Mouse | DNA Binding | 17703 | B2RPS3 |
Mtap1b | microtubule-associated protein 1B | Mouse | DNA Binding | 17755 | P14873 |
Mtap4 | microtubule-associated protein 4 | Mouse | DNA Binding | 17758 | P27546 |
Mtch2 | mitochondrial carrier homolog 2 (C. elegans) | Mouse | DNA Binding | 56428 | Q791V5 |
Mterfd1 | MTERF domain containing 1 | Mouse | DNA Binding | 66410 | Q8R3J4 |
Mtrf1l | mitochondrial translational release factor 1-like | Mouse | DNA Binding | 108853 | Q8BJU9 |
Muc4 | mucin 4 | Mouse | DNA Binding | 140474 | E9Q7Q0 |
Musk | muscle, skeletal, receptor tyrosine kinase | Mouse | DNA Binding | 18198 | Q61006 |
Mvd | mevalonate (diphospho) decarboxylase | Mouse | DNA Binding | 192156 | Q3UYC1 |
Mx2 | myxovirus (influenza virus) resistance 2 | Mouse | DNA Binding | 17858 | Q9WVP9 |
Mycbp | c-myc binding protein | Mouse | DNA Binding | 56309 | Q8R048 |
Mycbp2 | MYC binding protein 2 | Mouse | DNA Binding | 105689 | Q7TPH6 |
Myf5 | myogenic factor 5 | Mouse | DNA Binding | 17877 | A2RSK4 |
Myh8 | myosin, heavy polypeptide 8, skeletal muscle, perinatal | Mouse | DNA Binding | 17885 | P13542 |
Myt1 | myelin transcription factor 1 | Mouse | DNA Binding | 17932 | B0R0C1 |
Myt1l | myelin transcription factor 1-like | Mouse | DNA Binding | 17933 | P97500 |
N28178 | expressed sequence N28178 | Mouse | DNA Binding | 230085 | A2AG27 |
Naa35 | N(alpha)-acetyltransferase 35, NatC auxiliary subunit | Mouse | DNA Binding | 78689 | Q6PHQ8 |
Nanos2 | nanos homolog 2 (Drosophila) | Mouse | DNA Binding | 378430 | I6ZHM2 |
Napb | N-ethylmaleimide sensitive fusion protein attachment protein beta | Mouse | DNA Binding | 17957 | A2APW8 |
Napepld | N-acyl phosphatidylethanolamine phospholipase D | Mouse | DNA Binding | 242864 | Q8BH82 |
Ndnl2 | necdin-like 2 | Mouse | DNA Binding | 66647 | Q9CPR8 |
Ndrg1 | N-myc downstream regulated gene 1 | Mouse | DNA Binding | 17988 | Q545R3 |
Neil1 | nei endonuclease VIII-like 1 (E. coli) | Mouse | DNA Binding | 72774 | Q8K4Q6 |
NELL2 | NEL-like 2 (chicken) | Human | Protein Binding | 4753 | Q99435 |
Nenf | neuron derived neurotrophic factor | Mouse | DNA Binding | 66208 | Q9CQ45 |
Neo1 | neogenin | Mouse | DNA Binding | 18007 | Q7TQG5 |
Nfe2l3 | nuclear factor, erythroid derived 2, like 3 | Mouse | DNA Binding | 18025 | Q3UZC1 |
Nfib | nuclear factor I/B | Mouse | DNA Binding | 18028 | P97863 |
Nid2 | nidogen 2 | Mouse | DNA Binding | 18074 | O88322 |
Nipal4 | NIPA-like domain containing 4 | Mouse | DNA Binding | 214112 | Q8BZF2 |
Nkx2-1 | NK2 homeobox 1 | Mouse | DNA Binding | 21869 | P50220 |
Nms | neuromedin S | Mouse | DNA Binding | 433292 | Q5H8A1 |
Nox4 | NADPH oxidase 4 | Mouse | DNA Binding | 50490 | B2RSM1 |
Nppc | natriuretic peptide type C | Mouse | DNA Binding | 18159 | Q544K5 |
Npy6r | neuropeptide Y receptor Y6 | Mouse | DNA Binding | 18169 | Q61212 |
Nr4a1 | nuclear receptor subfamily 4, group A, member 1 | Mouse | DNA Binding | 15370 | P12813 |
Nr4a2 | nuclear receptor subfamily 4, group A, member 2 | Mouse | DNA Binding | 18227 | Q06219 |
Nrbp2 | nuclear receptor binding protein 2 | Mouse | DNA Binding | 223649 | Q91V36 |
Nrl | neural retina leucine zipper gene | Mouse | DNA Binding | 18185 | P54846 |
Nt5c1b | 5'-nucleotidase, cytosolic IB | Mouse | DNA Binding | 70881 | Q91YE9 |
Ntng1 | netrin G1 | Mouse | DNA Binding | 80883 | Q8R4G0 |
Ntsr2 | neurotensin receptor 2 | Mouse | DNA Binding | 18217 | P70310 |
Nub1 | negative regulator of ubiquitin-like proteins 1 | Mouse | DNA Binding | 53312 | P54729 |
Nudt16 | nudix (nucleoside diphosphate linked moiety X)-type motif 16 | Mouse | DNA Binding | 75686 | Q6P3D0 |
Nxf1 | nuclear RNA export factor 1 | Mouse | DNA Binding | 53319 | Q99JX7 |
Nxt2 | nuclear transport factor 2-like export factor 2 | Mouse | DNA Binding | 237082 | Q3UNA4 |
Ocln | occludin | Mouse | DNA Binding | 18260 | B2RS24 |
Odam | odontogenic, ameloblast asssociated | Mouse | DNA Binding | 69592 | A1E960 |
Odf3l1 | outer dense fiber of sperm tails 3-like 1 | Mouse | DNA Binding | 382075 | Q810P2 |
Odz4 | odd Oz/ten-m homolog 4 (Drosophila) | Mouse | DNA Binding | 23966 | Q3UHK6 |
Olfm3 | olfactomedin 3 | Mouse | DNA Binding | 229759 | P63056 |
Olfml3 | olfactomedin-like 3 | Mouse | DNA Binding | 99543 | Q8BK62 |
Olig3 | oligodendrocyte transcription factor 3 | Mouse | DNA Binding | 94222 | Q6PFG8 |
Onecut1 | one cut domain, family member 1 | Mouse | DNA Binding | 15379 | O08755 |
Oosp1 | oocyte secreted protein 1 | Mouse | DNA Binding | 170834 | Q925U0 |
Orf61 | open reading frame 61 | Mouse | DNA Binding | 216157 | Q8CIV2 |
Ormdl3 | ORM1-like 3 (S. cerevisiae) | Mouse | DNA Binding | 66612 | Q9CPZ6 |
Otp | orthopedia homolog (Drosophila) | Mouse | DNA Binding | 18420 | O09113 |
Otx1 | orthodenticle homolog 1 (Drosophila) | Mouse | DNA Binding | 18423 | P80205 |
Ovol1 | OVO homolog-like 1 (Drosophila) | Mouse | DNA Binding | 18426 | Q9WTJ2 |
Oxr1 | oxidation resistance 1 | Mouse | DNA Binding | 170719 | Q4KMM3 |
P2rx1 | purinergic receptor P2X, ligand-gated ion channel, 1 | Mouse | DNA Binding | 18436 | B2KG89 |
P2rx7 | purinergic receptor P2X, ligand-gated ion channel, 7 | Mouse | DNA Binding | 18439 | Q3UN00 |
P2ry10 | purinergic receptor P2Y, G-protein coupled 10 | Mouse | DNA Binding | 78826 | Q8BFU7 |
Padi1 | peptidyl arginine deiminase, type I | Mouse | DNA Binding | 18599 | Q544I4 |
Palmd | palmdelphin | Mouse | DNA Binding | 114301 | Q3UVT7 |
Pank1 | pantothenate kinase 1 | Mouse | DNA Binding | 75735 | Q8K4K6 |
Parm1 | prostate androgen-regulated mucin-like protein 1 | Mouse | DNA Binding | 231440 | Q923D3 |
Parp12 | poly (ADP-ribose) polymerase family, member 12 | Mouse | DNA Binding | 243771 | Q8BZ20 |
Parp8 | poly (ADP-ribose) polymerase family, member 8 | Mouse | DNA Binding | 52552 | F8WIK2 |
Patl1 | protein associated with topoisomerase II homolog 1 (yeast) | Mouse | DNA Binding | 225929 | Q3TC46 |
Pax1 | paired box gene 1 | Mouse | DNA Binding | 18503 | P09084 |
Pbld | phenazine biosynthesis-like protein domain containing 1 | Mouse | DNA Binding | 68371 | Q9DCG6 |
Pcdhac2 | protocadherin alpha subfamily C, 2 | Mouse | DNA Binding | 353237 | Q91Y09 |
Pcdhb10 | protocadherin beta 10 | Mouse | DNA Binding | 93881 | Q91VE5 |
Pcdhb5 | protocadherin beta 5 | Mouse | DNA Binding | 93876 | Q8CEA8 |
Pcdhgc4 | protocadherin gamma subfamily C, 4 | Mouse | DNA Binding | 93707 | Q91XX0 |
Pcgf3 | polycomb group ring finger 3 | Mouse | DNA Binding | 69587 | Q8BTQ0 |
Pcnxl4 | pecanex-like 4 (Drosophila) | Mouse | DNA Binding | 67708 | E9QN69 |
Pde10a | phosphodiesterase 10A | Mouse | DNA Binding | 23984 | Q8CA95 |
Pde1a | phosphodiesterase 1A, calmodulin-dependent | Mouse | DNA Binding | 18573 | Q9JLL9 |
Pde3a | phosphodiesterase 3A, cGMP inhibited | Mouse | DNA Binding | 54611 | B2RR84 |
Pde6b | phosphodiesterase 6B, cGMP, rod receptor, beta polypeptide | Mouse | DNA Binding | 18587 | P23440 |
Pde8b | phosphodiesterase 8B | Mouse | DNA Binding | 218461 | E9PYP0 |
Pdgfrl | platelet-derived growth factor receptor-like | Mouse | DNA Binding | 68797 | Q6PE55 |
Pdk3 | pyruvate dehydrogenase kinase, isoenzyme 3 | Mouse | DNA Binding | 236900 | Q4FJR4 |
Pdss1 | prenyl (solanesyl) diphosphate synthase, subunit 1 | Mouse | DNA Binding | 56075 | Q33DR2 |
Pdzd9 | PDZ domain containing 9 | Mouse | DNA Binding | 67983 | B9EJT5 |
Peg10 | paternally expressed 10 | Mouse | DNA Binding | 170676 | Q7TN75 |
Pgf | placental growth factor | Mouse | DNA Binding | 18654 | P49764 |
Phf19 | PHD finger protein 19 | Mouse | DNA Binding | 74016 | Q9CXG9 |
Phkg2 | phosphorylase kinase, gamma 2 (testis) | Mouse | DNA Binding | 68961 | Q9DB30 |
Phlda1 | pleckstrin homology-like domain, family A, member 1 | Mouse | DNA Binding | 21664 | Q62392 |
Phox2a | paired-like homeobox 2a | Mouse | DNA Binding | 11859 | Q62066 |
Phtf2 | putative homeodomain transcription factor 2 | Mouse | DNA Binding | 68770 | Q8C9D2 |
Phyh | phytanoyl-CoA hydroxylase | Mouse | DNA Binding | 16922 | O35386 |
Pias1 | protein inhibitor of activated STAT 1 | Mouse | DNA Binding | 56469 | O88907 |
Pibf1 | progesterone immunomodulatory binding factor 1 | Mouse | DNA Binding | 52023 | E9Q6K3 |
PICK1 | protein interacting with PRKCA 1 | Human | Protein Binding | 9463 | Q9NRD5 |
Pigr | polymeric immunoglobulin receptor | Mouse | DNA Binding | 18703 | O70570 |
Pik3r3 | phosphatidylinositol 3 kinase, regulatory subunit, polypeptide 3 (p55) | Mouse | DNA Binding | 18710 | Q3UXE9 |
Pitpnb | phosphatidylinositol transfer protein, beta | Mouse | DNA Binding | 56305 | P53811 |
Pkhd1l1 | polycystic kidney and hepatic disease 1-like 1 | Mouse | DNA Binding | 192190 | Q80ZA4 |
PKM2 | pyruvate kinase, muscle | Human | Protein Binding | 5315 | P14618 |
Pkp4 | plakophilin 4 | Mouse | DNA Binding | 227937 | Q68FH0 |
Pla2g15 | phospholipase A2, group XV | Mouse | DNA Binding | 192654 | Q8VEB4 |
Pla2g7 | phospholipase A2, group VII (platelet-activating factor acetylhydrolase, plasma) | Mouse | DNA Binding | 27226 | Q60963 |
Plac1 | placental specific protein 1 | Mouse | DNA Binding | 56096 | B1B0W9 |
Plac9 | placenta specific 9 | Mouse | DNA Binding | 211623 | Q8K262 |
Plec1 | plectin | Mouse | DNA Binding | 18810 | E9QN87 |
Plekhf1 | pleckstrin homology domain containing, family F (with FYVE domain) member 1 | Mouse | DNA Binding | 72287 | Q3TB82 |
Plekhg5 | pleckstrin homology domain containing, family G (with RhoGef domain) member 5 | Mouse | DNA Binding | 269608 | B1AS68 |
Plekhg6 | pleckstrin homology domain containing, family G (with RhoGef domain) member 6 | Mouse | DNA Binding | 213522 | Q8R0J1 |
Pls3 | plastin 3 (T-isoform) | Mouse | DNA Binding | 102866 | Q3UJG9 |
Plscr2 | phospholipid scramblase 2 | Mouse | DNA Binding | 18828 | Q9DCW2 |
Plxnd1 | plexin D1 | Mouse | DNA Binding | 67784 | Q3UH93 |
Pmaip1 | phorbol-12-myristate-13-acetate-induced protein 1 | Mouse | DNA Binding | 58801 | Q9JM54 |
Pnmt | phenylethanolamine-N-methyltransferase | Mouse | DNA Binding | 18948 | P40935 |
Poc1b | POC1 centriolar protein homolog B (Chlamydomonas) | Mouse | DNA Binding | 382406 | Q8BHD1 |
Polk | polymerase (DNA directed), kappa | Mouse | DNA Binding | 27015 | Q9QUG2 |
Polr2j | polymerase (RNA) II (DNA directed) polypeptide J | Mouse | DNA Binding | 20022 | Q3TYI2 |
Polr3e | polymerase (RNA) III (DNA directed) polypeptide E | Mouse | DNA Binding | 26939 | Q9CZT4 |
Por | P450 (cytochrome) oxidoreductase | Mouse | DNA Binding | 18984 | P37040 |
Pot1a | protection of telomeres 1A | Mouse | DNA Binding | 101185 | Q91WC1 |
Pou1f1 | POU domain, class 1, transcription factor 1 | Mouse | DNA Binding | 18736 | Q00286 |
Pou4f2 | POU domain, class 4, transcription factor 2 | Mouse | DNA Binding | 18997 | Q63934 |
Pou4f3 | POU domain, class 4, transcription factor 3 | Mouse | DNA Binding | 18998 | Q63955 |
Ppap2a | phosphatidic acid phosphatase type 2A | Mouse | DNA Binding | 19012 | Q61469 |
Ppap2b | phosphatidic acid phosphatase type 2B | Mouse | DNA Binding | 67916 | B1ASM1 |
Pparg | peroxisome proliferator activated receptor gamma | Mouse | DNA Binding | 19016 | P37238 |
Ppargc1a | peroxisome proliferative activated receptor, gamma, coactivator 1 alpha | Mouse | DNA Binding | 19017 | O70343 |
Ppfibp2 | PTPRF interacting protein, binding protein 2 (liprin beta 2) | Mouse | DNA Binding | 19024 | O35711 |
Ppp1r3a | protein phosphatase 1, regulatory (inhibitor) subunit 3A | Mouse | DNA Binding | 140491 | Q99MR9 |
Ppp2r1a | protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), alpha isoform | Mouse | DNA Binding | 51792 | Q76MZ3 |
Ppp3cc | protein phosphatase 3, catalytic subunit, gamma isoform | Mouse | DNA Binding | 19057 | P48455 |
Pqlc1 | PQ loop repeat containing 1 | Mouse | DNA Binding | 66943 | Q80XM9 |
Prc1 | protein regulator of cytokinesis 1 | Mouse | DNA Binding | 233406 | G3UW86 |
Prdm8 | PR domain containing 8 | Mouse | DNA Binding | 77630 | B2RU90 |
Prkd3 | protein kinase D3 | Mouse | DNA Binding | 75292 | Q5FWX6 |
Prkrir | protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor) | Mouse | DNA Binding | 72981 | Q9CUX1 |
Prl | prolactin | Mouse | DNA Binding | 19109 | Q3TT66 |
Prl5a1 | prolactin family 5, subfamily a, member 1 | Mouse | DNA Binding | 28078 | Q9JII2 |
Prl8a6 | prolactin family 8, subfamily a, member 6 | Mouse | DNA Binding | 19112 | Q9DAY2 |
Prl8a9 | prolactin family8, subfamily a, member 9 | Mouse | DNA Binding | 67310 | Q9CQ58 |
Prmt6 | protein arginine N-methyltransferase 6 | Mouse | DNA Binding | 99890 | Q6NZB1 |
Prosapip1 | ProSAPiP1 protein | Mouse | DNA Binding | 241638 | A2AHG0 |
Prpf39 | PRP39 pre-mRNA processing factor 39 homolog (yeast) | Mouse | DNA Binding | 328110 | E9QJV4 |
Prph | peripherin | Mouse | DNA Binding | 19132 | G5E846 |
Prpsap1 | phosphoribosyl pyrophosphate synthetase-associated protein 1 | Mouse | DNA Binding | 67763 | B1AT82 |
Prss12 | protease, serine, 12 neurotrypsin (motopsin) | Mouse | DNA Binding | 19142 | O08762 |
Prss58 | protease, serine 58 | Mouse | DNA Binding | 232717 | Q8BW11 |
Psd3 | pleckstrin and Sec7 domain containing 3 | Mouse | DNA Binding | 234353 | E9PUC5 |
Psma1 | proteasome (prosome, macropain) subunit, alpha type 1 | Mouse | DNA Binding | 26440 | Q3TS44 |
Psmd7 | proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 | Mouse | DNA Binding | 17463 | A1L3B8 |
Ptch1 | patched homolog 1 | Mouse | DNA Binding | 19206 | Q61115 |
Ptcra | pre T cell antigen receptor alpha | Mouse | DNA Binding | 19208 | P0C6B2 |
Ptger4 | prostaglandin E receptor 4 (subtype EP4) | Mouse | DNA Binding | 19219 | Q91VE4 |
Ptgr1 | prostaglandin reductase 1 | Mouse | DNA Binding | 67103 | A2ALW3 |
Ptpn4 | protein tyrosine phosphatase, non-receptor type 4 | Mouse | DNA Binding | 19258 | G5E8E7 |
Pxt1 | peroxisomal, testis specific 1 | Mouse | DNA Binding | 69307 | B2KF08 |
Pzp | pregnancy zone protein | Mouse | DNA Binding | 11287 | Q61838 |
Rab15 | RAB15, member RAS oncogene family | Mouse | DNA Binding | 104886 | Q3TYB1 |
Rab21 | RAB21, member RAS oncogene family | Mouse | DNA Binding | 216344 | P35282 |
Rab2b | RAB2B, member RAS oncogene family | Mouse | DNA Binding | 76338 | P59279 |
Rab39b | RAB39B, member RAS oncogene family | Mouse | DNA Binding | 67790 | Q0PD14 |
Rab3ip | RAB3A interacting protein | Mouse | DNA Binding | 216363 | Q68EF0 |
Rab43 | RAB43, member RAS oncogene family | Mouse | DNA Binding | 69834 | Q0PD10 |
Rab5a | RAB5A, member RAS oncogene family | Mouse | DNA Binding | 271457 | Q9CQD1 |
Rad54l2 | RAD54 like 2 (S. cerevisiae) | Mouse | DNA Binding | 81000 | E9QKL0 |
Ralb | v-ral simian leukemia viral oncogene homolog B (ras related) | Mouse | DNA Binding | 64143 | Q8CCG5 |
Ranbp10 | RAN binding protein 10 | Mouse | DNA Binding | 74334 | Q6VN19 |
Ranbp3 | RAN binding protein 3 | Mouse | DNA Binding | 71810 | Q9CT10 |
Rapgef3 | Rap guanine nucleotide exchange factor (GEF) 3 | Mouse | DNA Binding | 223864 | Q3UQC2 |
Rasgef1b | RasGEF domain family, member 1B | Mouse | DNA Binding | 320292 | Q8JZL7 |
Rassf5 | Ras association (RalGDS/AF-6) domain family member 5 | Mouse | DNA Binding | 54354 | Q5EBH1 |
Rbbp5 | retinoblastoma binding protein 5 | Mouse | DNA Binding | 213464 | Q8BX09 |
Rbm26 | RNA binding motif protein 26 | Mouse | DNA Binding | 74213 | E9PUF4 |
Rbm38 | RNA binding motif protein 38 | Mouse | DNA Binding | 56190 | Q62176 |
Rbm42 | RNA binding motif protein 42 | Mouse | DNA Binding | 68035 | Q91V81 |
Rbm47 | RNA binding motif protein 47 | Mouse | DNA Binding | 245945 | Q91WT8 |
Rbms2 | RNA binding motif, single stranded interacting protein 2 | Mouse | DNA Binding | 56516 | E9Q7G6 |
Rcl1 | RNA terminal phosphate cyclase-like 1 | Mouse | DNA Binding | 59028 | Q9JJT0 |
Rcor1 | REST corepressor 1 | Mouse | DNA Binding | 217864 | Q8CFE3 |
Rdh11 | retinol dehydrogenase 11 | Mouse | DNA Binding | 17252 | Q9QYF1 |
Reps1 | RalBP1 associated Eps domain containing protein | Mouse | DNA Binding | 19707 | E9Q632 |
Rexo1 | REX1, RNA exonuclease 1 homolog (S. cerevisiae) | Mouse | DNA Binding | 66932 | Q7TT28 |
Rffl | ring finger and FYVE like domain containing protein | Mouse | DNA Binding | 67338 | Q3TEV8 |
Rmi1 | RMI1, RecQ mediated genome instability 1, homolog (S. cerevisiae) | Mouse | DNA Binding | 74386 | Q9D4G9 |
Rnft2 | ring finger protein, transmembrane 2 | Mouse | DNA Binding | 269695 | Q3UF64 |
Rpe | ribulose-5-phosphate-3-epimerase | Mouse | DNA Binding | 66646 | B2KGE9 |
Rpl21 | ribosomal protein L21 | Mouse | DNA Binding | 19933 | Q9CQM8 |
Rps27l | ribosomal protein S27-like | Mouse | DNA Binding | 67941 | Q6ZWY3 |
Rpusd4 | RNA pseudouridylate synthase domain containing 4 | Mouse | DNA Binding | 71989 | Q9CWX4 |
Rraga | Ras-related GTP binding A | Mouse | DNA Binding | 68441 | Q80X95 |
Rragb | Ras-related GTP binding B | Mouse | DNA Binding | 245670 | Q6NTA4 |
Rrp1b | ribosomal RNA processing 1 homolog B (S. cerevisiae) | Mouse | DNA Binding | 72462 | Q91YK2 |
Rspo3 | R-spondin 3 homolog (Xenopus laevis) | Mouse | DNA Binding | 72780 | Q2TJ95 |
Rtn4r | reticulon 4 receptor | Mouse | DNA Binding | 65079 | Q99PI8 |
Rtp1 | receptor transporter protein 1 | Mouse | DNA Binding | 239766 | B2RSL5 |
Rtp2 | receptor transporter protein 2 | Mouse | DNA Binding | 224055 | Q80ZI2 |
Rwdd1 | RWD domain containing 1 | Mouse | DNA Binding | 66521 | Q9CQK7 |
S1pr5 | sphingosine-1-phosphate receptor 5 | Mouse | DNA Binding | 94226 | Q91X56 |
Saa1 | serum amyloid A 1 | Mouse | DNA Binding | 20208 | P05366 |
Sall3 | sal-like 3 (Drosophila) | Mouse | DNA Binding | 20689 | Q62255 |
Samd5 | sterile alpha motif domain containing 5 | Mouse | DNA Binding | 320825 | Q3V1H9 |
Sars | seryl-aminoacyl-tRNA synthetase | Mouse | DNA Binding | 20226 | P26638 |
Sbf1 | SET binding factor 1 | Mouse | DNA Binding | 77980 | Q6ZPE2 |
Sbk1 | SH3-binding kinase 1 | Mouse | DNA Binding | 104175 | Q8QZX0 |
Scfd2 | Sec1 family domain containing 2 | Mouse | DNA Binding | 212986 | Q3UPD0 |
Scoc | short coiled-coil protein | Mouse | DNA Binding | 56367 | Q78YZ6 |
Sdc3 | syndecan 3 | Mouse | DNA Binding | 20970 | B1ASF5 |
Sdc4 | syndecan 4 | Mouse | DNA Binding | 20971 | O35988 |
Sdr39u1 | short chain dehydrogenase/reductase family 39U, member 1 | Mouse | DNA Binding | 654795 | Q5M8N4 |
Sdr42e1 | short chain dehydrogenase/reductase family 42E, member 1 | Mouse | DNA Binding | 74032 | Q9D665 |
Sema3c | sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C | Mouse | DNA Binding | 20348 | Q62181 |
Sema3g | sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3G | Mouse | DNA Binding | 218877 | Q4LFA9 |
Sema6a | sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A | Mouse | DNA Binding | 20358 | O35464 |
Serp1 | stress-associated endoplasmic reticulum protein 1 | Mouse | DNA Binding | 28146 | Q9Z1W5 |
Serpina10 | serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10 | Mouse | DNA Binding | 217847 | Q8R121 |
Serpinb7 | serine (or cysteine) peptidase inhibitor, clade B, member 7 | Mouse | DNA Binding | 116872 | Q6P3F8 |
Serpinb9c | serine (or cysteine) peptidase inhibitor, clade B, member 9c | Mouse | DNA Binding | 20707 | I7HJI5 |
Serpini2 | serine (or cysteine) peptidase inhibitor, clade I, member 2 | Mouse | DNA Binding | 67931 | Q4G0D3 |
SETD2 | SET domain containing 2 | Human | Protein Binding | 29072 | Q9BYW2 |
Setd5 | SET domain containing 5 | Mouse | DNA Binding | 72895 | Q5XJV7 |
Setd6 | SET domain containing 6 | Mouse | DNA Binding | 66083 | Q9CWY3 |
Sf1 | splicing factor 1 | Mouse | DNA Binding | 22668 | Q64213 |
Sf3a2 | splicing factor 3a, subunit 2 | Mouse | DNA Binding | 20222 | G3UVU2 |
Sfrs1 | serine/arginine-rich splicing factor 1 | Mouse | DNA Binding | 110809 | Q6PDM2 |
Sfrs12 | splicing regulatory glutamine/lysine-rich protein 1 | Mouse | DNA Binding | 218543 | Q8BZX4 |
Sfrs5 | serine/arginine-rich splicing factor 5 | Mouse | DNA Binding | 20384 | O35326 |
Sfrs7 | serine/arginine-rich splicing factor 7 | Mouse | DNA Binding | 225027 | Q3THA6 |
Sfxn5 | sideroflexin 5 | Mouse | DNA Binding | 94282 | Q925N0 |
Sh3tc2 | SH3 domain and tetratricopeptide repeats 2 | Mouse | DNA Binding | 225608 | Q3UPD8 |
Shoc2 | soc-2 (suppressor of clear) homolog (C. elegans) | Mouse | DNA Binding | 56392 | O88520 |
Shox2 | short stature homeobox 2 | Mouse | DNA Binding | 20429 | P70390 |
Shroom3 | shroom family member 3 | Mouse | DNA Binding | 27428 | Q9QXN0 |
Siah1b | seven in absentia 1B | Mouse | DNA Binding | 20438 | A2AHZ2 |
Siglec5 | sialic acid binding Ig-like lectin 5 | Mouse | DNA Binding | 233186 | B7ZN64 |
Sike1 | suppressor of IKBKE 1 | Mouse | DNA Binding | 66641 | Q9CPR7 |
Six6os1 | RIKEN cDNA 4930447C04 gene | Mouse | DNA Binding | 75801 | Q9CTN5 |
Skint10 | selection and upkeep of intraepithelial T cells 10 | Mouse | DNA Binding | 230613 | Q8CA07 |
Skint11 | selection and upkeep of intraepithelial T cells 11 | Mouse | DNA Binding | 230623 | A7XV14 |
Sla2 | Src-like-adaptor 2 | Mouse | DNA Binding | 77799 | A2AVZ2 |
Slc10a5 | solute carrier family 10 (sodium/bile acid cotransporter family), member 5 | Mouse | DNA Binding | 241877 | Q5PT54 |
Slc10a7 | solute carrier family 10 (sodium/bile acid cotransporter family), member 7 | Mouse | DNA Binding | 76775 | Q5PT53 |
Slc12a5 | solute carrier family 12, member 5 | Mouse | DNA Binding | 57138 | Q91V14 |
Slc16a10 | solute carrier family 16 (monocarboxylic acid transporters), member 10 | Mouse | DNA Binding | 72472 | Q3U9N9 |
Slc16a4 | solute carrier family 16 (monocarboxylic acid transporters), member 4 | Mouse | DNA Binding | 229699 | Q8R0M8 |
Slc1a1 | solute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 1 | Mouse | DNA Binding | 20510 | P51906 |
Slc22a23 | solute carrier family 22, member 23 | Mouse | DNA Binding | 73102 | Q3UHH2 |
Slc26a1 | solute carrier family 26 (sulfate transporter), member 1 | Mouse | DNA Binding | 231583 | P58735 |
Slc2a13 | solute carrier family 2 (facilitated glucose transporter), member 13 | Mouse | DNA Binding | 239606 | Q3UHK1 |
Slc2a2 | solute carrier family 2 (facilitated glucose transporter), member 2 | Mouse | DNA Binding | 20526 | P14246 |
Slc2a3 | solute carrier family 2 (facilitated glucose transporter), member 3 | Mouse | DNA Binding | 20527 | P32037 |
Slc2a9 | solute carrier family 2 (facilitated glucose transporter), member 9 | Mouse | DNA Binding | 117591 | B9EHN5 |
Slc35d1 | solute carrier family 35 (UDP-glucuronic acid/UDP-N-acetylgalactosamine dual transporter), member D1 | Mouse | DNA Binding | 242585 | Q8BX24 |
Slc35e1 | solute carrier family 35, member E1 | Mouse | DNA Binding | 270066 | Q8CD26 |
Slc43a3 | solute carrier family 43, member 3 | Mouse | DNA Binding | 58207 | A2AVZ9 |
Slc46a2 | solute carrier family 46, member 2 | Mouse | DNA Binding | 30936 | Q8CA03 |
Slc46a3 | solute carrier family 46, member 3 | Mouse | DNA Binding | 71706 | Q9DC26 |
Slc47a1 | solute carrier family 47, member 1 | Mouse | DNA Binding | 67473 | Q8K0H1 |
Slc48a1 | solute carrier family 48 (heme transporter), member 1 | Mouse | DNA Binding | 67739 | Q9D8M3 |
Slc4a4 | solute carrier family 4 (anion exchanger), member 4 | Mouse | DNA Binding | 54403 | O88343 |
Slc52a3 | solute carrier protein family 52, member 3 | Mouse | DNA Binding | 69698 | Q9D6X5 |
Slc6a2 | solute carrier family 6 (neurotransmitter transporter, noradrenalin), member 2 | Mouse | DNA Binding | 20538 | O55192 |
Slc6a20 | solute carrier family 6 (neurotransmitter transporter), member 20B | Mouse | DNA Binding | 22599 | O88575 |
Slc6a5 | solute carrier family 6 (neurotransmitter transporter, glycine), member 5 | Mouse | DNA Binding | 104245 | B2RQX9 |
Slc7a5 | solute carrier family 7 (cationic amino acid transporter, y+ system), member 5 | Mouse | DNA Binding | 20539 | Q9Z127 |
Slit2 | slit homolog 2 (Drosophila) | Mouse | DNA Binding | 20563 | Q9R1B9 |
Smad1 | MAD homolog 1 (Drosophila) | Mouse | DNA Binding | 17125 | P70340 |
Smad4 | SMAD family member 4 | Mouse | DNA Binding | 17128 | P97471 |
Smc6 | structural maintenance of chromosomes 6 | Mouse | DNA Binding | 67241 | Q924W5 |
Smu1 | smu-1 suppressor of mec-8 and unc-52 homolog (C. elegans) | Mouse | DNA Binding | 74255 | B1AXY3 |
Snapap | SNAP-associated protein | Mouse | DNA Binding | 20615 | Q9Z266 |
Snf1lk | salt inducible kinase 1 | Mouse | DNA Binding | 17691 | Q60670 |
Snf8 | SNF8, ESCRT-II complex subunit, homolog (S. cerevisiae) | Mouse | DNA Binding | 27681 | Q9CZ28 |
Snrp70 | small nuclear ribonucleoprotein 70 (U1) | Mouse | DNA Binding | 20637 | A2RS68 |
Snrpb | small nuclear ribonucleoprotein B | Mouse | DNA Binding | 20638 | A2APD4 |
Snrpn | small nuclear ribonucleoprotein N | Mouse | DNA Binding | 20646 | P63163 |
Snx15 | sorting nexin 15 | Mouse | DNA Binding | 69024 | Q91WE1 |
Snx2 | sorting nexin 2 | Mouse | DNA Binding | 67804 | Q9CWK8 |
Snx30 | sorting nexin family member 30 | Mouse | DNA Binding | 209131 | Q8CE50 |
Sod1 | superoxide dismutase 1, soluble | Mouse | DNA Binding | 20655 | P08228 |
Sox8 | SRY-box containing gene 8 | Mouse | DNA Binding | 20681 | Q04886 |
Spag16 | sperm associated antigen 16 | Mouse | DNA Binding | 66722 | Q8K450 |
Spag9 | sperm associated antigen 9 | Mouse | DNA Binding | 70834 | Q58A65 |
Spata16 | spermatogenesis associated 16 | Mouse | DNA Binding | 70862 | Q8C636 |
Spic | Spi-C transcription factor (Spi-1/PU.1 related) | Mouse | DNA Binding | 20728 | Q6P3D7 |
Spock3 | sparc/osteonectin, cwcv and kazal-like domains proteoglycan 3 | Mouse | DNA Binding | 72902 | Q8BKV0 |
Sprr2e | small proline-rich protein 2E | Mouse | DNA Binding | 20759 | O70556 |
Sprr2f | small proline-rich protein 2F | Mouse | DNA Binding | 20760 | O70557 |
Sptssa | serine palmitoyltransferase, small subunit A | Mouse | DNA Binding | 104725 | Q8R207 |
Sptssb | serine palmitoyltransferase, small subunit B | Mouse | DNA Binding | 66183 | Q925E8 |
Spty2d1 | SPT2, Suppressor of Ty, domain containing 1 (S. cerevisiae) | Mouse | DNA Binding | 101685 | Q68FG3 |
Srpx | sushi-repeat-containing protein | Mouse | DNA Binding | 51795 | Q9R0M3 |
Srrm3 | serine/arginine repetitive matrix 3 | Mouse | DNA Binding | 58212 | Q80WV7 |
Stag3 | stromal antigen 3 | Mouse | DNA Binding | 50878 | O70576 |
Stam2 | signal transducing adaptor molecule (SH3 domain and ITAM motif) 2 | Mouse | DNA Binding | 56324 | O88811 |
Stk11 | serine/threonine kinase 11 | Mouse | DNA Binding | 20869 | Q9WTK7 |
Stmn4 | stathmin-like 4 | Mouse | DNA Binding | 56471 | P63042 |
Stox2 | storkhead box 2 | Mouse | DNA Binding | 71069 | Q499E5 |
Stx8 | syntaxin 8 | Mouse | DNA Binding | 55943 | O88983 |
Sucnr1 | succinate receptor 1 | Mouse | DNA Binding | 84112 | Q99MT6 |
Sult2b1 | sulfotransferase family, cytosolic, 2B, member 1 | Mouse | DNA Binding | 54200 | O35400 |
Susd4 | sushi domain containing 4 | Mouse | DNA Binding | 96935 | Q8BH32 |
Svs4 | seminal vesicle secretory protein 4 | Mouse | DNA Binding | 20941 | P18419 |
Syt15 | synaptotagmin XV | Mouse | DNA Binding | 319508 | Q8C6N3 |
Tas2r102 | taste receptor, type 2, member 102 | Mouse | DNA Binding | 387339 | F8VPL4 |
Tas2r113 | taste receptor, type 2, member 113 | Mouse | DNA Binding | 387345 | Q7M711 |
Tas2r125 | taste receptor, type 2, member 125 | Mouse | DNA Binding | 387352 | Q7M710 |
Tas2r129 | taste receptor, type 2, member 129 | Mouse | DNA Binding | 387354 | Q7M709 |
Tceal8 | transcription elongation factor A (SII)-like 8 | Mouse | DNA Binding | 66684 | Q9CZY2 |
Tcerg1 | transcription elongation regulator 1 (CA150) | Mouse | DNA Binding | 56070 | Q3TH57 |
Tcf1 | transcription factor 12 | Mouse | DNA Binding | 21406 | Q3UZ69 |
Tcl1 | T cell lymphoma breakpoint 1 | Mouse | DNA Binding | 21432 | P56280 |
Tcp11l2 | t-complex 11 (mouse) like 2 | Mouse | DNA Binding | 216198 | Q8K1H7 |
Tekt1 | tektin 1 | Mouse | DNA Binding | 21689 | Q5NBU4 |
Tgfb3 | transforming growth factor, beta 3 | Mouse | DNA Binding | 21809 | Q91YU7 |
Tgfbi | transforming growth factor, beta induced | Mouse | DNA Binding | 21810 | A1L353 |
Th | tyrosine hydroxylase | Mouse | DNA Binding | 21823 | P24529 |
Thbs4 | thrombospondin 4 | Mouse | DNA Binding | 21828 | B2RTL6 |
Themis | thymocyte selection associated | Mouse | DNA Binding | 210757 | Q8BGW0 |
Thnsl2 | threonine synthase-like 2 (bacterial) | Mouse | DNA Binding | 232078 | Q80W22 |
Timm8a1 | translocase of inner mitochondrial membrane 8 homolog a1 (yeast) | Mouse | DNA Binding | 30058 | B1AV37 |
Tiparp | TCDD-inducible poly(ADP-ribose) polymerase | Mouse | DNA Binding | 99929 | Q8C1B2 |
Tle1 | transducin-like enhancer of split 1, homolog of Drosophila E(spl) | Mouse | DNA Binding | 21885 | Q62440 |
Tmc7 | transmembrane channel-like gene family 7 | Mouse | DNA Binding | 209760 | Q8C428 |
Tmcc2 | transmembrane and coiled-coil domains 2 | Mouse | DNA Binding | 68875 | Q80W04 |
Tmco4 | transmembrane and coiled-coil domains 4 | Mouse | DNA Binding | 77056 | Q91WU4 |
Tmed9 | transmembrane emp24 protein transport domain containing 9 | Mouse | DNA Binding | 67511 | Q6PDC2 |
Tmeff2 | transmembrane protein with EGF-like and two follistatin-like domains 2 | Mouse | DNA Binding | 56363 | Q9QYM9 |
Tmem136 | transmembrane protein 136 | Mouse | DNA Binding | 235300 | Q3TYE7 |
Tmem150B | transmembrane protein 150B | Mouse | DNA Binding | 330460 | Q8R218 |
Tmem154 | transmembrane protein 154 | Mouse | DNA Binding | 320782 | Q8C4Q9 |
Tmem200a | transmembrane protein 200A | Mouse | DNA Binding | 77220 | B2RUN2 |
Tmem222 | transmembrane protein 222 | Mouse | DNA Binding | 52174 | Q8BVA2 |
Tmem232 | transmembrane protein 232 | Mouse | DNA Binding | 381107 | Q5K6N0 |
Tmem246 | transmembrane protein 246 | Mouse | DNA Binding | 67063 | A2AKL1 |
Tmem35 | transmembrane protein 35 | Mouse | DNA Binding | 67564 | B1AV87 |
Tmem65 | transmembrane protein 65 | Mouse | DNA Binding | 74868 | Q4VAE3 |
Tmem67 | transmembrane protein 67 | Mouse | DNA Binding | 329795 | E9QNI1 |
Tmem90a | transmembrane protein 90a | Mouse | DNA Binding | 627191 | B2RRM8 |
Tmod1 | tropomodulin 1 | Mouse | DNA Binding | 21916 | P49813 |
Tnfaip8l2 | tumor necrosis factor, alpha-induced protein 8-like 2 | Mouse | DNA Binding | 69769 | Q9D8Y7 |
Tnfrsf19 | tumor necrosis factor receptor superfamily, member 19 | Mouse | DNA Binding | 29820 | Q8BUM7 |
Tnfsf18 | tumor necrosis factor (ligand) superfamily, member 18 | Mouse | DNA Binding | 240873 | Q7TS55 |
Tnpo2 | transportin 2 (importin 3, karyopherin beta 2b) | Mouse | DNA Binding | 212999 | Q99LG2 |
Tob1 | transducer of ErbB-2.1 | Mouse | DNA Binding | 22057 | Q640M3 |
Tpbpa | trophoblast specific protein alpha | Mouse | DNA Binding | 21984 | Q9CPR0 |
Tpbpb | trophoblast specific protein beta | Mouse | DNA Binding | 116913 | Q9CQC0 |
Tpd52 | tumor protein D52 | Mouse | DNA Binding | 21985 | F8WHQ1 |
Tph1 | tryptophan hydroxylase 1 | Mouse | DNA Binding | 21990 | P17532 |
Tpp2 | tripeptidyl peptidase II | Mouse | DNA Binding | 22019 | Q64514 |
Tppp3 | tubulin polymerization-promoting protein family member 3 | Mouse | DNA Binding | 67971 | Q9CRB6 |
Trdmt1 | tRNA aspartic acid methyltransferase 1 | Mouse | DNA Binding | 13434 | O55055 |
Tril | TLR4 interactor with leucine-rich repeats | Mouse | DNA Binding | 66873 | Q9DBY4 |
Trim40 | tripartite motif-containing 40 | Mouse | DNA Binding | 195359 | Q3UWA4 |
Trim44 | tripartite motif-containing 44 | Mouse | DNA Binding | 80985 | Q4KMS1 |
Trp53bp1 | transformation related protein 53 binding protein 1 | Mouse | DNA Binding | 27223 | A2AU91 |
Trp53inp2 | transformation related protein 53 inducible nuclear protein 2 | Mouse | DNA Binding | 68728 | Q8CFU8 |
Trps1 | trichorhinophalangeal syndrome I (human) | Mouse | DNA Binding | 83925 | G3UW90 |
Tspan2 | tetraspanin 2 | Mouse | DNA Binding | 70747 | Q9D1X8 |
Tspan32 | tetraspanin 32 | Mouse | DNA Binding | 27027 | Q9JHH2 |
Tspan4 | tetraspanin 4 | Mouse | DNA Binding | 64540 | Q4FJW7 |
Tspan7 | tetraspanin 7 | Mouse | DNA Binding | 21912 | Q62283 |
Tspyl1 | testis-specific protein, Y-encoded-like 1 | Mouse | DNA Binding | 22110 | O88852 |
Tst | thiosulfate sulfurtransferase, mitochondrial | Mouse | DNA Binding | 22117 | P52196 |
Ttc3 | tetratricopeptide repeat domain 3 | Mouse | DNA Binding | 22129 | O88196 |
Ttc32 | tetratricopeptide repeat domain 32 | Mouse | DNA Binding | 75516 | Q9DAC7 |
Ttk | Ttk protein kinase | Mouse | DNA Binding | 22137 | Q8BY97 |
Txn1 | thioredoxin 1 | Mouse | DNA Binding | 22166 | A2AV97 |
Txndc3 | NME/NM23 family member 8 | Mouse | DNA Binding | 73412 | Q715T0 |
Uaca | uveal autoantigen with coiled-coil domains and ankyrin repeats | Mouse | DNA Binding | 72565 | Q8CGB3 |
Ubqln4 | ubiquilin 4 | Mouse | DNA Binding | 94232 | Q99NB8 |
Ubr7 | ubiquitin protein ligase E3 component n-recognin 7 (putative) | Mouse | DNA Binding | 66622 | Q52KC0 |
Ubxn4 | UBX domain protein 4 | Mouse | DNA Binding | 67812 | Q8C0Z0 |
Ucn | urocortin | Mouse | DNA Binding | 22226 | P81615 |
Ugt2a2 | UDP glucuronosyltransferase 2 family, polypeptide A2 | Mouse | DNA Binding | 552899 | Q6PDD0 |
Ugt2b37 | UDP glucuronosyltransferase 2 family, polypeptide B37 | Mouse | DNA Binding | 112417 | Q8VCN3 |
Unc50 | unc-50 homolog (C. elegans) | Mouse | DNA Binding | 67387 | Q9CQ61 |
Unc5d | unc-5 homolog D (C. elegans) | Mouse | DNA Binding | 210801 | Q8K1S2 |
Uncx | UNC homeobox | Mouse | DNA Binding | 22255 | O08934 |
Upp2 | uridine phosphorylase 2 | Mouse | DNA Binding | 76654 | Q3UEN1 |
Use1 | unconventional SNARE in the ER 1 homolog (S. cerevisiae) | Mouse | DNA Binding | 67023 | E9Q496 |
Usp3 | ubiquitin specific peptidase 3 | Mouse | DNA Binding | 235441 | Q91W36 |
Usp53 | ubiquitin specific peptidase 53 | Mouse | DNA Binding | 99526 | P15975 |
Usp8 | ubiquitin specific peptidase 8 | Mouse | DNA Binding | 84092 | A2AI52 |
Utp6 | UTP6, small subunit (SSU) processome component, homolog (yeast) | Mouse | DNA Binding | 216987 | Q8VCY6 |
V1rc19 | vomeronasal 1 receptor 5 | Mouse | DNA Binding | 171192 | B2RQT2 |
V1rc20 | vomeronasal 1 receptor 6 | Mouse | DNA Binding | 171193 | Q8R2D4 |
V1rd1 | vomeronasal 1 receptor 63 | Mouse | DNA Binding | 81017 | Q9EPT1 |
V1rd15 | vomeronasal 1 receptor 183 | Mouse | DNA Binding | 209824 | Q8K3N5 |
V1rd2 | vomeronasal 1 receptor 62 | Mouse | DNA Binding | 81016 | Q8R2C0 |
V1rd20 | vomeronasal 1 receptor 181 | Mouse | DNA Binding | 404289 | Q0P547 |
V1rf2 | vomeronasal 1 receptor 235 | Mouse | DNA Binding | 171233 | Q8R297 |
V1rh13 | vomeronasal 1 receptor 219 | Mouse | DNA Binding | 171272 | Q8R271 |
V1rh21 | vomeronasal 1 receptor 197 | Mouse | DNA Binding | 171278 | Q8R265 |
V1ri1 | vomeronasal 1 receptor 192 | Mouse | DNA Binding | 252907 | Q8K4C9 |
Vars | valyl-tRNA synthetase | Mouse | DNA Binding | 22321 | Q9Z1Q9 |
Vat1 | vesicle amine transport protein 1 homolog (T californica) | Mouse | DNA Binding | 26949 | Q499X4 |
Vnn1 | vanin 1 | Mouse | DNA Binding | 22361 | Q9Z0K8 |
Vps4b | vacuolar protein sorting 4b (yeast) | Mouse | DNA Binding | 20479 | P46467 |
Vti1b | vesicle transport through interaction with t-SNAREs 1B homolog | Mouse | DNA Binding | 53612 | Q91XH6 |
Vwa2 | von Willebrand factor A domain containing 2 | Mouse | DNA Binding | 240675 | Q70UZ7 |
Wasf1 | WASP family 1 | Mouse | DNA Binding | 83767 | Q8R5H6 |
Wbscr27 | Williams Beuren syndrome chromosome region 27 (human) | Mouse | DNA Binding | 79565 | Q8BGM4 |
Wdr17 | WD repeat domain 17 | Mouse | DNA Binding | 244484 | Q8C8Y2 |
Wdr25 | WD repeat domain 25 | Mouse | DNA Binding | 212198 | E9Q349 |
Wfdc1 | WAP four-disulfide core domain 1 | Mouse | DNA Binding | 67866 | Q3UQ76 |
Wfs1 | Wolfram syndrome 1 homolog (human) | Mouse | DNA Binding | 22393 | P56695 |
Wrap53 | WD repeat containing, antisense to TP53 | Mouse | DNA Binding | 216853 | Q8VC51 |
Xpo7 | exportin 7 | Mouse | DNA Binding | 65246 | Q9EPK7 |
Yme1l1 | YME1-like 1 (S. cerevisiae) | Mouse | DNA Binding | 27377 | A2AQY3 |
Zbtb41 | zinc finger and BTB domain containing 41 homolog | Mouse | DNA Binding | 226470 | Q811F1 |
Zbtb7c | zinc finger and BTB domain containing 7C | Mouse | DNA Binding | 207259 | Q8VCZ7 |
Zc3h12d | zinc finger CCCH type containing 12D | Mouse | DNA Binding | 237256 | E9QNR7 |
Zc3hav1l | zinc finger CCCH-type, antiviral 1-like | Mouse | DNA Binding | 209032 | B9EHM1 |
Zdhhc2 | zinc finger, DHHC domain containing 2 | Mouse | DNA Binding | 70546 | P59267 |
Zdhhc9 | zinc finger, DHHC domain containing 9 | Mouse | DNA Binding | 208884 | B1AVD4 |
Zer1 | zer-1 homolog (C. elegans) | Mouse | DNA Binding | 227693 | Q80ZJ6 |
Zfand6 | zinc finger, AN1-type domain 6 | Mouse | DNA Binding | 65098 | Q9DCH6 |
Zfhx4 | zinc finger homeodomain 4 | Mouse | DNA Binding | 80892 | Q9JJN2 |
Zfp238 | zinc finger protein 238 | Mouse | DNA Binding | 30928 | H7BX69 |
Zfp358 | zinc finger protein 358 | Mouse | DNA Binding | 140482 | E9Q8M1 |
Zfp369 | zinc finger protein 369 | Mouse | DNA Binding | 170936 | F8VQL6 |
Zfp36l2 | zinc finger protein 36, C3H type-like 2 | Mouse | DNA Binding | 12193 | B9EIF6 |
Zfp39 | zinc finger protein 39 | Mouse | DNA Binding | 22698 | Q02525 |
Zfp408 | zinc finger protein 408 | Mouse | DNA Binding | 381410 | Q3V1D8 |
Zfp64 | zinc finger protein 64 | Mouse | DNA Binding | 22722 | A2AQR4 |
Zfp688 | zinc finger protein 688 | Mouse | DNA Binding | 69234 | E9Q5M9 |
Zfp69 | zinc finger protein 69 | Mouse | DNA Binding | 381549 | A2A761 |
Zfp75 | zinc finger protein 317 | Mouse | DNA Binding | 244713 | Q0P5V5 |
Zfpm2 | zinc finger protein, multitype 2 | Mouse | DNA Binding | 22762 | Q8CCH7 |
Zhx2 | zinc fingers and homeoboxes 2 | Mouse | DNA Binding | 387609 | Q8C0C0 |
Zic5 | zinc finger protein of the cerebellum 5 | Mouse | DNA Binding | 65100 | Q7TQ40 |
Zim1 | zinc finger, imprinted 1 | Mouse | DNA Binding | 22776 | Q6NZC6 |
Zpbp | zona pellucida binding protein | Mouse | DNA Binding | 53604 | B7ZP49 |
Zranb1 | zinc finger, RAN-binding domain containing 1 | Mouse | DNA Binding | 360216 | Q7M760 |
Zrsr2 | zinc finger (CCCH type), RNA binding motif and serine/arginine rich 2 | Mouse | DNA Binding | 22184 | B1B0E8 |
Zscan30 | zinc finger and SCAN domain containing 30 | Mouse | DNA Binding | 328918 | N/A |