Human Gene Module / Chromosome 14 / BCL11B

BCL11BBCL11 transcription factor B

SFARI Gene Score
3
Suggestive Evidence Criteria 3.1
Autism Reports / Total Reports
5 / 13
Rare Variants / Common Variants
78 / 0
Aliases
-
Associated Syndromes
-
Chromosome Band
14q32.2
Associated Disorders
-
Relevance to Autism

Rare variants in the BCL11B gene are responsible for intellectual developmental disorder with dysmorphic facies, speech delay, and T-cell abnormalities (OMIM 618092), a neurodevelopmental disorder characterized by developmental delay, intellectual disability, behavioral abnormalities including autism spectrum disorder or autistic features, dysmorphic features, and immunological abnormalities (Lessel et al., 2018; Sabbagh et al., 2023). Additional rare de novo variants in the BCL11B gene, including a de novo loss-of-function variant and three de novo missense variants, have been reported in ASD probands (Satterstrom et al., 2020; Zhou et al., 2022).

Molecular Function

This gene encodes a C2H2-type zinc finger protein and is closely related to BCL11A, a gene whose translocation may be associated with B-cell malignancies. Although the specific function of this gene has not been determined, the encoded protein is known to be a transcriptional repressor, and is regulated by the NURD nucleosome remodeling and histone deacetylase complex.

SFARI Genomic Platforms
Reports related to BCL11B (13 Reports)
# Type Title Author, Year Autism Report Associated Disorders
1 Support - Davor Lessel et al. (2018) No Autistic features
2 Support Large-Scale Exome Sequencing Study Implicates Both Developmental and Functional Changes in the Neurobiology of Autism Satterstrom FK et al. (2020) Yes -
3 Support - Zhou X et al. (2022) Yes -
4 Primary - Quentin Sabbagh et al. (2024) No ASD, ADHD
5 Support - Omri Bar et al. (2024) Yes Learning disability
6 Support - Marketa Wayhelova et al. (2024) No -
7 Support - Artemis Koumoundourou et al. (2024) No -
8 Support - Axel Schmidt et al. (2024) No ASD
9 Recent Recommendation - Ivana Lessel et al. (2025) No ASD, ADHD, OCD, epilepsy/seizures
10 Support - J Heather Vedovato-Dos-Santos et al. () No Autistic features
11 Support - Congcong Chen et al. () Yes -
12 Support - Yawen Liu et al. (2026) No -
13 Support - Natividad Avila, Marina et al. (2026) Yes -
Rare Variants   (78)
Status Allele Change Residue Change Variant Type Inheritance Pattern Parental Transmission Family Type PubMed ID Author, Year
- - translocation De novo - - 29985992 Davor Lessel et al. (2018)
- - copy_number_loss De novo - - 37860968 Quentin Sabbagh et al. (2024)
- - translocation De novo - Simplex 29985992 Davor Lessel et al. (2018)
- - copy_number_loss Unknown - - 40033098 J Heather Vedovato-Dos-Santos et al. ()
c.428-11405C>T - intron_variant De novo - Simplex 40738258 Congcong Chen et al. ()
c.1495G>T p.Glu499Ter stop_gained De novo - - 29985992 Davor Lessel et al. (2018)
c.2472C>A p.Tyr824Ter stop_gained De novo - - 39039281 Axel Schmidt et al. (2024)
c.13A>C p.Lys5Gln missense_variant De novo - Simplex 35982159 Zhou X et al. (2022)
c.682C>T p.Gln228Ter stop_gained De novo - - 37860968 Quentin Sabbagh et al. (2024)
c.56C>G p.Thr19Ser missense_variant De novo - - 31981491 Satterstrom FK et al. (2020)
c.2421C>G p.Asn807Lys missense_variant De novo - - 29985992 Davor Lessel et al. (2018)
c.2421C>G p.Asn807Lys missense_variant De novo - - 39039281 Axel Schmidt et al. (2024)
c.2536C>G p.His846Asp missense_variant De novo - - 39798569 Ivana Lessel et al. (2025)
c.2631C>G p.His877Gln missense_variant De novo - Simplex 35982159 Zhou X et al. (2022)
c.2494dup p.Ala832GlyfsTer53 frameshift_variant De novo - - 35982159 Zhou X et al. (2022)
c.2174C>A p.Pro725His missense_variant De novo - - 37860968 Quentin Sabbagh et al. (2024)
c.2258C>G p.Ser753Cys missense_variant De novo - - 37860968 Quentin Sabbagh et al. (2024)
c.2476T>C p.Cys826Arg missense_variant De novo - - 37860968 Quentin Sabbagh et al. (2024)
c.2T>C p.Met1? initiator_codon_variant De novo - - 37860968 Quentin Sabbagh et al. (2024)
c.239del p.Cys80LeufsTer76 frameshift_variant De novo - - 29985992 Davor Lessel et al. (2018)
c.1407G>C p.Lys469Asn missense_variant De novo - Simplex 39798569 Ivana Lessel et al. (2025)
c.1407G>T p.Lys469Asn missense_variant De novo - Simplex 39798569 Ivana Lessel et al. (2025)
c.1414C>T p.Arg472Cys missense_variant De novo - Simplex 39798569 Ivana Lessel et al. (2025)
c.2421C>G p.Asn807Lys missense_variant De novo - Simplex 39798569 Ivana Lessel et al. (2025)
c.2507G>A p.Ser836Asn missense_variant De novo - Simplex 39798569 Ivana Lessel et al. (2025)
c.2513A>C p.Lys838Thr missense_variant De novo - Simplex 39798569 Ivana Lessel et al. (2025)
c.2513A>G p.Lys838Arg missense_variant De novo - Simplex 39798569 Ivana Lessel et al. (2025)
c.2519C>T p.Thr840Met missense_variant De novo - Simplex 39798569 Ivana Lessel et al. (2025)
c.2522G>T p.Arg841Leu missense_variant De novo - Simplex 39798569 Ivana Lessel et al. (2025)
c.2525A>C p.His842Pro missense_variant De novo - Simplex 39798569 Ivana Lessel et al. (2025)
c.2629C>T p.His877Tyr missense_variant De novo - Simplex 39798569 Ivana Lessel et al. (2025)
c.2473A>T p.Lys825Ter stop_gained Familial Maternal - 37860968 Quentin Sabbagh et al. (2024)
c.1742del p.Gly581AlafsTer24 frameshift_variant De novo - - 39039281 Axel Schmidt et al. (2024)
c.2192A>T p.Asp731Val missense_variant De novo - - 41912808 Natividad Avila, Marina et al. (2026)
c.183_189delTCAAATG p.Cys61Ter stop_gained De novo - Simplex 39798569 Ivana Lessel et al. (2025)
c.657del p.Ser220AlafsTer61 frameshift_variant De novo - - 37860968 Quentin Sabbagh et al. (2024)
c.1500dup p.Gly501ArgfsTer16 frameshift_variant De novo - - 37860968 Quentin Sabbagh et al. (2024)
c.1967del p.Gly656AlafsTer67 frameshift_variant De novo - - 37860968 Quentin Sabbagh et al. (2024)
c.2036C>T p.Pro679Leu missense_variant Familial Paternal Multiplex 38256266 Omri Bar et al. (2024)
c.784_820del p.Arg262TrpfsTer7 frameshift_variant De novo - - 37860968 Quentin Sabbagh et al. (2024)
c.2037del p.Leu681SerfsTer42 frameshift_variant De novo - - 38321498 Marketa Wayhelova et al. (2024)
c.600_606dup p.Glu203SerfsTer15 frameshift_variant Unknown - - 37860968 Quentin Sabbagh et al. (2024)
c.1499dup p.Thr501HisfsTer15 frameshift_variant De novo - Simplex 29985992 Davor Lessel et al. (2018)
c.1549del p.Arg517AlafsTer45 frameshift_variant De novo - Simplex 29985992 Davor Lessel et al. (2018)
c.2668del p.Ala890ProfsTer106 frameshift_variant De novo - Simplex 29985992 Davor Lessel et al. (2018)
c.1552delC p.Arg518AlafsTer45 frameshift_variant De novo - Simplex 39798569 Ivana Lessel et al. (2025)
c.1742delG p.Gly581AlafsTer24 frameshift_variant De novo - Simplex 39798569 Ivana Lessel et al. (2025)
c.1988delA p.Glu663GlyfsTer60 frameshift_variant De novo - Simplex 39798569 Ivana Lessel et al. (2025)
c.2348delG p.Gly783AlafsTer29 frameshift_variant De novo - Simplex 39798569 Ivana Lessel et al. (2025)
c.2448delG p.Ser817AlafsTer27 frameshift_variant De novo - Simplex 39798569 Ivana Lessel et al. (2025)
c.1887_1893del p.Gly630ThrfsTer91 frameshift_variant De novo - - 37860968 Quentin Sabbagh et al. (2024)
c.1944_1965del p.Gly649AlafsTer67 frameshift_variant De novo - - 37860968 Quentin Sabbagh et al. (2024)
c.1952_1964del p.Val651GlyfsTer68 frameshift_variant De novo - - 37860968 Quentin Sabbagh et al. (2024)
c.2616_2617del p.Met873GlufsTer11 frameshift_variant De novo - - 37860968 Quentin Sabbagh et al. (2024)
c.1176_1179dup p.Pro394GlufsTer124 frameshift_variant De novo - Simplex 41665692 Yawen Liu et al. (2026)
c.1597del p.Asp533ThrfsTer29 frameshift_variant Familial Maternal - 29985992 Davor Lessel et al. (2018)
c.2422T>C p.Cys808Arg missense_variant Familial Paternal Multiplex 39798569 Ivana Lessel et al. (2025)
c.2646_2649del p.Asn884ThrfsTer112 frameshift_variant De novo - - 37860968 Quentin Sabbagh et al. (2024)
c.1362_1364del p.Tyr454_Lys455delinsTer stop_gained De novo - Simplex 29985992 Davor Lessel et al. (2018)
c.1887_1893delCGGCGGG p.Gly630ThrfsTer91 frameshift_variant Unknown - - 39798569 Ivana Lessel et al. (2025)
c.1944_1965del p.Gly649AlafsTer67 frameshift_variant De novo - Simplex 29985992 Davor Lessel et al. (2018)
c.2446_2453dup p.Gly819AlafsTer27 frameshift_variant De novo - Simplex 29985992 Davor Lessel et al. (2018)
c.1216_1217insACGC p.Thr406AsnfsTer112 frameshift_variant De novo - - 37860968 Quentin Sabbagh et al. (2024)
c.1770_1771delGA p.Lys591GlyfsTer293 frameshift_variant De novo - Simplex 39798569 Ivana Lessel et al. (2025)
c.400_403dup p.Cys135TyrfsTer61 frameshift_variant De novo - - 40033098 J Heather Vedovato-Dos-Santos et al. ()
c.1474delC p.Leu492SerfsTer71 frameshift_variant Familial Maternal Simplex 39798569 Ivana Lessel et al. (2025)
c.2438_2459del p.Val813AlafsTer24 frameshift_variant De novo - - 40033098 J Heather Vedovato-Dos-Santos et al. ()
c.1887_1893delCGGCGGG p.Gly630ThrfsTer91 frameshift_variant De novo - Simplex 39798569 Ivana Lessel et al. (2025)
c.2119_2126delGTGTACTCinsA p.Val707SerfsTer14 frameshift_variant De novo - Simplex 39798569 Ivana Lessel et al. (2025)
c.600_606dup p.Glu203SerfsTer15 frameshift_variant Familial Maternal Multiplex 37860968 Quentin Sabbagh et al. (2024)
c.781_808dup p.Gly270AlafsTer256 frameshift_variant De novo - Simplex 40033098 J Heather Vedovato-Dos-Santos et al. ()
c.2439_2452dupGCACCGGCGGAGCC p.His818ArgfsTer31 frameshift_variant De novo - Simplex 39798569 Ivana Lessel et al. (2025)
c.2439_2452dupGGCTCCGCCGGTGC p.His818ArgfsTer31 frameshift_variant De novo - Simplex 39798569 Ivana Lessel et al. (2025)
c.2448_2461delGAGCCACACCGGCG p.Ser817AlafsTer63 frameshift_variant De novo - Simplex 39798569 Ivana Lessel et al. (2025)
c.2449_2462delGCACCGGCGGAGCC p.Ser817AlafsTer63 frameshift_variant De novo - Simplex 39798569 Ivana Lessel et al. (2025)
c.1944_1965delCGGCGCGGTCAACGGGCGCGGG p.Gly649AlafsTer67 frameshift_variant De novo - - 39798569 Ivana Lessel et al. (2025)
c.2499delC p.Cys833TrpfsTer11 frameshift_variant De novo (germline mosaicism) - Multiplex 39798569 Ivana Lessel et al. (2025)
c.1460_1485delGCTCCGACGACGGGCTCTCGGCCGCC p.Arg487GlnfsTer21 frameshift_variant De novo - Simplex 39798569 Ivana Lessel et al. (2025)
Common Variants  

No common variants reported.

SFARI Gene score
3

Suggestive Evidence

Score Delta: Score remained at 3

3

Suggestive Evidence

See all Category 3 Genes

The literature is replete with relatively small studies of candidate genes, using either common or rare variant approaches, which do not reach the criteria set out for categories 1 and 2. Genes that had two such lines of supporting evidence were placed in category 3, and those with one line of evidence were placed in category 4. Some additional lines of "accessory evidence" (indicated as "acc" in the score cards) could also boost a gene from category 4 to 3.

1/1/2024
icon
3

Increased from to 3

Krishnan Probability Score

Score 0.56827623938545

Ranking 1127/25841 scored genes


[Show Scoring Methodology]
Krishnan and colleagues generated probability scores genome-wide by using a machine learning approach on a human brain-specific gene network. The method was first presented in Nat Neurosci 19, 1454-1462 (2016), and scores for more than 25,000 RefSeq genes can be accessed in column G of supplementary table 3 (see: http://www.nature.com/neuro/journal/v19/n11/extref/nn.4353-S5.xlsx). A searchable browser, with the ability to view networks of associated ASD risk genes, can be found at asd.princeton.edu.
ExAC Score

Score 0.92978524186829

Ranking 2936/18225 scored genes


[Show Scoring Methodology]
The Exome Aggregation Consortium (ExAC) is a summary database of 60,706 exomes that has been widely used to estimate 'constraint' on mutation for individual genes. It was introduced by Lek et al. Nature 536, 285-291 (2016), and the ExAC browser can be found at exac.broadinstitute.org. The pLI score was developed as measure of intolerance to loss-of- function mutation. A pLI > 0.9 is generally viewed as highly constrained, and thus any loss-of- function mutations in autism in such a gene would be more likely to confer risk. For a full list of pLI scores see: ftp://ftp.broadinstitute.org/pub/ExAC_release/release0.3.1/functional_gene_constraint/fordist_cle aned_exac_nonTCGA_z_pli_rec_null_data.txt
Sanders TADA Score

Score 0.94544353911703

Ranking 16472/18665 scored genes


[Show Scoring Methodology]
The TADA score ('Transmission and De novo Association') was introduced by He et al. PLoS Genet 9(8):e1003671 (2013), and is a statistic that integrates evidence from both de novo and transmitted mutations. It forms the basis for the claim of 65 individual genes being strongly associated with autism risk at a false discovery rate of 0.1 (Sanders et al. Neuron 87, 1215-1233 (2015)). The calculated TADA score for 18,665 RefSeq genes can be found in column P of Supplementary Table 6 in the Sanders et al. paper (the column headed 'tadaFdrAscSscExomeSscAgpSmallDel'), which represents a combined analysis of exome data and small de novo deletions (see www.cell.com/cms/attachment/2038545319/2052606711/mmc7.xlsx).
Zhang D Score

Score 0.33580867583134

Ranking 2197/20870 scored genes


[Show Scoring Methodology]
The DAMAGES score (disease-associated mutation analysis using gene expression signatures), or D score, was developed to combine evidence from de novo loss-of- function mutation with evidence from cell-type- specific gene expression in the mouse brain (specifically translational profiles of 24 specific mouse CNS cell types isolated from 6 different brain regions). Genes with positive D scores are more likely to be associated with autism risk, with higher-confidence genes having higher D scores. This statistic was first presented by Zhang & Shen (Hum Mutat 38, 204- 215 (2017), and D scores for more than 20,000 RefSeq genes can be found in column M in supplementary table 2 from that paper.
Submit New Gene

Report an Error