BCL11BBCL11 transcription factor B
Autism Reports / Total Reports
4 / 12Rare Variants / Common Variants
77 / 0Aliases
-Associated Syndromes
-Chromosome Band
14q32.2Associated Disorders
-Relevance to Autism
Rare variants in the BCL11B gene are responsible for intellectual developmental disorder with dysmorphic facies, speech delay, and T-cell abnormalities (OMIM 618092), a neurodevelopmental disorder characterized by developmental delay, intellectual disability, behavioral abnormalities including autism spectrum disorder or autistic features, dysmorphic features, and immunological abnormalities (Lessel et al., 2018; Sabbagh et al., 2023). Additional rare de novo variants in the BCL11B gene, including a de novo loss-of-function variant and three de novo missense variants, have been reported in ASD probands (Satterstrom et al., 2020; Zhou et al., 2022).
Molecular Function
This gene encodes a C2H2-type zinc finger protein and is closely related to BCL11A, a gene whose translocation may be associated with B-cell malignancies. Although the specific function of this gene has not been determined, the encoded protein is known to be a transcriptional repressor, and is regulated by the NURD nucleosome remodeling and histone deacetylase complex.
External Links
SFARI Genomic Platforms
Reports related to BCL11B (12 Reports)
| # | Type | Title | Author, Year | Autism Report | Associated Disorders |
|---|---|---|---|---|---|
| 1 | Support | - | Davor Lessel et al. (2018) | No | Autistic features |
| 2 | Support | Large-Scale Exome Sequencing Study Implicates Both Developmental and Functional Changes in the Neurobiology of Autism | Satterstrom FK et al. (2020) | Yes | - |
| 3 | Support | - | Zhou X et al. (2022) | Yes | - |
| 4 | Primary | - | Quentin Sabbagh et al. (2024) | No | ASD, ADHD |
| 5 | Support | - | Omri Bar et al. (2024) | Yes | Learning disability |
| 6 | Support | - | Marketa Wayhelova et al. (2024) | No | - |
| 7 | Support | - | Artemis Koumoundourou et al. (2024) | No | - |
| 8 | Support | - | Axel Schmidt et al. (2024) | No | ASD |
| 9 | Recent Recommendation | - | Ivana Lessel et al. (2025) | No | ASD, ADHD, OCD, epilepsy/seizures |
| 10 | Support | - | J Heather Vedovato-Dos-Santos et al. () | No | Autistic features |
| 11 | Support | - | Congcong Chen et al. () | Yes | - |
| 12 | Support | - | Yawen Liu et al. (2026) | No | - |
Rare Variants (77)
| Status | Allele Change | Residue Change | Variant Type | Inheritance Pattern | Parental Transmission | Family Type | PubMed ID | Author, Year |
|---|---|---|---|---|---|---|---|---|
| - | - | translocation | De novo | - | - | 29985992 | Davor Lessel et al. (2018) | |
| - | - | copy_number_loss | De novo | - | - | 37860968 | Quentin Sabbagh et al. (2024) | |
| - | - | translocation | De novo | - | Simplex | 29985992 | Davor Lessel et al. (2018) | |
| - | - | copy_number_loss | Unknown | - | - | 40033098 | J Heather Vedovato-Dos-Santos et al. () | |
| c.428-11405C>T | - | intron_variant | De novo | - | Simplex | 40738258 | Congcong Chen et al. () | |
| c.1495G>T | p.Glu499Ter | stop_gained | De novo | - | - | 29985992 | Davor Lessel et al. (2018) | |
| c.2472C>A | p.Tyr824Ter | stop_gained | De novo | - | - | 39039281 | Axel Schmidt et al. (2024) | |
| c.13A>C | p.Lys5Gln | missense_variant | De novo | - | Simplex | 35982159 | Zhou X et al. (2022) | |
| c.682C>T | p.Gln228Ter | stop_gained | De novo | - | - | 37860968 | Quentin Sabbagh et al. (2024) | |
| c.56C>G | p.Thr19Ser | missense_variant | De novo | - | - | 31981491 | Satterstrom FK et al. (2020) | |
| c.2421C>G | p.Asn807Lys | missense_variant | De novo | - | - | 29985992 | Davor Lessel et al. (2018) | |
| c.2421C>G | p.Asn807Lys | missense_variant | De novo | - | - | 39039281 | Axel Schmidt et al. (2024) | |
| c.2536C>G | p.His846Asp | missense_variant | De novo | - | - | 39798569 | Ivana Lessel et al. (2025) | |
| c.2631C>G | p.His877Gln | missense_variant | De novo | - | Simplex | 35982159 | Zhou X et al. (2022) | |
| c.2494dup | p.Ala832GlyfsTer53 | frameshift_variant | De novo | - | - | 35982159 | Zhou X et al. (2022) | |
| c.2174C>A | p.Pro725His | missense_variant | De novo | - | - | 37860968 | Quentin Sabbagh et al. (2024) | |
| c.2258C>G | p.Ser753Cys | missense_variant | De novo | - | - | 37860968 | Quentin Sabbagh et al. (2024) | |
| c.2476T>C | p.Cys826Arg | missense_variant | De novo | - | - | 37860968 | Quentin Sabbagh et al. (2024) | |
| c.2T>C | p.Met1? | initiator_codon_variant | De novo | - | - | 37860968 | Quentin Sabbagh et al. (2024) | |
| c.239del | p.Cys80LeufsTer76 | frameshift_variant | De novo | - | - | 29985992 | Davor Lessel et al. (2018) | |
| c.1407G>C | p.Lys469Asn | missense_variant | De novo | - | Simplex | 39798569 | Ivana Lessel et al. (2025) | |
| c.1407G>T | p.Lys469Asn | missense_variant | De novo | - | Simplex | 39798569 | Ivana Lessel et al. (2025) | |
| c.1414C>T | p.Arg472Cys | missense_variant | De novo | - | Simplex | 39798569 | Ivana Lessel et al. (2025) | |
| c.2421C>G | p.Asn807Lys | missense_variant | De novo | - | Simplex | 39798569 | Ivana Lessel et al. (2025) | |
| c.2507G>A | p.Ser836Asn | missense_variant | De novo | - | Simplex | 39798569 | Ivana Lessel et al. (2025) | |
| c.2513A>C | p.Lys838Thr | missense_variant | De novo | - | Simplex | 39798569 | Ivana Lessel et al. (2025) | |
| c.2513A>G | p.Lys838Arg | missense_variant | De novo | - | Simplex | 39798569 | Ivana Lessel et al. (2025) | |
| c.2519C>T | p.Thr840Met | missense_variant | De novo | - | Simplex | 39798569 | Ivana Lessel et al. (2025) | |
| c.2522G>T | p.Arg841Leu | missense_variant | De novo | - | Simplex | 39798569 | Ivana Lessel et al. (2025) | |
| c.2525A>C | p.His842Pro | missense_variant | De novo | - | Simplex | 39798569 | Ivana Lessel et al. (2025) | |
| c.2629C>T | p.His877Tyr | missense_variant | De novo | - | Simplex | 39798569 | Ivana Lessel et al. (2025) | |
| c.2473A>T | p.Lys825Ter | stop_gained | Familial | Maternal | - | 37860968 | Quentin Sabbagh et al. (2024) | |
| c.1742del | p.Gly581AlafsTer24 | frameshift_variant | De novo | - | - | 39039281 | Axel Schmidt et al. (2024) | |
| c.183_189delTCAAATG | p.Cys61Ter | stop_gained | De novo | - | Simplex | 39798569 | Ivana Lessel et al. (2025) | |
| c.657del | p.Ser220AlafsTer61 | frameshift_variant | De novo | - | - | 37860968 | Quentin Sabbagh et al. (2024) | |
| c.1500dup | p.Gly501ArgfsTer16 | frameshift_variant | De novo | - | - | 37860968 | Quentin Sabbagh et al. (2024) | |
| c.1967del | p.Gly656AlafsTer67 | frameshift_variant | De novo | - | - | 37860968 | Quentin Sabbagh et al. (2024) | |
| c.2036C>T | p.Pro679Leu | missense_variant | Familial | Paternal | Multiplex | 38256266 | Omri Bar et al. (2024) | |
| c.784_820del | p.Arg262TrpfsTer7 | frameshift_variant | De novo | - | - | 37860968 | Quentin Sabbagh et al. (2024) | |
| c.2037del | p.Leu681SerfsTer42 | frameshift_variant | De novo | - | - | 38321498 | Marketa Wayhelova et al. (2024) | |
| c.600_606dup | p.Glu203SerfsTer15 | frameshift_variant | Unknown | - | - | 37860968 | Quentin Sabbagh et al. (2024) | |
| c.1499dup | p.Thr501HisfsTer15 | frameshift_variant | De novo | - | Simplex | 29985992 | Davor Lessel et al. (2018) | |
| c.1549del | p.Arg517AlafsTer45 | frameshift_variant | De novo | - | Simplex | 29985992 | Davor Lessel et al. (2018) | |
| c.2668del | p.Ala890ProfsTer106 | frameshift_variant | De novo | - | Simplex | 29985992 | Davor Lessel et al. (2018) | |
| c.1552delC | p.Arg518AlafsTer45 | frameshift_variant | De novo | - | Simplex | 39798569 | Ivana Lessel et al. (2025) | |
| c.1742delG | p.Gly581AlafsTer24 | frameshift_variant | De novo | - | Simplex | 39798569 | Ivana Lessel et al. (2025) | |
| c.1988delA | p.Glu663GlyfsTer60 | frameshift_variant | De novo | - | Simplex | 39798569 | Ivana Lessel et al. (2025) | |
| c.2348delG | p.Gly783AlafsTer29 | frameshift_variant | De novo | - | Simplex | 39798569 | Ivana Lessel et al. (2025) | |
| c.2448delG | p.Ser817AlafsTer27 | frameshift_variant | De novo | - | Simplex | 39798569 | Ivana Lessel et al. (2025) | |
| c.1887_1893del | p.Gly630ThrfsTer91 | frameshift_variant | De novo | - | - | 37860968 | Quentin Sabbagh et al. (2024) | |
| c.1944_1965del | p.Gly649AlafsTer67 | frameshift_variant | De novo | - | - | 37860968 | Quentin Sabbagh et al. (2024) | |
| c.1952_1964del | p.Val651GlyfsTer68 | frameshift_variant | De novo | - | - | 37860968 | Quentin Sabbagh et al. (2024) | |
| c.2616_2617del | p.Met873GlufsTer11 | frameshift_variant | De novo | - | - | 37860968 | Quentin Sabbagh et al. (2024) | |
| c.1176_1179dup | p.Pro394GlufsTer124 | frameshift_variant | De novo | - | Simplex | 41665692 | Yawen Liu et al. (2026) | |
| c.1597del | p.Asp533ThrfsTer29 | frameshift_variant | Familial | Maternal | - | 29985992 | Davor Lessel et al. (2018) | |
| c.2422T>C | p.Cys808Arg | missense_variant | Familial | Paternal | Multiplex | 39798569 | Ivana Lessel et al. (2025) | |
| c.2646_2649del | p.Asn884ThrfsTer112 | frameshift_variant | De novo | - | - | 37860968 | Quentin Sabbagh et al. (2024) | |
| c.1362_1364del | p.Tyr454_Lys455delinsTer | stop_gained | De novo | - | Simplex | 29985992 | Davor Lessel et al. (2018) | |
| c.1887_1893delCGGCGGG | p.Gly630ThrfsTer91 | frameshift_variant | Unknown | - | - | 39798569 | Ivana Lessel et al. (2025) | |
| c.1944_1965del | p.Gly649AlafsTer67 | frameshift_variant | De novo | - | Simplex | 29985992 | Davor Lessel et al. (2018) | |
| c.2446_2453dup | p.Gly819AlafsTer27 | frameshift_variant | De novo | - | Simplex | 29985992 | Davor Lessel et al. (2018) | |
| c.1216_1217insACGC | p.Thr406AsnfsTer112 | frameshift_variant | De novo | - | - | 37860968 | Quentin Sabbagh et al. (2024) | |
| c.1770_1771delGA | p.Lys591GlyfsTer293 | frameshift_variant | De novo | - | Simplex | 39798569 | Ivana Lessel et al. (2025) | |
| c.400_403dup | p.Cys135TyrfsTer61 | frameshift_variant | De novo | - | - | 40033098 | J Heather Vedovato-Dos-Santos et al. () | |
| c.1474delC | p.Leu492SerfsTer71 | frameshift_variant | Familial | Maternal | Simplex | 39798569 | Ivana Lessel et al. (2025) | |
| c.2438_2459del | p.Val813AlafsTer24 | frameshift_variant | De novo | - | - | 40033098 | J Heather Vedovato-Dos-Santos et al. () | |
| c.1887_1893delCGGCGGG | p.Gly630ThrfsTer91 | frameshift_variant | De novo | - | Simplex | 39798569 | Ivana Lessel et al. (2025) | |
| c.2119_2126delGTGTACTCinsA | p.Val707SerfsTer14 | frameshift_variant | De novo | - | Simplex | 39798569 | Ivana Lessel et al. (2025) | |
| c.600_606dup | p.Glu203SerfsTer15 | frameshift_variant | Familial | Maternal | Multiplex | 37860968 | Quentin Sabbagh et al. (2024) | |
| c.781_808dup | p.Gly270AlafsTer256 | frameshift_variant | De novo | - | Simplex | 40033098 | J Heather Vedovato-Dos-Santos et al. () | |
| c.2439_2452dupGCACCGGCGGAGCC | p.His818ArgfsTer31 | frameshift_variant | De novo | - | Simplex | 39798569 | Ivana Lessel et al. (2025) | |
| c.2439_2452dupGGCTCCGCCGGTGC | p.His818ArgfsTer31 | frameshift_variant | De novo | - | Simplex | 39798569 | Ivana Lessel et al. (2025) | |
| c.2448_2461delGAGCCACACCGGCG | p.Ser817AlafsTer63 | frameshift_variant | De novo | - | Simplex | 39798569 | Ivana Lessel et al. (2025) | |
| c.2449_2462delGCACCGGCGGAGCC | p.Ser817AlafsTer63 | frameshift_variant | De novo | - | Simplex | 39798569 | Ivana Lessel et al. (2025) | |
| c.1944_1965delCGGCGCGGTCAACGGGCGCGGG | p.Gly649AlafsTer67 | frameshift_variant | De novo | - | - | 39798569 | Ivana Lessel et al. (2025) | |
| c.2499delC | p.Cys833TrpfsTer11 | frameshift_variant | De novo (germline mosaicism) | - | Multiplex | 39798569 | Ivana Lessel et al. (2025) | |
| c.1460_1485delGCTCCGACGACGGGCTCTCGGCCGCC | p.Arg487GlnfsTer21 | frameshift_variant | De novo | - | Simplex | 39798569 | Ivana Lessel et al. (2025) |
Common Variants
No common variants reported.
SFARI Gene score
Suggestive Evidence

Score Delta: Score remained at 3
criteria met
See SFARI Gene'scoring criteriaThe literature is replete with relatively small studies of candidate genes, using either common or rare variant approaches, which do not reach the criteria set out for categories 1 and 2. Genes that had two such lines of supporting evidence were placed in category 3, and those with one line of evidence were placed in category 4. Some additional lines of "accessory evidence" (indicated as "acc" in the score cards) could also boost a gene from category 4 to 3.
1/1/2024

Increased from to 3
Krishnan Probability Score
Score 0.56827623938545
Ranking 1127/25841 scored genes
[Show Scoring Methodology]
ExAC Score
Score 0.92978524186829
Ranking 2936/18225 scored genes
[Show Scoring Methodology]
Sanders TADA Score
Score 0.94544353911703
Ranking 16472/18665 scored genes
[Show Scoring Methodology]
Zhang D Score
Score 0.33580867583134
Ranking 2197/20870 scored genes
[Show Scoring Methodology]