Human Gene Module / Chromosome 14 / CHD8

CHD8chromodomain helicase DNA binding protein 8

High Confidence, Syndromic Criteria 1.1, Syndromic
Autism Reports / Total Reports
15 / 22
Rare Variants / Common Variants
67 / 0
Associated Syndromes
Genetic Category
Rare Single Gene Mutation
Chromosome Band
Associated Disorders
Relevance to Autism

Rare mutations in the CHD8 gene have been identified in individuals with ASD (O’Roak et al., 2012). A balanced chromosomal abnormality (BCA) that disrupted the CHD8 gene was also recently identified in an ASD case (Talkowski et al., 2012).

Molecular Function

This gene encodes a DNA helicase that functions as a transcription repressor by remodeling chromatin structure. It binds beta-catenin and negatively regulates Wnt signaling pathway, which plays a pivotal role in vertebrate early development and morphogenesis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Reports related to CHD8 (22 Reports)
# Type Title Author, Year Autism Report Associated Disorders
1 Support CHD8 interacts with CHD7, a protein which is mutated in CHARGE syndrome. Batsukh T , et al. (2010) No -
2 Primary Sporadic autism exomes reveal a highly interconnected protein network of de novo mutations. O'Roak BJ , et al. (2012) Yes -
3 Support Sequencing chromosomal abnormalities reveals neurodevelopmental loci that confer risk across diagnostic boundaries. Talkowski ME , et al. (2012) Yes -
4 Support Multiplex targeted sequencing identifies recurrently mutated genes in autism spectrum disorders. O'Roak BJ , et al. (2012) Yes -
5 Support De novo mutations in schizophrenia implicate chromatin remodeling and support a genetic overlap with autism and intellectual disability. McCarthy SE , et al. (2014) No -
6 Recent recommendation Disruptive CHD8 mutations define a subtype of autism early in development. Bernier R , et al. (2014) Yes DD, ID
7 Support Recurrent 100 Kb microdeletion in the chromosomal region 14q11.2, involving CHD8 gene, is associated with autism and macrocephaly. Prontera P , et al. (2014) Yes -
8 Recent recommendation CHD8 regulates neurodevelopmental pathways associated with autism spectrum disorder in neural progenitors. Sugathan A , et al. (2014) No -
9 Recent recommendation Synaptic, transcriptional and chromatin genes disrupted in autism. De Rubeis S , et al. (2014) Yes -
10 Support The contribution of de novo coding mutations to autism spectrum disorder. Iossifov I , et al. (2014) Yes -
11 Support Large-scale discovery of novel genetic causes of developmental disorders. Deciphering Developmental Disorders Study (2014) Yes -
12 Recent recommendation The autism-associated chromatin modifier CHD8 regulates other autism risk genes during human neurodevelopment. Cotney J , et al. (2015) No -
13 Recent recommendation The autism-associated gene chromodomain helicase DNA-binding protein 8 (CHD8) regulates noncoding RNAs and autism-related genes. Wilkinson B , et al. (2015) No -
14 Recent recommendation Low load for disruptive mutations in autism genes and their biased transmission. Iossifov I , et al. (2015) Yes -
15 Support Targeted DNA Sequencing from Autism Spectrum Disorder Brains Implicates Multiple Genetic Mechanisms. D'Gama AM , et al. (2015) Yes -
16 Support A de novo frameshift mutation in chromodomain helicase DNA-binding domain 8 (CHD8): A case report and literature review. Merner N , et al. (2016) Yes ID, SCZ
17 Support Novel 14q11.2 microduplication including the CHD8 and SUPT16H genes associated with developmental delay. Smyk M , et al. (2016) No -
18 Support CHD8 intragenic deletion associated with autism spectrum disorder. Stolerman ES , et al. (2016) Yes -
19 Recent recommendation Chd8 mediates cortical neurogenesis via transcriptional regulation of cell cycle and Wnt signaling. Durak O , et al. (2016) No -
20 Support De novo genic mutations among a Chinese autism spectrum disorder cohort. Wang T , et al. (2016) Yes -
21 Support The genomic landscape of balanced cytogenetic abnormalities associated with human congenital anomalies. Redin C , et al. (2016) Yes -
22 Support Targeted sequencing identifies 91 neurodevelopmental-disorder risk genes with autism and developmental-disability biases. Stessman HA , et al. (2017) Yes -
Rare Variants   (67)
Status Allele Change Residue Change Variant Type Inheritance Pattern Parental Transmission Family Type Author, Year
delCT p.Leu2120ProfsTer13 frameshift_variant De novo - Simplex O'Roak BJ , et al. (2012)
c.2875C>T p.Gln959Ter stop_gained De novo - Simplex O'Roak BJ , et al. (2012)
- - translocation De novo - - Talkowski ME , et al. (2012)
c.7493_7495delACC p.His2498del inframe_deletion De novo - Simplex O'Roak BJ , et al. (2012)
c.7112dupA p.Asn2371LysfsTer2 frameshift_variant De novo - Simplex O'Roak BJ , et al. (2012)
c.6308_6311del p.Glu2103ArgfsTer3 frameshift_variant De novo - Simplex O'Roak BJ , et al. (2012)
c.4009C>T p.Arg1337Ter stop_gained De novo - Simplex O'Roak BJ , et al. (2012)
c.3519-2A>G - splice_site_variant De novo - Simplex O'Roak BJ , et al. (2012)
ins(T) p.Tyr747Ter frameshift_variant De novo - Simplex O'Roak BJ , et al. (2012)
c.185C>G p.Ser62Ter stop_gained De novo - Simplex O'Roak BJ , et al. (2012)
C>A p.Ser2173Ter stop_gained De novo - Simplex McCarthy SE , et al. (2014)
- p.Val984Ter frameshift_variant Familial Maternal Possible multi-generational Bernier R , et al. (2014)
c.3340G>T p.Glu1114Ter stop_gained De novo - - Bernier R , et al. (2014)
- p.Glu1932SerfsTer3 frameshift_variant De novo - - Bernier R , et al. (2014)
- p.Glu2136ArgfsTer6 frameshift_variant De novo - - Bernier R , et al. (2014)
- p.Lys2287del inframe_deletion Unknown - - Bernier R , et al. (2014)
c.2729G>A p.Arg910Gln missense_variant Unknown - Unknown Bernier R , et al. (2014)
c.5129G>T p.Gly1710Val missense_variant Familial Maternal - Bernier R , et al. (2014)
- p.Arg1797Gln missense_variant Familial Paternal Possible multi-generational Bernier R , et al. (2014)
- - copy_number_gain Familial Paternal Possible multiplex Bernier R , et al. (2014)
- - copy_number_gain Unknown - Unknown Bernier R , et al. (2014)
- - copy_number_gain Unknown - Unknown Bernier R , et al. (2014)
- - copy_number_loss De novo - - Prontera P , et al. (2014)
c.3725G>A p.Arg1242Gln missense_variant De novo - Simplex De Rubeis S , et al. (2014)
c.2501T>C p.Leu834Pro missense_variant De novo - Simplex De Rubeis S , et al. (2014)
c.3532C>T p.Arg1178Cys missense_variant Familial Paternal Simplex De Rubeis S , et al. (2014)
c.4073T>G p.Phe1358Cys missense_variant Familial Maternal Simplex De Rubeis S , et al. (2014)
c.639G>C p.Arg213Pro missense_variant Familial Maternal Simplex De Rubeis S , et al. (2014)
c.4826G>A p.Arg1609His missense_variant Familial Paternal Simplex De Rubeis S , et al. (2014)
del(T) - frameshift_variant Unknown - Unknown De Rubeis S , et al. (2014)
c.5051+2T>A - splice_site_variant De novo - Simplex De Rubeis S , et al. (2014)
c.4818-2A>C - splice_site_variant De novo - Simplex De Rubeis S , et al. (2014)
c.5393G>A p.Trp1798Ter stop_gained Unknown - Unknown De Rubeis S , et al. (2014)
c.5096G>A p.Arg1699His missense_variant Unknown - Unknown De Rubeis S , et al. (2014)
c.3214C>T p.Leu1072Phe missense_variant Unknown - Unknown De Rubeis S , et al. (2014)
c.4825C>T p.Arg1609Cys missense_variant Unknown - Unknown De Rubeis S , et al. (2014)
c.4843C>T p.Arg1615Cys missense_variant Unknown - Unknown De Rubeis S , et al. (2014)
c.1733G>A p.Arg578His missense_variant Unknown - Unknown De Rubeis S , et al. (2014)
c.494C>T p.Pro165Leu missense_variant Unknown - Unknown De Rubeis S , et al. (2014)
c.410G>T p.Gly137Val missense_variant Unknown - Unknown De Rubeis S , et al. (2014)
del(CTCTTGCACGTCCCATCACAGTAGCAAGGAGTACTCACTTGAGCTT - splice_site_variant De novo - Simplex Iossifov I , et al. (2014)
c.1188A>C p.Gln397Pro missense_variant Familial Paternal Multi-generational Deciphering Developmental Disorders Study (2014)
c.2230G>A p.Val744Ile missense_variant Unknown - Unknown D'Gama AM , et al. (2015)
c.6276dup p.Asn2092LysfsTer2 frameshift_variant De novo - Simplex Merner N , et al. (2016)
c.19C>T p.Arg7Cys missense_variant Familial Paternal - Merner N , et al. (2016)
c.3974T>C p.Ile1325Thr missense_variant Familial Maternal - Merner N , et al. (2016)
c.5248G>A p.Glu1750Lys missense_variant Unknown - - Merner N , et al. (2016)
c.5635C>T p.Arg1879Cys missense_variant Familial Maternal - Merner N , et al. (2016)
c.5701C>T p.Arg1901Cys missense_variant Unknown - - Merner N , et al. (2016)
c.5993G>C p.Gly1998Ala missense_variant Unknown - - Merner N , et al. (2016)
c.6104G>A p.Arg2035Gln missense_variant Familial Maternal Multiplex Merner N , et al. (2016)
G>C p.(=) synonymous_variant Familial Paternal - Merner N , et al. (2016)
c.3915A>G p.(=) synonymous_variant Familial Maternal - Merner N , et al. (2016)
A>G p.(=) synonymous_variant Familial Maternal - Merner N , et al. (2016)
c.5475G>A p.(=) synonymous_variant Familial Paternal - Merner N , et al. (2016)
C>T p.(=) synonymous_variant Familial Paternal - Merner N , et al. (2016)
C>T p.(=) synonymous_variant Unknown - - Merner N , et al. (2016)
- - copy_number_gain De novo - Simplex Smyk M , et al. (2016)
- - copy_number_loss De novo - Multiplex Stolerman ES , et al. (2016)
c.5688dup p.Arg1897ThrfsTer23 frameshift_variant De novo - - Wang T , et al. (2016)
c.3704del p.Asn1235MetfsTer18 frameshift_variant De novo - - Wang T , et al. (2016)
c.2250del p.Lys750AsnfsTer14 frameshift_variant De novo - - Wang T , et al. (2016)
c.5288A>G p.Glu1763Gly missense_variant Familial Paternal - Wang T , et al. (2016)
- - translocation De novo - - Redin C , et al. (2016)
c.4799_4800delTAinsT p.Gly1602ValfsTer13 frameshift_variant De novo - - Stessman HA , et al. (2017)
c.1096C>T p.Gln366Ter stop_gained De novo - - Stessman HA , et al. (2017)
c.3316_3322delGAAAAAAinsGAAAAAAA p.Ile1108AsnfsTer7 frameshift_variant De novo - - Stessman HA , et al. (2017)
Common Variants  

No common variants reported.

SFARI Gene score

High Confidence, Syndromic

PMID 22495309 showed 2 de novo loss-of-function (LoF) mutations in CHD8 among 209 simplex ASD families. In a screen of 44 genes in 2,446 ASD probands from the Simons Simplex Collection, PMID 23160955 found 6 additional de novo CHD8 LoF mutations. A ninth de novo LoF variant in CHD8 in an ASD proband from the Simons Simplex Collection was observed in PMID 25363768. Additional LoF variants in CHD8 were identified in children with developmental delay and ASD in PMID 24998929. PMID 22521361 showed that CHD8 is among 33 loci with balanced chromosomal abnormalities in individuals with ASD or other neurodevelopmental disorders. Analysis of rare coding variation in 3,871 ASD cases and 9,937 ancestry-matched or paternal controls from the Autism Sequencing Consortium (ASC) identified CHD8 as a gene meeting high statistical significance with a FDR ?0.01, meaning that this gene had a ?99% chance of being a true autism gene (PMID 25363760). A phenotypic comparison of patients with CHD8 variants in PMID 24998929 identified recurrent dysmorphic facial features suggestive of a syndromic form of ASD. This gene was identified in Iossifov et al. 2015 as a strong candidate to be an ASD risk gene based on a combination of de novo mutational evidence and the absence or very low frequency of mutations in controls (PMID 26401017).


High Confidence

See all Category 1 Genes

We considered a rigorous statistical comparison between cases and controls, yielding genome-wide statistical significance, with independent replication, to be the strongest possible evidence for a gene. These criteria were relaxed slightly for category 2.

The syndromic category includes mutations that are associated with a substantial degree of increased risk and consistently linked to additional characteristics not required for an ASD diagnosis. If there is independent evidence implicating a gene in idiopathic ASD, it will be listed as "#S" (e.g., 2S, 3S, etc.). If there is no such independent evidence, the gene will be listed simply as "S."


Initial score established: 1S


PMID 22495309 showed 2 de novo loss-of-function (LoF) mutations in CHD8 among 209 simplex ASD families. In a screen of 44 genes in 2,446 ASD probands from the Simons Simplex Collection, PMID 23160955 found 6 additional de novo CHD8 LoF mutations. A ninth de novo LoF variant in CHD8 in an ASD proband from the Simons Simplex Collection was observed in PMID 25363768. Additional LoF variants in CHD8 were identified in children with developmental delay and ASD in PMID 24998929. PMID 22521361 showed that CHD8 is among 33 loci with balanced chromosomal abnormalities in individuals with ASD or other neurodevelopmental disorders. Analysis of rare coding variation in 3,871 ASD cases and 9,937 ancestry-matched or paternal controls from the Autism Sequencing Consortium (ASC) identified CHD8 as a gene meeting high statistical significance with a FDR ?0.01, meaning that this gene had a ?99% chance of being a true autism gene (PMID 25363760). A phenotypic comparison of patients with CHD8 variants in PMID 24998929 identified recurrent dysmorphic facial features suggestive of a syndromic form of ASD. This gene was identified in Iossifov et al. 2015 as a strong candidate to be an ASD risk gene based on a combination of de novo mutational evidence and the absence or very low frequency of mutations in controls (PMID 26401017).

Reports Added
Interaction Table
Interactor Symbol Interactor Name Interactor Organism Interactor Type Entrez ID Uniprot ID
41703 membrane-associated ring finger (C3HC4) 5 Human DNA Binding NM_017824 Q9NX47
41704 membrane-associated ring finger (C3HC4) 6, E3 ubiquitin protein ligase Human DNA Binding NM_005885 O60337
41707 membrane-associated ring finger (C3HC4) 9 Human DNA Binding NM_138396 Q86YJ5
41884 septin 2 Human DNA Binding NM_004404 Q15019
41886 septin 4 Human DNA Binding NM_004574 O43236
41889 membrane-associated ring finger (C3HC4) 7, E3 ubiquitin protein ligase Human DNA Binding NM_022826 B7ZAR7
41893 15 kDa selenoprotein Human DNA Binding NM_004261 O60613
AAK1 AP2 associated kinase 1 Human DNA Binding 22848 Q2M2I8
AAMDC Mth938 domain-containing protein Human DNA Binding 28971 Q9H7C9
AASDH aminoadipate-semialdehyde dehydrogenase Human DNA Binding 132949 Q4L235
ABCA17P ATP-binding cassette, sub-family A (ABC1), member 17, pseudogene Human DNA Binding 650655 NA
ABCA3 Human DNA Binding
ABCC5 ATP-binding cassette, sub-family C (CFTR/MRP), member 5 Human DNA Binding 10057 O15440
ABCD3 ATP-binding cassette, sub-family D (ALD), member 3 Human DNA Binding 5825 P28288
ABCE1 ATP-binding cassette, sub-family E (OABP), member 1 Human DNA Binding 6059 P61221
ABHD10 abhydrolase domain containing 10 Human DNA Binding 55347 Q9NUJ1
ABHD14A abhydrolase domain containing 14A Human DNA Binding NM_015407 Q9BUJ0
ABHD3 abhydrolase domain containing 3 Human DNA Binding NM_138340 Q8WU67
ABL1 c-abl oncogene 1, non-receptor tyrosine kinase Human DNA Binding 25 P00519
ABT1 activator of basal transcription 1 Human DNA Binding 29777 Q9ULW3
ABTB2 ankyrin repeat and BTB (POZ) domain containing 2 Human DNA Binding 25841 Q8N961
ACACA acetyl-CoA carboxylase alpha Human DNA Binding 31 Q13085
ACADM acyl-CoA dehydrogenase, C-4 to C-12 straight chain Human DNA Binding 34 P11310
ACADSB Short/branched chain specific acyl-CoA dehydrogenase, mitochondrial Human DNA Binding 36 P45954
ACAT1 acetyl-CoA acetyltransferase 1 Human DNA Binding 38 P24752
ACBD5 acyl-CoA binding domain containing 5 Human DNA Binding 91452 Q5T8D3
ACBD6 acyl-CoA binding domain containing 6 Human DNA Binding 84320 B2RAA8
ACIN1 apoptotic chromatin condensation inducer 1 Human DNA Binding 22985 Q9UKV3
ACO1 aconitase 1, soluble Human DNA Binding 48 P21399
ACO2 aconitase 2, mitochondrial Human DNA Binding 50 Q99798
ACOX3 acyl-CoA oxidase 3, pristanoyl Human DNA Binding NM_003501 O15254
ACP1 acid phosphatase 1, soluble Human DNA Binding 52 B5MCC7
ACP2 acid phosphatase 2, lysosomal Human DNA Binding 53 P11117
ACPL2 2-phosphoxylose phosphatase 1 Human DNA Binding 92370 Q8TE99
ACSL3 acyl-CoA synthetase long-chain family member 3 Human DNA Binding 2181 B3KMA6
ACTL6A actin-like 6A Human DNA Binding 86 O96019
ACTR2 ARP2 actin-related protein 2 homolog (yeast) Human DNA Binding 10097 E9PF41
ACTR6 ARP6 actin-related protein 6 homolog (yeast) Human DNA Binding NM_022496 Q9GZN1
ACVR1B activin A receptor, type IB Human DNA Binding 91 P36896
ACVR2A activin A receptor, type IIA Human DNA Binding 92 P27037
ACYP1 acylphosphatase 1, erythrocyte (common) type Human DNA Binding NM_001107 P07311
ACYP2 Acylphosphatase-2 Human DNA Binding 98 P14621
ADAL adenosine deaminase-like Human DNA Binding 161823 Q6DHV7
ADAM17 ADAM metallopeptidase domain 17 Human DNA Binding 6868 B2RNB2
ADAM8 ADAM metallopeptidase domain 8 Human DNA Binding NM_001109 P78325
ADAM9 ADAM metallopeptidase domain 9 Human DNA Binding 8754 Q13443
ADAMTS10 A disintegrin and metalloproteinase with thrombospondin motifs 10 Human DNA Binding 81794 Q9H324
ADAR adenosine deaminase, RNA-specific Human DNA Binding 103 P55265
ADAT2 adenosine deaminase, tRNA-specific 2 Human DNA Binding 134637 Q7Z6V5
ADCK4 aarF domain containing kinase 4 Human DNA Binding 79934 Q96D53
ADCY5 Adenylate cyclase type 5 Human DNA Binding 111 O95622
ADD1 adducin 1 (alpha) Human DNA Binding 118 P35611
ADK adenosine kinase Human DNA Binding 132 P55263
ADM adrenomedullin Human DNA Binding NM_001124 P35318
ADO 2-aminoethanethiol (cysteamine) dioxygenase Human DNA Binding 84890 B3KXN9
ADRM1 adhesion regulating molecule 1 Human DNA Binding 11047 Q16186
ADSL adenylosuccinate lyase Human DNA Binding 158 P30566
ADSS adenylosuccinate synthase Human DNA Binding 159 P30520
AEBP2 AE binding protein 2 Human DNA Binding 121536 Q6ZN18
AFTPH aftiphilin Human DNA Binding 54812 Q6ULP2
AGA aspartylglucosaminidase Human DNA Binding NM_000027 P20933
AGAP3 ArfGAP with GTPase domain, ankyrin repeat and PH domain 3 Human DNA Binding NM_001042535 Q86ST5
AGK acylglycerol kinase Human DNA Binding 55750 A4D1U5
AGO2 argonaute RISC catalytic component 2 Human DNA Binding 27161 A4FVC0
AGPAT1 1-acylglycerol-3-phosphate O-acyltransferase 1 Human DNA Binding 10554 Q99943
AGPAT3 1-acylglycerol-3-phosphate O-acyltransferase 3 Human DNA Binding 56894 Q9NRZ7
AGPAT6 1-acylglycerol-3-phosphate O-acyltransferase 6 Human DNA Binding 137964 Q2TU73
AHCYL2 adenosylhomocysteinase-like 2 Human DNA Binding 23382 Q96HN2
AHSA1 AHA1, activator of heat shock 90kDa protein ATPase homolog 1 (yeast) Human DNA Binding 10598 O95433
AK3 adenylate kinase 3 Human DNA Binding 50808 Q7Z4Y4
AKAP4 A kinase (PRKA) anchor protein 4 Human DNA Binding 8852 Q5JQC9
AKAP8 A kinase (PRKA) anchor protein 8 Human DNA Binding 10270 O43823
AKAP8L A kinase (PRKA) anchor protein 8-like Human DNA Binding 26993 Q9ULX6
AKIRIN1 akirin 1 Human DNA Binding 79647 Q9H9L7
AKIRIN2 akirin 2 Human DNA Binding 55122 Q53H80
AKT1S1 AKT1 substrate 1 (proline-rich) Human DNA Binding 84335 Q96B36
AKT2 v-akt murine thymoma viral oncogene homolog 2 Human DNA Binding 208 B4DG79
ALG10B ALG10B, alpha-1,2-glucosyltransferase Human DNA Binding 144245 Q5I7T1
ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit Human DNA Binding NM_144988 Q96F25
ALG5 ALG5, dolichyl-phosphate beta-glucosyltransferase Human DNA Binding 29880 Q9Y673
ALG9 ALG9, alpha-1,2-mannosyltransferase Human DNA Binding 79796 Q9H6U8
ALKBH5 alkB, alkylation repair homolog 5 (E. coli) Human DNA Binding 54890 Q6P6C2
ALKBH8 alkB, alkylation repair homolog 8 (E. coli) Human DNA Binding 91801 Q96BT7
ALMS1 Alstrom syndrome 1 Human DNA Binding 7840 Q8TCU4
ALOXE3 Hydroperoxide isomerase ALOXE3 Human DNA Binding 59344 Q9BYJ1
ALS2 amyotrophic lateral sclerosis 2 (juvenile) Human DNA Binding NM_001135745 Q96Q42
AMBRA1 autophagy/beclin-1 regulator 1 Human DNA Binding 55626 Q9C0C7
AMHR2 anti-Mullerian hormone receptor, type II Human DNA Binding 269 Q16671
AMMECR1L AMMECR1-like Human DNA Binding 83607 Q6DCA0
AMOTL2 CDH10 Human DNA Binding 51421 Q9Y2J4
ANAPC10 anaphase promoting complex subunit 10 Human DNA Binding 10393 Q9UM13
ANAPC13 anaphase promoting complex subunit 13 Human DNA Binding 25847 A8K3Z6
ANAPC5 anaphase promoting complex subunit 5 Human DNA Binding 51433 Q9UJX4
ANAPC7 anaphase promoting complex subunit 7 Human DNA Binding 51434 Q9UJX3
ANGEL2 angel homolog 2 (Drosophila) Human DNA Binding 90806 Q5VTE6
ANKH ankylosis, progressive homolog (mouse) Human DNA Binding 56172 Q9HCJ1
ANKLE2 Ankyrin repeat and LEM domain-containing protein 2 Human DNA Binding 23141 Q86XL3
ANKRD13A ankyrin repeat domain 13A Human DNA Binding 88455 Q3ZTS7
ANKRD13C ankyrin repeat domain 13C Human DNA Binding 81573 Q8N6S4
ANKRD16 ankyrin repeat domain 16 Human DNA Binding 54522 Q6P6B7
ANKRD32 ankyrin repeat domain 32 Human DNA Binding 84250 I6L9F1
ANKRD34A ankyrin repeat domain 34A Human DNA Binding NM_001039888 Q69YU3
ANKRD40 ankyrin repeat domain 40 Human DNA Binding 91369 A8IK34
ANKRD42 ankyrin repeat domain 42 Human DNA Binding NM_182603 Q8N9B4
ANKRD50 ankyrin repeat domain 50 Human DNA Binding 57182 Q8TB46
ANKRD52 Human DNA Binding
ANLN anillin, actin binding protein Human DNA Binding 54443 Q9NQW6
ANO8 anoctamin 8 Human DNA Binding 57719 Q9HCE9
ANP32B acidic (leucine-rich) nuclear phosphoprotein 32 family, member B Human DNA Binding 10541 Q92688
ANXA2 annexin A2 Human DNA Binding 302 P07355
AP1G1 adaptor-related protein complex 1, gamma 1 subunit Human DNA Binding 164 O43747
AP1M1 adaptor-related protein complex 1, mu 1 subunit Human DNA Binding 8907 Q59EK3
AP1S3 adaptor-related protein complex 1, sigma 3 subunit Human DNA Binding 130340 Q96PC3
AP2A2 adaptor-related protein complex 2, alpha 2 subunit Human DNA Binding 161 O94973
AP4E1 adaptor-related protein complex 4, epsilon 1 subunit Human DNA Binding 23431 B4DM48
AP4M1 adaptor-related protein complex 4, mu 1 subunit Human DNA Binding 9179 O00189
AP4S1 adaptor-related protein complex 4, sigma 1 subunit Human DNA Binding 11154 Q9Y587
AP5B1 AP-5 complex subunit beta-1 Human DNA Binding 91056 Q2VPB7
AP5M1 AP-5 complex subunit mu-1 Human DNA Binding 55745 Q9H0R1
AP5S1 AP-5 complex subunit sigma-1 Human DNA Binding 55317 Q9NUS5
APEH N-acylaminoacyl-peptide hydrolase Human DNA Binding 327 P13798
APEX1 APEX nuclease (multifunctional DNA repair enzyme) 1 Human DNA Binding 328 P27695
API5 apoptosis inhibitor 5 Human DNA Binding 8539 Q9BZZ5
APIP APAF1 interacting protein Human DNA Binding 51074 Q96GX9
APITD1 Centromere protein S Human DNA Binding 1325 Q8N2Z9
APITD1-CORT Centromere protein S Human DNA Binding 100526739 Q8N2Z9
APLP1 amyloid beta (A4) precursor-like protein 1 Human DNA Binding 333 P51693
APLP2 amyloid beta (A4) precursor-like protein 2 Human DNA Binding 334 Q06481
APOLD1 apolipoprotein L domain containing 1 Human DNA Binding 81575 Q96LR9
APOO apolipoprotein O Human DNA Binding NM_024122 Q9BUR5
APOPT1 Apoptogenic protein 1, mitochondrial Human DNA Binding 84334 Q96IL0
APPBP2 amyloid beta precursor protein (cytoplasmic tail) binding protein 2 Human DNA Binding 10513 Q92624
APPL1 adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1 Human DNA Binding 26060 Q9UKG1
APTX aprataxin Human DNA Binding 54840 Q7Z2E3
AR androgen receptor Human Protein Binding 367 P10275
ARF4 ADP-ribosylation factor 4 Human DNA Binding 378 P18085
ARF6 ADP-ribosylation factor 6 Human DNA Binding 382 P62330
ARFGAP1 ADP-ribosylation factor GTPase activating protein 1 Human DNA Binding 55738 Q8N6T3
ARFGAP2 ADP-ribosylation factor GTPase activating protein 2 Human DNA Binding 84364 B4DX29
ARFGEF1 Human DNA Binding
ARFRP1 ADP-ribosylation factor related protein 1 Human DNA Binding NM_003224 Q13795
ARHGAP11B Rho GTPase activating protein 11B Human DNA Binding NM_001039841 Q3KRB8
ARHGAP21 Rho GTPase activating protein 21 Human DNA Binding 57584 Q5T5U3
ARHGAP33 Rho GTPase-activating protein 33 Human DNA Binding 115703 O14559
ARHGDIA Rho GDP dissociation inhibitor (GDI) alpha Human DNA Binding 396 P52565
ARHGEF11 Rho guanine nucleotide exchange factor (GEF) 11 Human DNA Binding 9826 O15085
ARHGEF12 Rho guanine nucleotide exchange factor (GEF) 12 Human DNA Binding 23365 B4E2K6
ARHGEF7 Human DNA Binding
ARID1B AT rich interactive domain 1B (SWI1-like) Human DNA Binding 57492 Q8NFD5
ARID3A AT rich interactive domain 3A (BRIGHT-like) Human DNA Binding 1820 Q99856
ARID4A AT rich interactive domain 4A (RBP1-like) Human DNA Binding 5926 P29374
ARIH1 ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 (Drosophila) Human DNA Binding 25820 Q9Y4X5
ARL13B ADP-ribosylation factor-like 13B Human DNA Binding 200894 Q3SXY8
ARL17P1 ADP-ribosylation factor-like 17A Human DNA Binding NM_001113738 A8K0M5
ARL2BP ADP-ribosylation factor-like 2 binding protein Human DNA Binding 23568 Q9Y2Y0
ARL3 ADP-ribosylation factor-like 3 Human DNA Binding NM_004311 P36405
ARL4A ADP-ribosylation factor-like 4A Human DNA Binding NM_001037164 A0A024R9Z2
ARL5A ADP-ribosylation factor-like 5A Human DNA Binding 26225 Q9Y689
ARL5B ADP-ribosylation factor-like 5B Human DNA Binding 221079 B0YIW9
ARL6 ADP-ribosylation factor-like 6 Human DNA Binding NM_177976 Q9H0F7
ARL6IP6 ADP-ribosylation-like factor 6 interacting protein 6 Human DNA Binding 151188 B3KMZ5
ARL8A ADP-ribosylation factor-like 8A Human DNA Binding 127829 Q96BM9
ARMC1 armadillo repeat containing 1 Human DNA Binding 55156 Q9NVT9
ARMC5 armadillo repeat containing 5 Human DNA Binding 79798 Q96C12
ARMC6 armadillo repeat containing 6 Human DNA Binding 93436 Q6NXE6
ARMCX5 armadillo repeat containing, X-linked 5 Human DNA Binding NM_022838 Q6P1M9
ARPC4 actin related protein 2/3 complex, subunit 4, 20kDa Human DNA Binding 10093 F6TTL5
ARPC4-TTLL3 Protein ARPC4-TTLL3 Human DNA Binding 100526693 A0A0A6YYG9
ARPC5 actin related protein 2/3 complex, subunit 5, 16kDa Human DNA Binding 10092 O15511
ARPP19 cAMP-regulated phosphoprotein, 19kDa Human DNA Binding 10776 P56211
ARRDC3-AS1 ARRDC3 antisense RNA 1 Human DNA Binding 100129716 NA
ARSB arylsulfatase B Human DNA Binding 411 P15848
ARSK arylsulfatase family, member K Human DNA Binding NM_198150 Q6UWY0
ARV1 ARV1 homolog (S. cerevisiae) Human DNA Binding 64801 Q9H2C2
ASB6 ankyrin repeat and SOCS box containing 6 Human DNA Binding 140459 Q9NWX5
ASB7 ankyrin repeat and SOCS box containing 7 Human DNA Binding 140460 Q9H672
ASCC3 activating signal cointegrator 1 complex subunit 3 Human DNA Binding 10973 Q8N3C0
ASF1A Histone chaperone ASF1A Human DNA Binding 25842 Q9Y294
ASF1B ASF1 anti-silencing function 1 homolog B (S. cerevisiae) Human DNA Binding 55723 Q9NVP2
ASH1L ash1 (absent, small, or homeotic)-like (Drosophila) Human DNA Binding 55870 Q9NR48
ASH1L-AS1 ASH1L antisense RNA 1 Human DNA Binding 645676 NA
ASH2L ash2 (absent, small, or homeotic)-like (Drosophila) Human Protein Binding 9070 Q9UBL3
ASNA1 arsA arsenite transporter, ATP-binding, homolog 1 (bacterial) Human DNA Binding NM_004317 O43681
ASPSCR1 alveolar soft part sarcoma chromosome region, candidate 1 Human DNA Binding 79058 Q9BZE9
ASXL1 additional sex combs like 1 (Drosophila) Human DNA Binding 171023 Q498B9
ATAD2B ATPase family, AAA domain containing 2B Human DNA Binding 54454 Q9ULI0
ATAD3A ATPase family, AAA domain containing 3A Human DNA Binding 55210 Q9NVI7
ATAD5 ATPase family, AAA domain containing 5 Human DNA Binding 79915 Q96QE3
ATE1 arginyltransferase 1 Human DNA Binding 11101 O95260
ATF6 activating transcription factor 6 Human DNA Binding 22926 A8K383
ATF7 activating transcription factor 7 Human DNA Binding NM_006856 P17544
ATF7IP activating transcription factor 7 interacting protein Human DNA Binding 55729 Q6VMQ6
ATG16L1 autophagy related 16-like 1 (S. cerevisiae) Human DNA Binding 55054 Q53SV2
ATG16L2 autophagy related 16-like 2 (S. cerevisiae) Human DNA Binding NM_033388 Q8NAA4
ATG3 Ubiquitin-like-conjugating enzyme ATG3 Human DNA Binding 64422 Q9NT62
ATL1 Atlastin-1 Human DNA Binding 51062 Q8WXF7
ATL3 atlastin GTPase 3 Human DNA Binding 25923 Q6DD88
ATN1 atrophin 1 Human DNA Binding 1822 P54259
ATP10D CYFIP1 Human DNA Binding 57205 Q9P241
ATP11A ATPase, class VI, type 11A Human DNA Binding 23250 P98196
ATP11B ATPase, class VI, type 11B Human DNA Binding 23200 B4DKX1
ATP1B1 Human DNA Binding
ATP2A1 ATPase, Ca++ transporting, cardiac muscle, fast twitch 1 Human DNA Binding 487 O14983
ATP5E ATP synthase, H+ transporting, mitochondrial F1 complex, epsilon subunit Human DNA Binding NM_006886 P56381
ATP5F1 ATP synthase, H+ transporting, mitochondrial Fo complex, subunit B1 Human DNA Binding 515 P24539
ATP5G1 ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C1 (subunit 9) Human DNA Binding 516 P05496
ATP5G2 ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C2 (subunit 9) Human DNA Binding 517 Q06055
ATP5I ATP synthase, H+ transporting, mitochondrial Fo complex, subunit E Human DNA Binding 521 P56385
ATP6V0C ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c Human DNA Binding 527 P27449
ATP6V0D1 ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d1 Human DNA Binding NM_004691 P61421
ATP6V1A ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A Human DNA Binding 523 P38606
ATP6V1G1 ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G1 Human DNA Binding 9550 O75348
ATP6V1G2 ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G2 Human DNA Binding 534 Q2L6F8
ATP6V1G2-DDX39B ATP6V1G2-DDX39B readthrough (NMD candidate) Human DNA Binding 100532737 NA
ATRAID All-trans retinoic acid-induced differentiation factor Human DNA Binding 51374 Q6UW56
ATRN attractin Human DNA Binding 8455 B4DZ36
ATXN10 ataxin 10 Human DNA Binding 25814 Q9UBB4
ATXN2 ataxin 2 Human DNA Binding 6311 Q99700
ATXN2L ataxin 2-like Human DNA Binding 11273 Q8WWM7
ATXN3 ataxin 3 Human DNA Binding 4287 E9PB63
ATXN7 ataxin 7 Human DNA Binding 6314 O15265
ATXN7L2 ataxin 7-like 2 Human DNA Binding 127002 Q5T6C5
AUP1 ancient ubiquitous protein 1 Human DNA Binding 550 Q9Y679
AVEN Cell death regulator Aven Human DNA Binding 57099 Q9NQS1
AVL9 AVL9 homolog (S. cerevisiase) Human DNA Binding 23080 Q8NBF6
B2M beta-2-microglobulin Human DNA Binding 567 P61769
B3GALNT2 beta-1,3-N-acetylgalactosaminyltransferase 2 Human DNA Binding 148789 Q8NCR0
B4GALNT1 Beta-1,4 N-acetylgalactosaminyltransferase 1 Human DNA Binding 2583 Q00973
B4GALT5 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5 Human DNA Binding 9334 O43286
B4GALT6 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 6 Human DNA Binding 9331 Q9UBX8
B4GALT7 DNM1L Human DNA Binding 11285 Q9UBV7
B9D1 B9 protein domain 1 Human DNA Binding NM_015681 B4DN64
BACH2 BTB and CNC homology 1, basic leucine zipper transcription factor 2 Human DNA Binding 60468 Q9BYV9
BAD Bcl2-associated agonist of cell death Human DNA Binding 572 Q92934
BAG2 BCL2-associated athanogene 2 Human DNA Binding 9532 O95816
BAG5 BCL2-associated athanogene 5 Human DNA Binding 9529 Q9UL15
BAHCC1 DPP6 Human DNA Binding 57597 Q9P281
BANF1 barrier to autointegration factor 1 Human DNA Binding 8815 O75531
BANP BTG3 associated nuclear protein Human DNA Binding 54971 B3KM38
BAT1 DEAD (Asp-Glu-Ala-Asp) box polypeptide 39B Human DNA Binding NM_080598 A0A024RCM3
BAT2 proline-rich coiled-coil 2A Human DNA Binding 7916 P48634
BAT2L proline-rich coiled-coil 2B Human DNA Binding NM_013318 Q5JSZ5
BAT3 BCL2-associated athanogene 6 Human DNA Binding 7917 P46379
BAT4 G patch domain and ankyrin repeats 1 Human DNA Binding NM_033177 A0A024RCU2
BAT5 DUSP22 Human DNA Binding 7920 B3KNX9
BAZ1B bromodomain adjacent to zinc finger domain, 1B Human DNA Binding 9031 Q9UIG0
BBS10 Bardet-Biedl syndrome 10 Human DNA Binding 79738 Q8TAM1
BBS4 Bardet-Biedl syndrome 4 Human DNA Binding 585 Q96RK4
BBS5 Bardet-Biedl syndrome 5 Human DNA Binding 129880 Q8N3I7
BBX bobby sox homolog (Drosophila) Human DNA Binding 56987 A8K6U2
BCAR1 breast cancer anti-estrogen resistance 1 Human DNA Binding 9564 B4DEV4
BCAS2 breast carcinoma amplified sequence 2 Human DNA Binding 10286 B2R7W3
BCAS4 breast carcinoma amplified sequence 4 Human DNA Binding NM_017843 H7BXG3
BCAT1 branched chain amino-acid transaminase 1, cytosolic Human DNA Binding 586 P54687
BCL2 B-cell CLL/lymphoma 2 Human DNA Binding 596 P10415
BCL2L1 BCL2-like 1 Human DNA Binding 598 Q07817
BCL2L12 BCL2-like 12 (proline rich) Human DNA Binding 83596 Q9HB09
BCL2L13 BCL2-like 13 (apoptosis facilitator) Human DNA Binding 23786 Q9BXK5
BCL9 B-cell CLL/lymphoma 9 Human DNA Binding 607 O00512
BCR breakpoint cluster region Human DNA Binding 613 P11274
BEND3 BEN domain containing 3 Human DNA Binding 57673 Q5T5X7
BFAR bifunctional apoptosis regulator Human DNA Binding 51283 Q9NZS9
BHLHE41 basic helix-loop-helix family, member e41 Human DNA Binding 79365 Q8TAT1
BICD2 bicaudal D homolog 2 (Drosophila) Human DNA Binding 23299 Q8TD16
BIRC6 baculoviral IAP repeat containing 6 Human DNA Binding 57448 Q9NR09
BLMH bleomycin hydrolase Human DNA Binding 642 Q13867
BLOC1S6 biogenesis of lysosomal organelles complex-1, subunit 6, pallidin Human DNA Binding 26258 B3KY40
BLZF1 basic leucine zipper nuclear factor 1 Human DNA Binding 8548 Q9H2G9
BMPR1A bone morphogenetic protein receptor, type IA Human DNA Binding 657 P36894
BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) Human DNA Binding 659 Q13873
BMS1 BMS1 homolog, ribosome assembly protein (yeast) Human DNA Binding 9790 Q14692
BMS1P4 BMS1 pseudogene 4 Human DNA Binding NR_026592
BMS1P5 BMS1 pseudogene 5 Human DNA Binding NR_003611
BNC2 basonuclin 2 Human DNA Binding 54796 Q6ZN30
BNIP1 BCL2/adenovirus E1B 19kDa interacting protein 1 Human DNA Binding NM_013980 Q12981
BNIP2 BCL2/adenovirus E1B 19kDa interacting protein 2 Human DNA Binding 663 J3KN59
BNIP3L BCL2/adenovirus E1B 19kDa interacting protein 3-like Human DNA Binding 665 O60238
BOD1 biorientation of chromosomes in cell division 1 Human DNA Binding 91272 Q96IK1
BOD1L biorientation of chromosomes in cell division 1-like 1 Human DNA Binding 259282 Q8NFC6
BOLA3 bolA homolog 3 (E. coli) Human DNA Binding 388962 Q53S33
BOLA3-AS1 BOLA3 antisense RNA 1 (head to head) Human DNA Binding 100507171 NA
BPGM 2,3-bisphosphoglycerate mutase Human DNA Binding 669 P07738
BPNT1 3'(2'), 5'-bisphosphate nucleotidase 1 Human DNA Binding NM_006085 O95861
BPTF bromodomain PHD finger transcription factor Human DNA Binding 2186 Q12830
BRAF Serine/threonine-protein kinase B-raf Human DNA Binding 673 P15056
BRD8 bromodomain containing 8 Human DNA Binding 10902 Q9H0E9
BRD9 Bromodomain-containing protein 9 Human DNA Binding 65980 Q9H8M2
BRF2 BRF2, subunit of RNA polymerase III transcription initiation factor, BRF1-like Human DNA Binding 55290 Q9HAW0
BRIX1 BRX1, biogenesis of ribosomes, homolog (S. cerevisiae) Human DNA Binding 55299 Q8TDN6
BRWD1-AS1 BRWD1 antisense RNA 1 Human DNA Binding 100874093 NA
BRWD1-IT2 Human DNA Binding 103091865 NA
BSCL2 Berardinelli-Seip congenital lipodystrophy 2 (seipin) Human DNA Binding NM_001130702 A0A024R540
BTAF1 BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa (Mot1 homolog, S. cerevisiae) Human DNA Binding 9044 O14981
BTBD1 BTB (POZ) domain containing 1 Human DNA Binding 53339 Q9H0C5
BTBD2 BTB (POZ) domain containing 2 Human DNA Binding 55643 Q9BX70
BTF3 basic transcription factor 3 Human DNA Binding 689 P20290
BTF3L4 basic transcription factor 3-like 4 Human DNA Binding 91408 Q96K17
BTG3 BTG family, member 3 Human DNA Binding 10950 Q14201
BUD13 BUD13 homolog (S. cerevisiae) Human DNA Binding 84811 Q9BRD0
BZW1 basic leucine zipper and W2 domains 1 Human DNA Binding 9689 Q3LIC9
C10orf104 anaphase promoting complex subunit 16 Human DNA Binding NM_173473 C5H3H2
C10orf114 cancer susceptibility candidate 10 Human DNA Binding NM_001010911 Q5T4H9
C10orf119 minichromosome maintenance complex binding protein Human DNA Binding NM_024834 Q9BTE3
C10orf137 chromosome 10 open reading frame 137 Human DNA Binding 26098 Q3B7T1
C10orf140 chromosome 10 open reading frame 140 Human DNA Binding 387640 Q1XH10
C10orf2 chromosome 10 open reading frame 2 Human DNA Binding 56652 Q96RR1
C10ORF25 Uncharacterized protein C10orf25 Human DNA Binding 220979 Q5T742
C10orf28 R3H domain and coiled-coil containing 1-like Human DNA Binding 27291 D3DR60
C10orf4 fragile site, folic acid type, rare, fra(10)(q23.3) or fra(10)(q24.2) candidate 1 Human DNA Binding NM_145246 Q70Z53
C10orf57 transmembrane protein 254 Human DNA Binding NM_025125 B4DU43
C10orf78 SWI5-dependent recombination repair 1 Human DNA Binding NM_145247 Q86XK3
C11orf10 transmembrane protein 258 Human DNA Binding NM_014206 P61165
C11orf46 ADP-ribosylation factor-like 14 effector protein Human DNA Binding 120534 Q8N8R7
C11orf48 chromosome 11 open reading frame 48 Human DNA Binding 79081 Q9BQE6
C11orf58 chromosome 11 open reading frame 58 Human DNA Binding 10944 O00193
C11orf59 late endosomal/lysosomal adaptor, MAPK and MTOR activator 1 Human DNA Binding NM_017907 Q6IAA8
C11ORF68 UPF0696 protein C11orf68 Human DNA Binding 83638 Q9H3H3
C11orf82 chromosome 11 open reading frame 82 Human DNA Binding 220042 Q8IXT1
C11ORF84 chromosome 11 open reading frame 84 Human DNA Binding 144097 Q9BUA3
C11ORF95 Uncharacterized protein C11orf95 Human DNA Binding 65998 C9JLR9
C12orf10 chromosome 12 open reading frame 10 Human DNA Binding 60314 Q86UA3
C12ORF23 chromosome 12 open reading frame 23 Human DNA Binding 90488 Q8WUH6
C12orf30 N(alpha)-acetyltransferase 25, NatB auxiliary subunit Human DNA Binding NM_024953 Q14CX7
C12ORF52 chromosome 12 open reading frame 52 Human DNA Binding 84934 Q96K30
C12orf57 chromosome 12 open reading frame 57 Human DNA Binding 113246 Q99622
C12ORF60 Uncharacterized protein C12orf60 Human DNA Binding 144608 Q5U649
C12ORF61 Putative uncharacterized protein encoded by LINC01465 Human DNA Binding 283416 Q8N7H1
C12orf65 chromosome 12 open reading frame 65 Human DNA Binding 91574 Q9H3J6
C12orf72 methyltransferase like 20 Human DNA Binding NM_173802 Q8IXQ9
C13orf23 proline and serine rich 1 Human DNA Binding NM_025138 Q86XN7
C14orf101 transmembrane protein 260 Human DNA Binding NM_017799 B3KN73
C14orf106 MIS18 binding protein 1 Human DNA Binding NM_018353 Q6P0N0
C14orf119 chromosome 14 open reading frame 119 Human DNA Binding NM_017924 Q9NWQ9
C14orf135 chromosome 14 open reading frame 135 Human DNA Binding 64430 Q63HM2
C14orf178 chromosome 14 open reading frame 178 Human DNA Binding NM_174943 F8WAD5
C14orf181 Human DNA Binding NM_207442
C14orf33 KTN1 antisense RNA 1 Human DNA Binding NR_027123 Q86SY8
C14ORF80 chromosome 14 open reading frame 80 Human DNA Binding 283643 E9PAQ4
C14orf93 chromosome 14 open reading frame 93 Human DNA Binding NM_001130706 Q9H972
C15orf23 kinetochore-localized astrin/SPAG5 binding protein Human DNA Binding 90417 Q9Y448
C15orf33 family with sequence similarity 227, member B Human DNA Binding NM_152647 Q96M60
C16orf45 chromosome 16 open reading frame 45 Human DNA Binding NM_033201 Q96MC5
C16orf58 chromosome 16 open reading frame 58 Human DNA Binding 64755 Q96GQ5
C16orf61 C-x(9)-C motif containing 2 Human DNA Binding NM_020188 Q9NRP2
C16orf62 chromosome 16 open reading frame 62 Human DNA Binding 57020 E7EWW0
C16orf7 VPS9 domain containing 1 Human DNA Binding NM_004913 Q9Y2B5
C16orf72 chromosome 16 open reading frame 72 Human DNA Binding 29035 Q14CZ0
C16orf80 chromosome 16 open reading frame 80 Human DNA Binding 29105 Q9Y6A4
C16ORF87 chromosome 16 open reading frame 87 Human DNA Binding 388272 Q6PH81
C16orf88 chromosome 16 open reading frame 88 Human DNA Binding 400506 Q1ED39
C17orf59 chromosome 17 open reading frame 59 Human DNA Binding NM_017622 Q96GS4
C17orf70 chromosome 17 open reading frame 70 Human DNA Binding 80233 A4ZI32
C17ORF75 chromosome 17 open reading frame 75 Human DNA Binding 64149 Q9HAS0
C18orf25 chromosome 18 open reading frame 25 Human DNA Binding 147339 Q96B23
C18orf54 chromosome 18 open reading frame 54 Human DNA Binding 162681 I7GY12
C18orf55 translocase of inner mitochondrial membrane 21 homolog (yeast) Human DNA Binding 29090 A8K1K8
C19orf12 chromosome 19 open reading frame 12 Human DNA Binding 83636 Q9NSK7
C19orf2 URI1, prefoldin-like chaperone Human DNA Binding 8725 O94763
C19orf39 SWIM-type zinc finger 7 associated protein 1 Human DNA Binding NM_175871 Q6NVH7
C19ORF43 chromosome 19 open reading frame 43 Human DNA Binding 79002 Q9BQ61
C19orf48 chromosome 19 open reading frame 48 Human DNA Binding 84798 Q6RUI8
C19orf54 chromosome 19 open reading frame 54 Human DNA Binding 284325 Q5BKX5
C19orf55 chromosome 19 open reading frame 55 Human DNA Binding 148137 Q2NL68
C19ORF60 Uncharacterized protein C19orf60 Human DNA Binding 55049 Q96EN9
C19orf61 SMG9 nonsense mediated mRNA decay factor Human DNA Binding NM_019108 A0A024R0Q0
C19orf62 BRISC and BRCA1 A complex member 1 Human DNA Binding NM_014173 A0A024R7L2
C19orf76 adrenomedullin 5 (putative) Human DNA Binding NM_001101340 C9JUS6
C1D C1D nuclear receptor corepressor Human DNA Binding 10438 Q13901
C1orf107 digestive organ expansion factor homolog (zebrafish) Human DNA Binding NM_014388 Q68CQ4
C1orf109 chromosome 1 open reading frame 109 Human DNA Binding 54955 Q9NX04
C1orf112 chromosome 1 open reading frame 112 Human DNA Binding 55732 Q9NSG2
C1ORF122 chromosome 1 open reading frame 122 Human DNA Binding 127687 E9PQ13
C1orf151 mitochondrial inner membrane organizing system 1 Human DNA Binding NM_001032363 Q5TGZ0
C1orf156 methyltransferase like 18 Human DNA Binding NM_033418 A0A024R8Y7
C1ORF174 chromosome 1 open reading frame 174 Human DNA Binding 339448 Q8IYL3
C1orf182 TSSK6 activating co-chaperone Human DNA Binding NM_144627 Q96A04
C1ORF198 chromosome 1 open reading frame 198 Human DNA Binding 84886 B3KTW1
C1ORF21 chromosome 1 open reading frame 21 Human DNA Binding 81563 Q9H246
C1orf213 chromosome 1 open reading frame 213 Human DNA Binding 148898 Q8NC38
C1orf231 coiled-coil domain containing 163, pseudogene Human DNA Binding NM_001102601
C1orf27 chromosome 1 open reading frame 27 Human DNA Binding 54953 Q5SWX8
C1ORF35 chromosome 1 open reading frame 35 Human DNA Binding 79169 Q9BU76
C1orf43 chromosome 1 open reading frame 43 Human DNA Binding 25912 Q9BWL3
C1orf52 chromosome 1 open reading frame 52 Human DNA Binding 148423 Q8N6N3
C1orf55 SDE2 telomere maintenance homolog (S. pombe) Human DNA Binding NM_152608 Q6IQ49
C1orf71 consortin, connexin sorting protein Human DNA Binding NM_001139459 Q6PJW8
C1orf83 transcription elongation factor A (SII) N-terminal and central domain containing 2 Human DNA Binding NM_153035 Q96MN5
C1orf9 SUN domain containing ossification factor Human DNA Binding 51430 Q9UBS9
C1orf96 centriole, cilia and spindle-associated protein Human DNA Binding 126731 Q6IQ19
C1orf97 long intergenic non-protein coding RNA 467 Human DNA Binding NR_026761 Q9BRT7
C20ORF112 chromosome 20 open reading frame 112 Human DNA Binding 140688 Q6P0R2
C20ORF196 chromosome 20 open reading frame 196 Human DNA Binding 149840 Q8IYI0
C20orf199 ZNFX1 antisense RNA 1 Human DNA Binding NR_003604
C20orf24 chromosome 20 open reading frame 24 Human DNA Binding 55969 Q9BUV8
C20orf29 adaptor-related protein complex 5, sigma 1 subunit Human DNA Binding 55317 Q9NUS5
C20orf3 adipocyte plasma membrane associated protein Human DNA Binding 57136 Q9HDC9
C20orf30 transmembrane protein 230 Human DNA Binding NM_014145 Q96A57
C20orf4 AAR2 splicing factor homolog (S. cerevisiae) Human DNA Binding 25980 Q9Y312
C20orf72 mitochondrial genome maintenance exonuclease 1 Human DNA Binding 92667 Q9BQP7
C20orf94 SLX4 interacting protein Human DNA Binding 128710 Q5VYV7
C21orf2 chromosome 21 open reading frame 2 Human DNA Binding NM_004928 O43822
C21orf34 mir-99a-let-7c cluster host gene (non-protein coding) Human DNA Binding NR_027790 A1L4M7
C21orf45 MIS18 kinetochore protein A Human DNA Binding NM_018944 Q9NYP9
C21ORF49 Putative uncharacterized protein C21orf62-AS1 Human DNA Binding 54067 Q17RA5
C21orf57 ybeY metallopeptidase (putative) Human DNA Binding NM_001006114 Q8TBC8
C21orf91 chromosome 21 open reading frame 91 Human DNA Binding 54149 Q68DA1
C22ORF24 Uncharacterized protein C22orf24 Human DNA Binding 25775 Q9Y442
C22orf28 chromosome 22 open reading frame 28 Human DNA Binding 51493 Q9Y3I0
C22ORF29 chromosome 22 open reading frame 29 Human DNA Binding 79680 Q7L3V2
C22orf32 single-pass membrane protein with aspartate-rich tail 1 Human DNA Binding NM_033318 Q9H4I9
C2orf28 all-trans retinoic acid-induced differentiation factor Human DNA Binding 51374 Q6UW56
C2orf29 CCR4-NOT transcription complex, subunit 11 Human DNA Binding 55571 Q9UKZ1
C2orf3 GC-rich sequence DNA-binding factor 2 Human DNA Binding 6936 A4UHR0
C2orf34 calmodulin-lysine N-methyltransferase Human DNA Binding NM_024766 Q7Z624
C2orf42 chromosome 2 open reading frame 42 Human DNA Binding NM_017880 Q9NWW7
C2orf43 chromosome 2 open reading frame 43 Human DNA Binding 60526 Q9H6V9
C2ORF47 chromosome 2 open reading frame 47 Human DNA Binding 79568 Q8WWC4
C2orf52 long intergenic non-protein coding RNA 471 Human DNA Binding NR_024079
C2orf64 cytochrome c oxidase assembly factor 5 Human DNA Binding NM_001008215 Q86WW8
C2orf69 chromosome 2 open reading frame 69 Human DNA Binding 205327 Q8N8R5
C2orf79 peptidyl-tRNA hydrolase domain containing 1 Human DNA Binding NM_001013663 Q6GMV3
C2orf86 WD repeat containing planar cell polarity effector Human DNA Binding NM_015910 O95876
C3orf1 translocase of inner mitochondrial membrane domain containing 1 Human DNA Binding NM_016589 Q9NPL8
C3orf19 coiled-coil domain containing 174 Human DNA Binding 51244 Q6PII3
C4orf21 chromosome 4 open reading frame 21 Human DNA Binding 55345 B4DSN6
C4orf34 small integral membrane protein 14 Human DNA Binding 201895 Q96QK8
C4orf41 trafficking protein particle complex 11 Human DNA Binding 60684 Q7Z392
C4orf43 translation machinery associated 16 homolog (S. cerevisiae) Human DNA Binding 55319 Q96EY4
C4orf46 chromosome 4 open reading frame 46 Human DNA Binding NM_001008393 Q504U0
C4ORF48 Neuropeptide-like protein C4orf48 Human DNA Binding 401115 Q5BLP8
C5orf15 chromosome 5 open reading frame 15 Human DNA Binding 56951 Q8NC54
C5orf24 chromosome 5 open reading frame 24 Human DNA Binding 134553 Q7Z6I8
C5ORF28 chromosome 5 open reading frame 28 Human DNA Binding 64417 Q0VDI3
C5orf34 chromosome 5 open reading frame 34 Human DNA Binding 375444 Q96MH7
C5orf35 SET domain containing 9 Human DNA Binding NM_153706 Q8NE22
C5orf36 KIAA0825 Human DNA Binding NM_173665 Q8IV33
C5orf37 POC5 centriolar protein Human DNA Binding NM_001099271 Q8NA72
C5orf39 annexin A2 receptor Human DNA Binding NM_001014279 Q3ZCQ2
C5orf41 CREB3 regulatory factor Human DNA Binding 153222 Q8IUR6
C5orf44 trafficking protein particle complex 13 Human DNA Binding NR_003545 A5PLN9
C5orf51 chromosome 5 open reading frame 51 Human DNA Binding 285636 A6NDU8
C6orf115 ABRA C-terminal like Human DNA Binding NM_021243 Q9P1F3
C6orf120 chromosome 6 open reading frame 120 Human DNA Binding 387263 Q7Z4R8
C6orf129 coiled-coil domain containing 167 Human DNA Binding NM_138493 Q9P0B6
C6ORF136 Uncharacterized protein C6orf136 Human DNA Binding 221545 Q5SQH8
C6orf142 muscular LMNA-interacting protein Human DNA Binding NM_138569 Q5VWP3
C6orf145 PX domain containing 1 Human DNA Binding 221749 Q5TGL8
C6orf162 small integral membrane protein 8 Human DNA Binding 57150 Q96KF7
C6ORF211 chromosome 6 open reading frame 211 Human DNA Binding 79624 Q9H993
C6orf217 long intergenic non-protein coding RNA 271 Human DNA Binding NR_026805 P0C7V0
C6orf57 chromosome 6 open reading frame 57 Human DNA Binding NM_145267 Q5VUM1
C6orf62 chromosome 6 open reading frame 62 Human DNA Binding 81688 Q9GZU0
C7ORF10 chromosome 7 open reading frame 10 Human DNA Binding 79783 Q9HAC7
C7ORF25 chromosome 7 open reading frame 25 Human DNA Binding 79020 J3KR36
C7ORF26 chromosome 7 open reading frame 26 Human DNA Binding 79034 Q96N11
C7orf30 mitochondrial assembly of ribosomal large subunit 1 Human DNA Binding 115416 Q96EH3
C7orf36 Yae1 domain containing 1 Human DNA Binding 57002 B2RC46
C7orf38 family with sequence similarity 200, member A Human DNA Binding NM_145111 Q8TCP9
C7orf55 chromosome 7 open reading frame 55 Human DNA Binding NM_197964 Q96HJ9
C7ORF55-LUC7L2 UPF0562 protein C7orf55 Human DNA Binding 100996928 Q96HJ9
C7orf60 chromosome 7 open reading frame 60 Human DNA Binding 154743 Q1RMZ1
C8G Complement component C8 gamma chain Human DNA Binding 733 P07360
C8orf37 chromosome 8 open reading frame 37 Human DNA Binding NM_177965 F4Y588
C8orf39 RBM12B antisense RNA 1 Human DNA Binding NR_027259 Q9P1G2
C8orf40 small integral membrane protein 19 Human DNA Binding 114926 Q96E16
C8orf41 TELO2 interacting protein 2 Human DNA Binding 80185 Q6NXR4
C8orf59 chromosome 8 open reading frame 59 Human DNA Binding NM_001099670 A0A024R838
C9orf130 long intergenic non-protein coding RNA 476 Human DNA Binding NR_023389 Q8WZB0
C9orf156 chromosome 9 open reading frame 156 Human DNA Binding 51531 Q9BU70
C9ORF169 Cysteine-rich tail protein 1 Human DNA Binding 375791 A8MQ03
C9orf30 chromosome 9 open reading frame 30 Human DNA Binding 91283 Q96H12
C9orf40 chromosome 9 open reading frame 40 Human DNA Binding 55071 Q8IXQ3
C9orf41 chromosome 9 open reading frame 41 Human DNA Binding 138199 Q8N4J0
C9ORF43 Uncharacterized protein C9orf43 Human DNA Binding 257169 Q8TAL5
C9orf5 transmembrane protein 245 Human DNA Binding 23731 Q9H330
C9ORF69 Protein C9orf69 Human DNA Binding 90120 H0YL14
C9orf78 chromosome 9 open reading frame 78 Human DNA Binding 51759 Q9NZ63
C9orf82 caspase activity and apoptosis inhibitor 1 Human DNA Binding 79886 Q9H8G2
C9ORF96 Serine/threonine kinase-like domain-containing protein STKLD1 Human DNA Binding 169436 Q8NE28
CA11 carbonic anhydrase XI Human DNA Binding NM_001217 O75493
CACNA1G calcium channel, voltage-dependent, T type, alpha 1G subunit Human Direct Regulation 8913 O43497
CACTIN Cactin Human DNA Binding 58509 Q8WUQ7
CACYBP calcyclin binding protein Human DNA Binding 27101 B3KSF1
CAMK2N1 Human DNA Binding
CAMSAP1 calmodulin regulated spectrin-associated protein 1 Human DNA Binding 157922 Q5T5Y3
CAMSAP1L1 calmodulin regulated spectrin-associated protein family, member 2 Human DNA Binding 23271 B3KTI4
CAND1 cullin-associated and neddylation-dissociated 1 Human DNA Binding 55832 Q86VP6
CAPRIN1 cell cycle associated protein 1 Human DNA Binding 4076 Q14444
CAPRIN2 caprin family member 2 Human DNA Binding 65981 Q6IMN6
CAPZA1 capping protein (actin filament) muscle Z-line, alpha 1 Human DNA Binding 829 P52907
CAPZA2 capping protein (actin filament) muscle Z-line, alpha 2 Human DNA Binding 830 P47755
CAPZB capping protein (actin filament) muscle Z-line, beta Human DNA Binding 832 P47756
CARD8 caspase recruitment domain family, member 8 Human DNA Binding 22900 B5KVR6
CARM1 coactivator-associated arginine methyltransferase 1 Human DNA Binding 10498 Q86X55
CARS2 cysteinyl-tRNA synthetase 2, mitochondrial (putative) Human DNA Binding 79587 B7Z7E6
CASC5 cancer susceptibility candidate 5 Human DNA Binding 57082 Q8NG31
CASKIN2 CASK interacting protein 2 Human DNA Binding 57513 Q8WXE0
CASP2 caspase 2, apoptosis-related cysteine peptidase Human DNA Binding 835 D3DXD9
CASP3 caspase 3, apoptosis-related cysteine peptidase Human DNA Binding 836 P42574
CASP8AP2 caspase 8 associated protein 2 Human DNA Binding NM_012115 Q9UKL3
CBLL1 Cbl proto-oncogene, E3 ubiquitin protein ligase-like 1 Human DNA Binding 79872 B4DDV7
CBWD2 COBW domain containing 2 Human DNA Binding 150472 Q8IUF1
CBX3P2 chromobox homolog 3 pseudogene 2 Human DNA Binding 645158 NA
CBX4 chromobox homolog 4 Human DNA Binding 8535 O00257
CBX8 chromobox homolog 8 Human DNA Binding 57332 Q9HC52
CCAR1 cell division cycle and apoptosis regulator 1 Human DNA Binding 55749 Q8IX12
CCBL1 cysteine conjugate-beta lyase, cytoplasmic Human DNA Binding 883 A8K563
CCDC102B coiled-coil domain containing 102B Human DNA Binding NM_001093729 A1A4H1
CCDC109A mitochondrial calcium uniporter Human DNA Binding NM_138357 Q8NE86
CCDC111 DNA-directed primase/polymerase protein Human DNA Binding 201973 Q96LW4
CCDC115 Coiled-coil domain-containing protein 115 Human DNA Binding 84317 Q96NT0
CCDC136 coiled-coil domain containing 136 Human DNA Binding 64753 Q96JN2
CCDC137 coiled-coil domain containing 137 Human DNA Binding 339230 Q6PK04
CCDC142 coiled-coil domain containing 142 Human DNA Binding 84865 Q17RM4
CCDC18 coiled-coil domain containing 18 Human DNA Binding 343099 E9PFB9
CCDC45 centrosomal protein 95kDa Human DNA Binding NM_138363 Q96GE4
CCDC47 coiled-coil domain containing 47 Human DNA Binding 57003 Q96A33
CCDC49 CWC25 spliceosome-associated protein homolog (S. cerevisiae) Human DNA Binding NM_017748 Q9NXE8
CCDC50 coiled-coil domain containing 50 Human DNA Binding 152137 Q8IVM0
CCDC55 nuclear speckle splicing regulatory protein 1 Human DNA Binding NM_032141 A0A024QZ33
CCDC56 coiled-coil domain containing 56 Human DNA Binding 28958 Q9Y2R0
CCDC57 coiled-coil domain containing 57 Human DNA Binding 284001 Q2TAC2
CCDC58 coiled-coil domain containing 58 Human DNA Binding NM_001017928 Q4VC31
CCDC66 coiled-coil domain containing 66 Human DNA Binding 285331 A2RUB6
CCDC71L Coiled-coil domain-containing protein 71L Human DNA Binding 168455 Q8N9Z2
CCDC76 tRNA methyltransferase 13 homolog (S. cerevisiae) Human DNA Binding NM_019083 Q9NUP7
CCDC77 Coiled-coil domain-containing protein 77 Human DNA Binding 84318 Q9BR77
CCDC83 coiled-coil domain containing 83 Human DNA Binding NM_173556 Q8IWF9
CCDC84 coiled-coil domain containing 84 Human DNA Binding NM_198489 Q86UT8
CCDC85C coiled-coil domain containing 85C Human DNA Binding 317762 A6NKD9
CCDC88A coiled-coil domain containing 88A Human DNA Binding 55704 Q3V6T2
CCDC90B coiled-coil domain containing 90B Human DNA Binding 60492 Q9GZT6
CCDC92 Coiled-coil domain-containing protein 92 Human DNA Binding 80212 Q53HC0
CCDC97 coiled-coil domain containing 97 Human DNA Binding 90324 Q96F63
CCM2 cerebral cavernous malformation 2 Human DNA Binding 83605 Q9BSQ5
CCNE2 cyclin E2 Human DNA Binding 9134 O96020
CCNG2 cyclin G2 Human DNA Binding 901 Q16589
CCNI cyclin I Human DNA Binding 10983 Q14094
CCNL1 cyclin L1 Human DNA Binding 57018 Q9UK58
CCPG1 HUWE1 Human DNA Binding 9236 Q9ULG6
CCSAP Centriole, cilia and spindle-associated protein Human DNA Binding 126731 Q6IQ19
CD164 CD164 molecule, sialomucin Human DNA Binding 8763 Q04900
CD276 CD276 molecule Human DNA Binding 80381 Q5ZPR3
CD3EAP CD3e molecule, epsilon associated protein Human DNA Binding 10849 O15446
CD47 CD47 molecule Human DNA Binding 961 Q08722
CDC123 cell division cycle 123 homolog (S. cerevisiae) Human DNA Binding 8872 O75794
CDC14A cell division cycle 14A Human DNA Binding NM_033313 Q59EF4
CDC20 cell division cycle 20 Human DNA Binding 991 Q12834
CDC2L5 cyclin-dependent kinase 13 Human DNA Binding NM_003718 A0A024RA85
CDC42BPB CDC42 binding protein kinase beta (DMPK-like) Human DNA Binding 9578 Q86XZ8
CDC42EP3 CDC42 effector protein (Rho GTPase binding) 3 Human DNA Binding 10602 Q9UKI2
CDC42SE1 CDC42 small effector 1 Human DNA Binding 56882 Q9NRR8
CDC45L cell division cycle 45 Human DNA Binding NM_003504 O75419
CDC6 cell division cycle 6 homolog (S. cerevisiae) Human DNA Binding 990 Q99741
CDC7 cell division cycle 7 Human DNA Binding 8317 O00311
CDC73 cell division cycle 73 Human DNA Binding 79577 Q6P1J9
CDK13 cyclin-dependent kinase 13 Human DNA Binding 8621 Q14004
CDK19 cyclin-dependent kinase 19 Human DNA Binding 23097 Q9BWU1
CDK2AP1 cyclin-dependent kinase 2 associated protein 1 Human DNA Binding 8099 F5GYA4
CDK5RAP2 CDK5 regulatory subunit associated protein 2 Human DNA Binding 55755 B3KVI2
CDK7 cyclin-dependent kinase 7 Human DNA Binding 1022 P50613
CDKAL1 CDK5 regulatory subunit associated protein 1-like 1 Human DNA Binding 54901 Q5VV42
CDKN2A cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4) Human Direct Regulation 1029 P42771
CDKN2B cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4) Human DNA Binding 1030 P42772
CDKN2BAS CDKN2B antisense RNA 1 Human DNA Binding NR_003529
CDS2 CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2 Human DNA Binding 8760 O95674
CDV3 CDV3 homolog (mouse) Human DNA Binding 55573 Q9UKY7
CEBPD CCAAT/enhancer binding protein (C/EBP), delta Human DNA Binding NM_005195 P49716
CEBPE CCAAT/enhancer binding protein (C/EBP), epsilon Human DNA Binding NM_001805 Q15744
CEBPG CCAAT/enhancer binding protein (C/EBP), gamma Human DNA Binding 1054 P53567
CECR2 cat eye syndrome chromosome region, candidate 2 Human DNA Binding 27443 Q9BXF3
CECR6 Cat eye syndrome critical region protein 6 Human DNA Binding 27439 Q9BXQ6
CELSR3 cadherin, EGF LAG seven-pass G-type receptor 3 (flamingo homolog, Drosophila) Human DNA Binding 1951 Q9NYQ7
CENPA centromere protein A Human DNA Binding 1058 P49450
CENPF centromere protein F, 350/400kDa (mitosin) Human DNA Binding 1063 P49454
CENPH centromere protein H Human DNA Binding 64946 Q9H3R5
CENPL centromere protein L Human DNA Binding 91687 Q8N0S6
CENPQ centromere protein Q Human DNA Binding 55166 Q7L2Z9
CEP104 centrosomal protein 104kDa Human DNA Binding 9731 O60308
CEP164 centrosomal protein 164kDa Human DNA Binding 22897 Q9UPV0
CEP170 centrosomal protein 170kDa Human DNA Binding 9859 Q5SW79
CEP250 centrosomal protein 250kDa Human DNA Binding 11190 Q9BV73
CEP350 centrosomal protein 350kDa Human DNA Binding 9857 Q5VT06
CEP68 centrosomal protein 68kDa Human DNA Binding 23177 Q76N32
CEP95 Centrosomal protein of 95 kDa Human DNA Binding 90799 Q96GE4
CEP97 centrosomal protein 97kDa Human DNA Binding 79598 Q8IW35
CERS2 ceramide synthase 2 Human DNA Binding 29956 Q96G23
CFL1 cofilin 1 (non-muscle) Human DNA Binding 1072 P23528
CFLAR CASP8 and FADD-like apoptosis regulator Human DNA Binding 8837 O15519
CGRRF1 cell growth regulator with ring finger domain 1 Human DNA Binding NM_006568 Q99675
CHAMP1 Chromosome alignment-maintaining phosphoprotein 1 Human DNA Binding 283489 Q96JM3
CHCHD1 coiled-coil-helix-coiled-coil-helix domain containing 1 Human DNA Binding 118487 Q96BP2
CHCHD2 KIT Human DNA Binding 51142 Q9Y6H1
CHCHD3 coiled-coil-helix-coiled-coil-helix domain containing 3 Human DNA Binding 54927 A4D1N4
CHCHD7 coiled-coil-helix-coiled-coil-helix domain containing 7 Human DNA Binding 79145 Q9BUK0
CHD1 chromodomain helicase DNA binding protein 1 Human DNA Binding 1105 B3KT33
CHD9 chromodomain helicase DNA binding protein 9 Human DNA Binding 80205 Q3L8U1
CHERP calcium homeostasis endoplasmic reticulum protein Human DNA Binding 10523 Q8IWX8
CHFR checkpoint with forkhead and ring finger domains, E3 ubiquitin protein ligase Human DNA Binding 55743 Q96EP1
CHIC2 cysteine-rich hydrophobic domain 2 Human DNA Binding 26511 Q9UKJ5
CHM choroideremia (Rab escort protein 1) Human DNA Binding 1121 P24386
CHMP6 charged multivesicular body protein 6 Human DNA Binding 79643 Q96FZ7
CHP calcineurin-like EF-hand protein 1 Human DNA Binding 11261 Q99653
CHRAC1 chromatin accessibility complex 1 Human DNA Binding 54108 Q9NRG0
CHRNA5 cholinergic receptor, nicotinic, alpha 5 (neuronal) Human DNA Binding 1138 P30532
CHRNB3 cholinergic receptor, nicotinic, beta 3 (neuronal) Human DNA Binding NM_000749 Q05901
CHUK conserved helix-loop-helix ubiquitous kinase Human DNA Binding 1147 O15111
CIC capicua transcriptional repressor Human DNA Binding 23152 Q96RK0
CIRBP-AS1 CIRBP antisense RNA 1 Human DNA Binding 148046 Q8TBR5
CISD1 CDGSH iron sulfur domain 1 Human DNA Binding 55847 Q9NZ45
CISD2 CDGSH iron sulfur domain 2 Human DNA Binding NM_001008388 Q8N5K1
CITED1 Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 1 Human DNA Binding NM_001144886 Q99966
CITED2 Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 2 Human DNA Binding 10370 D9ZGF1
CIZ1 CDKN1A interacting zinc finger protein 1 Human DNA Binding 25792 Q9BTG3
CKAP2L cytoskeleton associated protein 2-like Human DNA Binding 150468 Q8IYA6
CKAP5 cytoskeleton associated protein 5 Human DNA Binding 9793 Q14008
CKLF chemokine-like factor Human DNA Binding 51192 Q9UBR5
CKLF-CMTM1 Protein CKLF-CMTM1 Human DNA Binding 100529251 A0A087WVB3
CKS2 CDC28 protein kinase regulatory subunit 2 Human DNA Binding 1164 P33552
CLASP1 cytoplasmic linker associated protein 1 Human DNA Binding 23332 A2RU21
CLCC1 chloride channel CLIC-like 1 Human DNA Binding 23155 Q96S66
CLCN3 chloride channel, voltage-sensitive 3 Human DNA Binding 1182 B7Z932
CLIC1 chloride intracellular channel 1 Human DNA Binding 1192 O00299
CLIC4 chloride intracellular channel 4 Human DNA Binding 25932 Q6FIC5
CLIP4 CAP-Gly domain-containing linker protein 4 Human DNA Binding 79745 Q8N3C7
CLK1 CDC-like kinase 1 Human DNA Binding 1195 P49759
CLK2 CDC-like kinase 2 Human DNA Binding 1196 P49760
CLK3 CDC-like kinase 3 Human DNA Binding 1198 B3KRI8
CLK4 CDC-like kinase 4 Human DNA Binding 57396 Q9HAZ1
CLOCK clock circadian regulator Human DNA Binding 9575 O15516
CLPTM1 cleft lip and palate associated transmembrane protein 1 Human DNA Binding 1209 B3KQH2
CLPX ClpX caseinolytic peptidase X homolog (E. coli) Human DNA Binding 10845 O76031
CLTA clathrin, light chain A Human DNA Binding 1211 P09496
CLUAP1 Clusterin-associated protein 1 Human DNA Binding 23059 Q96AJ1
CLUH Clustered mitochondria protein homolog Human DNA Binding 23277 O75153
CMIP c-Maf inducing protein Human DNA Binding 80790 Q8IY22
CMPK1 cytidine monophosphate (UMP-CMP) kinase 1, cytosolic Human DNA Binding 51727 E9PGI8
CMTM8 CKLF-like MARVEL transmembrane domain containing 8 Human DNA Binding NM_178868 Q8IZV2
CNBP CCHC-type zinc finger, nucleic acid binding protein Human DNA Binding 7555 A8K7V4
CNEP1R1 Nuclear envelope phosphatase-regulatory subunit 1 Human DNA Binding 255919 Q8N9A8
CNIH cornichon homolog (Drosophila) Human DNA Binding 10175 O95406
CNN3 calponin 3, acidic Human DNA Binding 1266 Q15417
CNNM2 cyclin M2 Human DNA Binding 54805 Q9H8M5
CNO biogenesis of lysosomal organelles complex-1, subunit 4, cappuccino Human DNA Binding 55330 Q9NUP1
CNOT1 CCR4-NOT transcription complex, subunit 1 Human DNA Binding 23019 A5YKK6
CNOT11 CCR4-NOT transcription complex subunit 11 Human DNA Binding 55571 Q9UKZ1
CNOT2 CCR4-NOT transcription complex, subunit 2 Human DNA Binding 4848 B2RDX7
CNOT3 CCR4-NOT transcription complex, subunit 3 Human DNA Binding 4849 O75175
CNOT4 CCR4-NOT transcription complex, subunit 4 Human DNA Binding 4850 O95628
CNOT6 CCR4-NOT transcription complex, subunit 6 Human DNA Binding 57472 Q9ULM6
CNOT6L CCR4-NOT transcription complex, subunit 6-like Human DNA Binding 246175 Q96LI5
CNOT8 CCR4-NOT transcription complex, subunit 8 Human DNA Binding 9337 Q9UFF9
CNPPD1 cyclin Pas1/PHO80 domain containing 1 Human DNA Binding 27013 Q9BV87
CNPY3 canopy FGF signaling regulator 3 Human DNA Binding NM_006586 Q9BT09
CNPY4 canopy FGF signaling regulator 4 Human DNA Binding NM_152755 Q8N129
COA5 Cytochrome c oxidase assembly factor 5 Human DNA Binding 493753 Q86WW8
COG2 component of oligomeric golgi complex 2 Human DNA Binding 22796 Q14746
COIL coilin Human DNA Binding 8161 P38432
COL4A3BP collagen, type IV, alpha 3 (Goodpasture antigen) binding protein Human DNA Binding 10087 Q9Y5P4
COL4A6 collagen, type IV, alpha 6 Human DNA Binding 1288 Q14031
COL5A2 MKL2 Human DNA Binding 1290 P05997
COMMD2 COMM domain containing 2 Human DNA Binding 51122 Q86X83
COMMD3 COMM domain containing 3 Human DNA Binding NM_012071 Q9UBI1
COPA coatomer protein complex, subunit alpha Human DNA Binding 1314 P53621
COPB1 coatomer protein complex, subunit beta 1 Human DNA Binding 1315 P53618
COPS4 COP9 constitutive photomorphogenic homolog subunit 4 (Arabidopsis) Human DNA Binding 51138 B3KST5
COPS5 COP9 constitutive photomorphogenic homolog subunit 5 (Arabidopsis) Human DNA Binding 10987 Q92905
COPS7A COP9 constitutive photomorphogenic homolog subunit 7A (Arabidopsis) Human DNA Binding 50813 Q9UBW8
COPS7B COP9 signalosome subunit 7B Human DNA Binding 64708 Q9H9Q2
COPS8 COP9 constitutive photomorphogenic homolog subunit 8 (Arabidopsis) Human DNA Binding 10920 Q53QS9
COPZ1 coatomer protein complex, subunit zeta 1 Human DNA Binding 22818 P61923
COQ2 coenzyme Q2 homolog, prenyltransferase (yeast) Human DNA Binding 27235 Q96H96
COQ3 coenzyme Q3 methyltransferase Human DNA Binding NM_017421 Q9NZJ6
COQ4 Ubiquinone biosynthesis protein COQ4 homolog, mitochondrial Human DNA Binding 51117 Q9Y3A0
COQ5 coenzyme Q5 homolog, methyltransferase (S. cerevisiae) Human DNA Binding 84274 Q5HYK3
CORO2B Coronin-2B Human DNA Binding 10391 Q9UQ03
COX11 cytochrome c oxidase assembly homolog 11 (yeast) Human DNA Binding 1353 B4DEY8
COX15 cytochrome c oxidase assembly homolog 15 (yeast) Human DNA Binding 1355 Q7KZN9
COX18 cytochrome c oxidase assembly homolog 18 (yeast) Human DNA Binding 285521 Q8N8Q8
COX20 Cytochrome c oxidase protein 20 homolog Human DNA Binding 116228 Q5RI15
COX4I1 cytochrome c oxidase subunit IV isoform 1 Human DNA Binding 1327 P13073
COX5A cytochrome c oxidase subunit Va Human DNA Binding 9377 P20674
COX5B cytochrome c oxidase subunit Vb Human DNA Binding 1329 P10606
COX6A1 cytochrome c oxidase subunit VIa polypeptide 1 Human DNA Binding 1337 H6SG15
COX6C cytochrome c oxidase subunit VIc Human DNA Binding NM_004374 A0A024R9B7
COX7A2 cytochrome c oxidase subunit VIIa polypeptide 2 (liver) Human DNA Binding NM_001865 H0UI06
COX7C cytochrome c oxidase subunit VIIc Human DNA Binding 1350 P15954
CP110 centriolar coiled coil protein 110kDa Human DNA Binding 9738 B4DTZ1
CPEB3 cytoplasmic polyadenylation element binding protein 3 Human DNA Binding 22849 Q5QP71
CPEB4 cytoplasmic polyadenylation element binding protein 4 Human DNA Binding 80315 Q17RY0
CPNE1 copine I Human DNA Binding 8904 B0QZ18
CPPED1 calcineurin-like phosphoesterase domain containing 1 Human DNA Binding 55313 Q9BRF8
CPS1 carbamoyl-phosphate synthase 1, mitochondrial Human DNA Binding 1373 J3KQL0
CPSF2 cleavage and polyadenylation specific factor 2, 100kDa Human DNA Binding 53981 Q9P2I0
CPSF3 cleavage and polyadenylation specific factor 3, 73kDa Human DNA Binding 51692 Q9UKF6
CPSF6 cleavage and polyadenylation specific factor 6, 68kDa Human DNA Binding 11052 Q16630
CPT1A carnitine palmitoyltransferase 1A (liver) Human DNA Binding 1374 P50416
CPT1C carnitine palmitoyltransferase 1C Human DNA Binding NM_152359 A0A024QZI3
CRADD CASP2 and RIPK1 domain containing adaptor with death domain Human DNA Binding 8738 P78560
CRBN Protein cereblon Human DNA Binding 51185 Q96SW2
CREB3 cAMP responsive element binding protein 3 Human DNA Binding NM_006368 O43889
CREBL2 cAMP responsive element binding protein-like 2 Human DNA Binding 1389 O60519
CREBRF CREB3 regulatory factor Human DNA Binding 153222 Q8IUR6
CRELD1 cysteine-rich with EGF-like domains 1 Human DNA Binding 78987 Q96HD1
CREM cAMP responsive element modulator Human DNA Binding 1390 Q03060
CRIPT cysteine-rich PDZ-binding protein Human DNA Binding NM_014171 Q9P021
CRKL v-crk sarcoma virus CT10 oncogene homolog (avian)-like Human DNA Binding 1399 P46109
CRLS1 cardiolipin synthase 1 Human DNA Binding 54675 Q9UJA2
CROCC ciliary rootlet coiled-coil, rootletin Human DNA Binding 9696 Q5TZA2
CROCCL2 ciliary rootlet coiled-coil, rootletin pseudogene 3 Human DNA Binding NR_023386
CROT Human DNA Binding NR_026585
CRY1 cryptochrome 1 (photolyase-like) Human DNA Binding 1407 A2I2P0
CRYL1 crystallin, lambda 1 Human DNA Binding NM_015974 Q9Y2S2
CRYZ crystallin, zeta (quinone reductase) Human DNA Binding NM_001134759 Q08257
CRYZL1 crystallin, zeta (quinone reductase)-like 1 Human DNA Binding 9946 O95825
CS citrate synthase Human DNA Binding 1431 O75390
CSNK1G1 casein kinase 1, gamma 1 Human DNA Binding 53944 Q9HCP0
CSPP1 centrosome and spindle pole associated protein 1 Human DNA Binding NM_024790 Q1MSJ5
CSTF1 cleavage stimulation factor, 3' pre-RNA, subunit 1, 50kDa Human DNA Binding 1477 Q05048
CTAGE5 CTAGE family, member 5 Human DNA Binding 4253 O15320
CTBP1-AS1 CTBP1 antisense RNA 1 Human DNA Binding 92070 Q0VAR9
CTBP2 C-terminal binding protein 2 Human DNA Binding 1488 P56545
CTDSP2 CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 2 Human DNA Binding 10106 O14595
CTTNBP2 cortactin binding protein 2 Human DNA Binding 83992 Q8WZ74
CTTNBP2NL CTTNBP2 N-terminal like Human DNA Binding 55917 Q9P2B4
CTU1 cytosolic thiouridylase subunit 1 homolog (S. pombe) Human DNA Binding 90353 Q7Z7A3
CUGBP1 CUGBP, Elav-like family member 1 Human DNA Binding NM_006560 Q92879
CUL1 cullin 1 Human DNA Binding 8454 Q13616
CUL4A cullin 4A Human DNA Binding 8451 Q13619
CUTA cutA divalent cation tolerance homolog (E. coli) Human DNA Binding 51596 O60888
CUTC cutC copper transporter homolog (E. coli) Human DNA Binding 51076 Q9NTM9
CUX1 cut like homeobox 1 Human DNA Binding 1523 Q13948
CWC27 CWC27 spliceosome-associated protein homolog (S. cerevisiae) Human DNA Binding 10283 Q6UX04
CWF19L1 CWF19-like 1, cell cycle control (S. pombe) Human DNA Binding 55280 Q69YN2
CXorf56 chromosome X open reading frame 56 Human DNA Binding NM_022101 Q9H5V9
CYB5A cytochrome b5 type A (microsomal) Human DNA Binding 1528 P00167
CYB5B cytochrome b5 type B (outer mitochondrial membrane) Human DNA Binding 80777 J3KNF8
CYB5D1 cytochrome b5 domain containing 1 Human DNA Binding 124637 Q6P9G0
CYB5D2 cytochrome b5 domain containing 2 Human DNA Binding 124936 Q8WUJ1
CYP39A1 cytochrome P450, family 39, subfamily A, polypeptide 1 Human DNA Binding NM_016593 B7Z786
CYP51A1 cytochrome P450, family 51, subfamily A, polypeptide 1 Human DNA Binding 1595 Q16850
CYR61 NXPH1 Human DNA Binding 3491 O00622
CYTSA sperm antigen with calponin homology and coiled-coil domains 1-like Human DNA Binding NM_001145468 B2RMV2
DACH1 dachshund homolog 1 (Drosophila) Human DNA Binding 1602 D0FY36
DALRD3 DALR anticodon binding domain containing 3 Human DNA Binding 55152 Q5D0E6
DAPK1 death-associated protein kinase 1 Human Direct Regulation 1612 P53355
DARS2 aspartyl-tRNA synthetase 2, mitochondrial Human DNA Binding 55157 Q6PI48
DAZAP2 DAZ associated protein 2 Human DNA Binding 9802 E9PB45
DBF4 DBF4 homolog (S. cerevisiae) Human DNA Binding 10926 Q9UBU7
DBN1 drebrin 1 Human DNA Binding 1627 Q16643
DBT dihydrolipoamide branched chain transacylase E2 Human DNA Binding 1629 P11182
DCAF10 DDB1 and CUL4 associated factor 10 Human DNA Binding 79269 Q5QP82
DCAF11 DDB1 and CUL4 associated factor 11 Human DNA Binding 80344 B3KSW2
DCAF17 DDB1- and CUL4-associated factor 17 Human DNA Binding 80067 Q5H9S7
DCAF5 DDB1 and CUL4 associated factor 5 Human DNA Binding 8816 Q96JK2
DCAF6 DDB1 and CUL4 associated factor 6 Human DNA Binding NM_018442 Q58WW2
DCAF8 DDB1 and CUL4 associated factor 8 Human DNA Binding 50717 B7Z8C9
DCDC2 doublecortin domain containing 2 Human DNA Binding 51473 Q9UHG0
DCLK2 Serine/threonine-protein kinase DCLK2 Human DNA Binding 166614 Q8N568
DCLRE1A DNA cross-link repair 1A Human DNA Binding 9937 Q6PJP8
DCLRE1C DNA cross-link repair 1C Human DNA Binding 64421 Q96SD1
DCP1A mRNA-decapping enzyme 1A Human DNA Binding 55802 Q9NPI6
DCP2 DCP2 decapping enzyme homolog (S. cerevisiae) Human DNA Binding 167227 Q8IU60
DCPS decapping enzyme, scavenger Human DNA Binding 28960 Q96C86
DCTN4 dynactin 4 (p62) Human DNA Binding 51164 Q9UJW0
DCUN1D4 DCN1, defective in cullin neddylation 1, domain containing 4 Human DNA Binding 23142 Q92564
DDAH1 dimethylarginine dimethylaminohydrolase 1 Human DNA Binding 23576 B4E3V1
DDB2 damage-specific DNA binding protein 2, 48kDa Human DNA Binding 1643 Q92466
DDHD1 DDHD domain containing 1 Human DNA Binding 80821 Q8NEL9
DDHD2 DDHD domain containing 2 Human DNA Binding 23259 O94830
DDI2 DNA-damage inducible 1 homolog 2 (S. cerevisiae) Human DNA Binding 84301 Q5TDH0
DDOST dolichyl-diphosphooligosaccharide--protein glycosyltransferase Human DNA Binding 1650 P39656
DDR1 discoidin domain receptor tyrosine kinase 1 Human DNA Binding 780 Q08345
DDX21 DEAD (Asp-Glu-Ala-Asp) box helicase 21 Human DNA Binding 9188 Q9NR30
DDX23 DEAD (Asp-Glu-Ala-Asp) box polypeptide 23 Human DNA Binding 9416 Q9BUQ8
DDX28 DEAD (Asp-Glu-Ala-Asp) box polypeptide 28 Human DNA Binding 55794 Q9NUL7
DDX31 DEAD (Asp-Glu-Ala-Asp) box polypeptide 31 Human DNA Binding 64794 Q9H8H2
DDX39B DEAD (Asp-Glu-Ala-Asp) box polypeptide 39B Human DNA Binding 7919 Q13838
DDX3X DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked Human DNA Binding 1654 O00571
DDX41 DEAD (Asp-Glu-Ala-Asp) box polypeptide 41 Human DNA Binding 51428 Q9UJV9
DDX46 DEAD (Asp-Glu-Ala-Asp) box polypeptide 46 Human DNA Binding 9879 Q7L014
DDX49 DEAD (Asp-Glu-Ala-Asp) box polypeptide 49 Human DNA Binding 54555 Q9Y6V7
DDX5 DEAD (Asp-Glu-Ala-Asp) box helicase 5 Human DNA Binding 1655 P17844
DDX50 DEAD (Asp-Glu-Ala-Asp) box polypeptide 50 Human DNA Binding 79009 Q9BQ39
DDX54 DEAD (Asp-Glu-Ala-Asp) box polypeptide 54 Human DNA Binding 79039 Q8TDD1
DDX59 DEAD (Asp-Glu-Ala-Asp) box polypeptide 59 Human DNA Binding 83479 Q5T1V6
DEDD death effector domain containing Human DNA Binding 9191 O75618
DEK DEK oncogene Human DNA Binding 7913 P35659
DEM1 exonuclease 5 Human DNA Binding 64789 Q9H790
DENND1B DENN/MADD domain containing 1B Human DNA Binding 163486 Q6P3S1
DENND4A DENN/MADD domain containing 4A Human DNA Binding 10260 Q05C90
DENND4C DENN/MADD domain containing 4C Human DNA Binding 55667 Q5VZ89
DENND5A DENN/MADD domain containing 5A Human DNA Binding NM_015213 Q6IQ26
DENND5B DENN/MADD domain containing 5B Human DNA Binding 160518 Q6ZUT9
DENND5B-AS1 DENND5B antisense RNA 1 Human DNA Binding 100874249 NA
DENND6B Protein DENND6B Human DNA Binding 414918 Q8NEG7
DEPDC1B DEP domain containing 1B Human DNA Binding 55789 Q8WUY9
DFFA DNA fragmentation factor, 45kDa, alpha polypeptide Human DNA Binding 1676 O00273
DFFB DNA fragmentation factor subunit beta Human DNA Binding 1677 O76075
DGKA diacylglycerol kinase, alpha 80kDa Human DNA Binding NM_001345 A0A024RB23
DHDDS dehydrodolichyl diphosphate synthase Human DNA Binding 79947 Q86SQ9
DHRS12 dehydrogenase/reductase (SDR family) member 12 Human DNA Binding NM_024705 A0PJE2
DHRS13 dehydrogenase/reductase (SDR family) member 13 Human DNA Binding 147015 Q6UX07
DHX15 DEAH (Asp-Glu-Ala-His) box polypeptide 15 Human DNA Binding 1665 O43143
DHX29 DEAH (Asp-Glu-Ala-His) box polypeptide 29 Human DNA Binding 54505 Q7Z478
DHX30 DEAH (Asp-Glu-Ala-His) box polypeptide 30 Human DNA Binding 22907 Q7L2E3
DHX33 DEAH (Asp-Glu-Ala-His) box polypeptide 33 Human DNA Binding 56919 B4DIS6
DHX34 DEAH (Asp-Glu-Ala-His) box polypeptide 34 Human DNA Binding 9704 Q14147
DHX35 DEAH (Asp-Glu-Ala-His) box polypeptide 35 Human DNA Binding 60625 F5GXM6
DHX36 DEAH (Asp-Glu-Ala-His) box polypeptide 36 Human DNA Binding 170506 Q9H2U1
DHX40 DEAH (Asp-Glu-Ala-His) box polypeptide 40 Human DNA Binding 79665 B4DR88
DHX57 DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57 Human DNA Binding 90957 Q6P158
DIAPH1 diaphanous homolog 1 (Drosophila) Human DNA Binding 1729 E9PEZ2
DIAPH2 diaphanous homolog 2 (Drosophila) Human DNA Binding 1730 O60879
DICER1 dicer 1, ribonuclease type III Human DNA Binding 23405 Q9UPY3
DICER1-AS1 DICER1 antisense RNA 1 Human DNA Binding 400242 NA
DIDO1 death inducer-obliterator 1 Human DNA Binding 11083 Q9BTC0
DIMT1L DIM1 dimethyladenosine transferase 1 homolog (S. cerevisiae) Human DNA Binding NM_014473 Q9UNQ2
DIP2C DIP2 disco-interacting protein 2 homolog C (Drosophila) Human DNA Binding 22982 Q9Y2E4
DIRC2 disrupted in renal carcinoma 2 Human DNA Binding 84925 Q96SL1
DIS3L DIS3 mitotic control homolog (S. cerevisiae)-like Human DNA Binding 115752 Q8TF46
DIS3L2 DIS3 mitotic control homolog (S. cerevisiae)-like 2 Human DNA Binding 129563 Q8IYB7
DKC1 dyskeratosis congenita 1, dyskerin Human Protein Binding 1736 O60832
DKK1 dickkopf 1 homolog (Xenopus laevis) Human DNA Binding 22943 O94907
DKKL1 dickkopf-like 1 Human DNA Binding NM_014419 Q9UK85
DLEU2 deleted in lymphocytic leukemia 2 (non-protein coding) Human DNA Binding NR_002612
DLG1-AS1 DLG1 antisense RNA 1 Human DNA Binding 100507086 NA
DLG5 discs, large homolog 5 (Drosophila) Human DNA Binding 9231 Q8TDM6
DLG5-AS1 DLG5 antisense RNA 1 Human DNA Binding 100128292 NA
DLGAP5 discs, large (Drosophila) homolog-associated protein 5 Human DNA Binding 9787 Q15398
DLST dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex) Human DNA Binding 1743 B7Z6J1
DLX3 distal-less homeobox 3 Human DNA Binding 1747 O60479
DMBX1 diencephalon/mesencephalon homeobox 1 Human DNA Binding NM_147192 Q8NFW5
DMTF1 cyclin D binding myb-like transcription factor 1 Human DNA Binding 9988 B3KMJ8
DMXL1 Dmx-like 1 Human DNA Binding 1657 Q9Y485
DMXL2 Dmx-like 2 Human DNA Binding NM_015263 Q8TDJ6
DNAJA1 DnaJ (Hsp40) homolog, subfamily A, member 1 Human DNA Binding 3301 P31689
DNAJA2 DnaJ (Hsp40) homolog, subfamily A, member 2 Human DNA Binding 10294 O60884
DNAJB14 DnaJ (Hsp40) homolog, subfamily B, member 14 Human DNA Binding 79982 Q8TBM8
DNAJB4 DnaJ (Hsp40) homolog, subfamily B, member 4 Human DNA Binding 11080 Q9UDY4
DNAJB6 DnaJ (Hsp40) homolog, subfamily B, member 6 Human DNA Binding 10049 O75190
DNAJC10 DnaJ (Hsp40) homolog, subfamily C, member 10 Human DNA Binding 54431 Q8IXB1
DNAJC11 DnaJ (Hsp40) homolog, subfamily C, member 11 Human DNA Binding 55735 Q9NVH1
DNAJC16 DnaJ (Hsp40) homolog, subfamily C, member 16 Human DNA Binding 23341 Q9Y2G8
DNAJC2 DnaJ (Hsp40) homolog, subfamily C, member 2 Human DNA Binding 27000 Q99543
DNAJC27 DnaJ (Hsp40) homolog, subfamily C, member 27 Human DNA Binding 51277 Q9NZQ0
DNAJC27-AS1 DNAJC27 antisense RNA 1 Human DNA Binding 729723 NA
DNAJC7 DnaJ (Hsp40) homolog, subfamily C, member 7 Human DNA Binding 7266 Q99615
DNAJC9 DnaJ (Hsp40) homolog, subfamily C, member 9 Human DNA Binding 23234 B2RMW6
DNMT3A DNA (cytosine-5-)-methyltransferase 3 alpha Human DNA Binding 1788 Q9Y6K1
DNMT3B DNA (cytosine-5-)-methyltransferase 3 beta Human Protein Binding 1789 Q9UBC3
DOCK7 dedicator of cytokinesis 7 Human DNA Binding 85440 Q96N67
DOT1L DOT1-like histone H3K79 methyltransferase Human DNA Binding 84444 Q8TEK3
DPAGT1 dolichyl-phosphate (UDP-N-acetylglucosamine) N-acetylglucosaminephosphotransferase 1 (GlcNAc-1-P transferase) Human DNA Binding 1798 Q9H3H5
DPH5 DPH5 homolog (S. cerevisiae) Human DNA Binding 51611 B3KWP1
DPM3 dolichyl-phosphate mannosyltransferase polypeptide 3 Human DNA Binding NM_018973 Q9P2X0
DPP3 dipeptidyl-peptidase 3 Human DNA Binding 10072 Q9NY33
DPP8 dipeptidyl-peptidase 8 Human DNA Binding 54878 Q6V1X1
DPP9 dipeptidyl-peptidase 9 Human DNA Binding 91039 Q86TI2
DPY19L3 dpy-19-like 3 (C. elegans) Human DNA Binding 147991 Q6ZPD9
DPY19L4 dpy-19-like 4 (C. elegans) Human DNA Binding 286148 Q7Z388
DPYSL5 dihydropyrimidinase-like 5 Human DNA Binding 56896 Q9BPU6
DR1 down-regulator of transcription 1, TBP-binding (negative cofactor 2) Human DNA Binding 1810 Q01658
DRAM2 DNA-damage regulated autophagy modulator 2 Human DNA Binding 128338 Q6UX65
DRAXIN Draxin Human DNA Binding 374946 Q8NBI3
DSCR3 Down syndrome critical region gene 3 Human DNA Binding 10311 O14972
DSE dermatan sulfate epimerase Human DNA Binding 29940 Q9UL01
DSTYK dual serine/threonine and tyrosine protein kinase Human DNA Binding 25778 Q6XUX3
DTD1 D-tyrosyl-tRNA deacylase 1 Human DNA Binding 92675 Q8TEA8
DTWD1 DTW domain containing 1 Human DNA Binding NM_020234 Q8N5C7
DTYMK deoxythymidylate kinase (thymidylate kinase) Human DNA Binding 1841 B7ZW70
DULLARD CTD nuclear envelope phosphatase 1 Human DNA Binding NM_001143775 O95476
DUS2L tRNA-dihydrouridine(20) synthase [NAD(P)+]-like Human DNA Binding 54920 Q9NX74
DUSP16 dual specificity phosphatase 16 Human DNA Binding 80824 Q9BY84
DUSP4 dual specificity phosphatase 4 Human DNA Binding 1846 Q13115
DUSP5P dual specificity phosphatase 5 pseudogene 1 Human DNA Binding NR_002834
DUSP6 dual specificity phosphatase 6 Human DNA Binding 1848 Q16828
DUSP7 dual specificity phosphatase 7 Human DNA Binding 1849 Q16829
DVL3 dishevelled, dsh homolog 3 (Drosophila) Human DNA Binding 1857 Q92997
DYNC1H1 dynein, cytoplasmic 1, heavy chain 1 Human DNA Binding 1778 Q14204
DYNC1I2 dynein, cytoplasmic 1, intermediate chain 2 Human DNA Binding 1781 Q13409
DYNC1LI1 dynein, cytoplasmic 1, light intermediate chain 1 Human DNA Binding 51143 Q9Y6G9
DYNLRB1 dynein, light chain, roadblock-type 1 Human DNA Binding 83658 Q9NP97
DYRK1A dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A Human DNA Binding 1859 Q13627
DYRK3 dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3 Human DNA Binding 8444 O43781
DZIP1 DAZ interacting protein 1 Human DNA Binding 22873 Q86YF9
E4F1 E4F transcription factor 1 Human DNA Binding 1877 Q66K89
EARS2 glutamyl-tRNA synthetase 2, mitochondrial Human DNA Binding 124454 Q5JPH6
ECH1 enoyl CoA hydratase 1, peroxisomal Human DNA Binding 1891 Q13011
ECHDC1 enoyl CoA hydratase domain containing 1 Human DNA Binding 55862 Q9NTX5
ECT2 epithelial cell transforming sequence 2 oncogene Human DNA Binding 1894 Q9H8V3
EDEM1 ER degradation enhancer, mannosidase alpha-like 1 Human DNA Binding 9695 Q92611
EDEM2 ER degradation enhancer, mannosidase alpha-like 2 Human DNA Binding 55741 Q9BV94
EED embryonic ectoderm development Human DNA Binding 8726 O75530
EEF2K eukaryotic elongation factor-2 kinase Human DNA Binding 29904 O00418
EFCAB11 EF-hand calcium binding domain 11 Human DNA Binding 90141 Q9BUY7
EFCAB2 EF-hand calcium binding domain 2 Human DNA Binding NM_032328 Q5VUJ9
EFCAB5 EF-hand calcium binding domain 5 Human DNA Binding NM_001145053 A4FU69
EFCAB7 EF-hand calcium binding domain 7 Human DNA Binding 84455 A8K855
EFHA1 mitochondrial calcium uptake 2 Human DNA Binding NM_152726 Q8IYU8
EFHC1 EF-hand domain (C-terminal) containing 1 Human DNA Binding 114327 B2CKC5
EFNA5 ephrin-A5 Human DNA Binding 1946 P52803
EGLN1 egl nine homolog 1 (C. elegans) Human DNA Binding 54583 Q9GZT9
EGR3 Human DNA Binding
EHBP1 EH domain binding protein 1 Human DNA Binding 23301 Q8NDI1
EHMT2 euchromatic histone-lysine N-methyltransferase 1 Human DNA Binding 79813 Q9H9B1
EIF1 eukaryotic translation initiation factor 1 Human DNA Binding 10209 P41567
EIF1AD eukaryotic translation initiation factor 1A domain containing Human DNA Binding 84285 Q8N9N8
EIF1AX eukaryotic translation initiation factor 1A, X-linked Human DNA Binding 1964 P47813
EIF2A eukaryotic translation initiation factor 2A, 65kDa Human DNA Binding 83939 Q9BY44
EIF2B4 eukaryotic translation initiation factor 2B, subunit 4 delta, 67kDa Human DNA Binding 8890 Q9UI10
EIF2C2 eukaryotic translation initiation factor 2C, 2 Human DNA Binding 27161 Q9UKV8
EIF2S1 eukaryotic translation initiation factor 2, subunit 1 alpha, 35kDa Human DNA Binding 1965 P05198
EIF2S2 eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa Human DNA Binding 8894 P20042
EIF2S3 eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa Human DNA Binding 1968 P41091
EIF3A eukaryotic translation initiation factor 3, subunit A Human DNA Binding 8661 Q14152
EIF3B eukaryotic translation initiation factor 3, subunit B Human DNA Binding 8662 P55884
EIF3D eukaryotic translation initiation factor 3, subunit D Human DNA Binding 8664 O15371
EIF3F eukaryotic translation initiation factor 3, subunit F Human DNA Binding 8665 O00303
EIF3L eukaryotic translation initiation factor 3, subunit L Human DNA Binding 51386 B4DYB2
EIF3M eukaryotic translation initiation factor 3, subunit M Human DNA Binding 10480 Q7L2H7
EIF4B eukaryotic translation initiation factor 4B Human DNA Binding 1975 P23588
EIF4E eukaryotic translation initiation factor 4E Human DNA Binding 1977 P06730
EIF4E2 eukaryotic translation initiation factor 4E family member 2 Human DNA Binding 9470 O60573
EIF4ENIF1 eukaryotic translation initiation factor 4E nuclear import factor 1 Human DNA Binding 56478 Q9NRA8
EIF4G2 eukaryotic translation initiation factor 4 gamma, 2 Human DNA Binding 1982 P78344
EIF4G3 Human DNA Binding
ELAC2 elaC homolog 2 (E. coli) Human DNA Binding 60528 Q9BQ52
ELF2 E74-like factor 2 (ets domain transcription factor) Human DNA Binding 1998 Q15723
ELMO2 Human DNA Binding
ELMOD3 ELMO/CED-12 domain containing 3 Human DNA Binding 84173 Q96FG2
ELMSAN1 ELM2 and SANT domain-containing protein 1 Human DNA Binding 91748 Q6PJG2
ELOVL1 ELOVL fatty acid elongase 1 Human DNA Binding NM_022821 Q9BW60
ELOVL5 ELOVL fatty acid elongase 5 Human DNA Binding 60481 Q9NYP7
ELOVL6 ELOVL fatty acid elongase 6 Human DNA Binding 79071 Q9H5J4
ELP2 elongator acetyltransferase complex subunit 2 Human DNA Binding 55250 Q6IA86
ELP3 elongator acetyltransferase complex subunit 3 Human DNA Binding 55140 Q9H9T3
EMC1 ER membrane protein complex subunit 1 Human DNA Binding 23065 Q8N766
EMC8 ER membrane protein complex subunit 8 Human DNA Binding 10328 O43402
EMG1 EMG1 N1-specific pseudouridine methyltransferase Human DNA Binding NM_006331 Q92979
EML1 echinoderm microtubule associated protein like 1 Human DNA Binding 2009 O00423
EML6 echinoderm microtubule associated protein like 6 Human DNA Binding NM_001039753 Q6ZMW3
EMP3 epithelial membrane protein 3 Human DNA Binding NM_001425 A0A024QZF8
ENAH enabled homolog (Drosophila) Human DNA Binding 55740 Q8N8S7
ENO1 enolase 1, (alpha) Human DNA Binding 2023 E2DRY6
ENOPH1 Enolase-phosphatase E1 Human DNA Binding 58478 Q9UHY7
ENOX2 ecto-NOX disulfide-thiol exchanger 2 Human DNA Binding 10495 Q16206
ENSA endosulfine alpha Human DNA Binding 2029 O43768
EP400 E1A binding protein p400 Human DNA Binding 57634 Q96L91
EPB41 erythrocyte membrane protein band 4.1 (elliptocytosis 1, RH-linked) Human DNA Binding 2035 P11171
EPC1 enhancer of polycomb homolog 1 (Drosophila) Human DNA Binding 80314 Q9H2F5
EPC2 enhancer of polycomb homolog 2 (Drosophila) Human DNA Binding 26122 Q52LR7
EPM2A epilepsy, progressive myoclonus type 2A, Lafora disease (laforin) Human DNA Binding 7957 O95278
EPN1 epsin 1 Human DNA Binding NM_013333 Q9Y6I3
EPR1 Human DNA Binding NR_002219
EPRS glutamyl-prolyl-tRNA synthetase Human DNA Binding 2058 P07814
ERAP1 endoplasmic reticulum aminopeptidase 1 Human DNA Binding NM_001040458 Q9NZ08
ERC1 ELKS/RAB6-interacting/CAST family member 1 Human DNA Binding 23085 Q8IUD2
ERCC3 excision repair cross-complementing rodent repair deficiency, complementation group 3 (xeroderma pigmentosum group B complementing) Human DNA Binding 2071 P19447
ERF Ets2 repressor factor Human DNA Binding 2077 P50548
ERH enhancer of rudimentary homolog (Drosophila) Human DNA Binding 2079 P84090
ERI1 exoribonuclease 1 Human DNA Binding 90459 Q8IV48
ERLEC1 endoplasmic reticulum lectin 1 Human DNA Binding 27248 B5MC72
ERLIN1 ER lipid raft associated 1 Human DNA Binding 10613 D3DR65
ERN1 endoplasmic reticulum to nucleus signaling 1 Human DNA Binding NM_001433 O75460
ESCO1 establishment of cohesion 1 homolog 1 (S. cerevisiae) Human DNA Binding 114799 Q5FWF5
ESF1 ESF1, nucleolar pre-rRNA processing protein, homolog (S. cerevisiae) Human DNA Binding 51575 Q9H501
ESYT2 extended synaptotagmin-like protein 2 Human DNA Binding 57488 A0FGR8
ETAA1 Ewing tumor-associated antigen 1 Human DNA Binding 54465 Q9NY74
ETF1 eukaryotic translation termination factor 1 Human DNA Binding 2107 P62495
ETV1 ets variant 1 Human DNA Binding NM_001163148 P50549
ETV3 ets variant 3 Human DNA Binding 2117 P41162
ETV5 ets variant 5 Human DNA Binding 2119 P41161
ETV6 ets variant 6 Human DNA Binding 2120 P41212
EWSR1 Ewing sarcoma breakpoint region 1 Human DNA Binding 2130 Q01844
EXD2 exonuclease 3'-5' domain containing 2 Human DNA Binding 55218 Q9NVH0
EXO1 exonuclease 1 Human DNA Binding 9156 Q9UQ84
EXOC4 exocyst complex component 4 Human DNA Binding 60412 E9PED2
EXOC5 exocyst complex component 5 Human DNA Binding 10640 O00471
EXOC6 exocyst complex component 6 Human DNA Binding 54536 B3KXY5
EXOC7 exocyst complex component 7 Human DNA Binding 23265 Q9UPT5
EXOSC6 exosome component 6 Human DNA Binding 118460 Q5RKV6
EXOSC8 exosome component 8 Human DNA Binding 11340 Q96B26
EXT1 exostosin 1 Human DNA Binding 2131 Q16394
EXTL3 exostosin-like glycosyltransferase 3 Human DNA Binding 2137 O43909
FABP5L3 fatty acid binding protein 5 pseudogene 3 Human DNA Binding NR_002935 A8MUU1
FADS1 fatty acid desaturase 1 Human DNA Binding 3992 O60427
FADS2 fatty acid desaturase 2 Human DNA Binding 9415 O95864
FAIM Fas apoptotic inhibitory molecule Human DNA Binding NM_018147 Q9NVQ4
FAM102A family with sequence similarity 102, member A Human DNA Binding 399665 Q5T9C2
FAM108B1 family with sequence similarity 108, member B1 Human DNA Binding 51104 Q5VST6
FAM108C1 family with sequence similarity 108, member C1 Human DNA Binding 58489 Q6PCB6
FAM110B Protein FAM110B Human DNA Binding 90362 Q8TC76
FAM116A DENN/MADD domain containing 6A Human DNA Binding 201627 Q8IWF6
FAM117B family with sequence similarity 117, member B Human DNA Binding 150864 Q6P1L5
FAM120A family with sequence similarity 120A Human DNA Binding 23196 Q9NZB2
FAM120AOS family with sequence similarity 120A opposite strand Human DNA Binding 158293 Q5T036
FAM122B family with sequence similarity 122B Human DNA Binding 159090 Q7Z309
FAM125A multivesicular body subunit 12A Human DNA Binding 93343 Q96EY5
FAM133B Protein FAM133B Human DNA Binding 728640 Q5BKY9
FAM133DP family with sequence similarity 133, member D, pseudogene Human DNA Binding 728066 NA
FAM134A Protein FAM134A Human DNA Binding 79137 Q8NC44
FAM136A family with sequence similarity 136, member A Human DNA Binding 84908 Q96C01
FAM13A family with sequence similarity 13, member A Human DNA Binding 10144 O94988
FAM13B family with sequence similarity 13, member B Human DNA Binding 51306 Q9NYF5
FAM155A Transmembrane protein FAM155A Human DNA Binding 728215 B1AL88
FAM160B1 family with sequence similarity 160, member B1 Human DNA Binding 57700 Q5W0V3
FAM160B2 family with sequence similarity 160, member B2 Human DNA Binding 64760 Q86V87
FAM164C zinc finger, C2HC-type containing 1C Human DNA Binding NM_001042430 A0A024R6E6
FAM171A1 family with sequence similarity 171, member A1 Human DNA Binding 221061 B3KMX9
FAM172A family with sequence similarity 172, member A Human DNA Binding 83989 Q8WUF8
FAM173A Protein FAM173A Human DNA Binding 65990 Q9BQD7
FAM178A family with sequence similarity 178, member A Human DNA Binding 55719 Q6GMU6
FAM179B family with sequence similarity 179, member B Human DNA Binding 23116 Q9Y4F4
FAM185A family with sequence similarity 185, member A Human DNA Binding 222234 Q8N0U4
FAM189A1 family with sequence similarity 189, member A1 Human DNA Binding 23359 O60320
FAM204A family with sequence similarity 204, member A Human DNA Binding 63877 Q9H8W3
FAM208A Protein FAM208A Human DNA Binding 23272 Q9UK61
FAM20B SLC38A10 Human DNA Binding 9917 O75063
FAM211B Leucine-rich repeat-containing protein 75B Human DNA Binding 388886 Q2VPJ9
FAM219B Protein FAM219B Human DNA Binding 57184 Q5XKK7
FAM36A COX20 cytochrome C oxidase assembly factor Human DNA Binding NM_198076 B3KM21
FAM40A striatin interacting protein 1 Human DNA Binding 85369 Q5VSL9
FAM43A family with sequence similarity 43, member A Human DNA Binding NM_153690 Q8N2R8
FAM47E family with sequence similarity 47, member E Human DNA Binding 100129583 Q6ZV65
FAM55C neurexophilin and PC-esterase domain family, member 3 Human DNA Binding 91775 Q969Y0
FAM57A family with sequence similarity 57, member A Human DNA Binding 79850 Q8TBR7
FAM63A family with sequence similarity 63, member A Human DNA Binding 55793 D3DV11
FAM65A SNTG2 Human DNA Binding 79567 Q6ZS17
FAM69A family with sequence similarity 69, member A Human DNA Binding 388650 Q5T7M9
FAM72A family with sequence similarity 72, member A Human DNA Binding NM_001123168 Q5TYM5
FAM72B family with sequence similarity 72, member B Human DNA Binding NM_001100910 Q86X60
FAM72D family with sequence similarity 72, member D Human DNA Binding NM_207418 Q6L9T8
FAM73A family with sequence similarity 73, member A Human DNA Binding 374986 B4DK63
FAM83B family with sequence similarity 83, member B Human DNA Binding 222584 Q5T0W9
FAM89B family with sequence similarity 89, member B Human DNA Binding 23625 Q8N5H3
FAM92A1 family with sequence similarity 92, member A1 Human DNA Binding 137392 A1XBS5
FANCC Fanconi anemia, complementation group C Human DNA Binding 2176 Q00597
FANCM Fanconi anemia, complementation group M Human DNA Binding 57697 Q8IYD8
FAR1 fatty acyl CoA reductase 1 Human DNA Binding 84188 Q8WVX9
FARS2 phenylalanyl-tRNA synthetase 2, mitochondrial Human DNA Binding 10667 O95363
FASN fatty acid synthase Human DNA Binding 2194 P49327
FASTKD2 FAST kinase domains 2 Human DNA Binding 22868 Q9NYY8
FASTKD3 FAST kinase domains 3 Human DNA Binding 79072 Q14CZ7
FASTKD5 FAST kinase domain-containing protein 5 Human DNA Binding 60493 Q7L8L6
FAT1 FAT tumor suppressor homolog 1 (Drosophila) Human DNA Binding 2195 Q14517
FAT4 FAT atypical cadherin 4 Human DNA Binding NM_024582 B3KU84
FAU Finkel-Biskis-Reilly murine sarcoma virus (FBR-MuSV) ubiquitously expressed Human DNA Binding 2197 P35544
FAXC Failed axon connections homolog Human DNA Binding 84553 Q5TGI0
FBLN1 fibulin 1 Human DNA Binding 2192 P23142
FBXL14 F-box and leucine-rich repeat protein 14 Human DNA Binding 144699 Q8N1E6
FBXL15 F-box and leucine-rich repeat protein 15 Human DNA Binding NM_024326 Q9H469
FBXL17 F-box and leucine-rich repeat protein 17 Human DNA Binding 64839 Q9UF56
FBXL19 F-box and leucine-rich repeat protein 19 Human DNA Binding 54620 Q6PCT2
FBXL19-AS1 FBXL19 antisense RNA 1 (head to head) Human DNA Binding 283932 Q494R0
FBXL2 F-box and leucine-rich repeat protein 2 Human DNA Binding NM_012157 Q9UKC9
FBXL4 F-box and leucine-rich repeat protein 4 Human DNA Binding 26235 Q9UKA2
FBXL5 F-box and leucine-rich repeat protein 5 Human DNA Binding 26234 Q9UKA1
FBXO11 F-box protein 11 Human DNA Binding 80204 Q86XK2
FBXO16 F-box protein 16 Human DNA Binding NM_172366 Q8IX29
FBXO17 F-box protein 17 Human DNA Binding 115290 Q96EF6
FBXO18 F-box protein, helicase, 18 Human DNA Binding 84893 B3KV95
FBXO21 F-box protein 21 Human DNA Binding 23014 O94952
FBXO24 F-box only protein 24 Human DNA Binding 26261 O75426
FBXO28 F-box protein 28 Human DNA Binding 23219 E9PEM8
FBXO33 F-box protein 33 Human DNA Binding 254170 Q7Z6M2
FBXO36 F-box protein 36 Human DNA Binding NM_174899 Q8NEA4
FBXO42 F-box protein 42 Human DNA Binding 54455 Q6P3S6
FBXO43 F-box protein 43 Human DNA Binding NM_001077528 Q4G163
FBXO5 F-box protein 5 Human DNA Binding 26271 Q9UKT4
FBXO7 F-box protein 7 Human DNA Binding 25793 Q9Y3I1
FBXO8 F-box protein 8 Human DNA Binding NM_012180 Q8IXA8
FBXO9 F-box protein 9 Human DNA Binding 26268 Q9UK97
FBXW5 F-box and WD repeat domain containing 5 Human DNA Binding 54661 Q969U6
FCGR1B Fc fragment of IgG, high affinity Ib, receptor (CD64) Human DNA Binding NM_001017986 Q92637
FCGR2A Fc fragment of IgG, low affinity IIa, receptor (CD32) Human DNA Binding NM_001136219 P12318
FCHSD2 FCH and double SH3 domains 2 Human DNA Binding 9873 O94868
FDFT1 farnesyl-diphosphate farnesyltransferase 1 Human DNA Binding 2222 P37268
FDPS farnesyl diphosphate synthase Human DNA Binding 2224 P14324
FDX1L ferredoxin 1-like Human DNA Binding NM_001031734 Q6P4F2
FEM1B fem-1 homolog b (C. elegans) Human DNA Binding 10116 Q9UK73
FER fer (fps/fes related) tyrosine kinase Human DNA Binding 2241 P16591
FGD5-AS1 FGD5 antisense RNA 1 Human DNA Binding 100505641 NA
FGD6 FYVE, RhoGEF and PH domain containing 6 Human DNA Binding 55785 Q6ZV73
FGF9 fibroblast growth factor 9 (glia-activating factor) Human DNA Binding 2254 P31371
FHOD3 formin homology 2 domain containing 3 Human DNA Binding 80206 Q2V2M9
FIP1L1 FIP1 like 1 (S. cerevisiae) Human DNA Binding 81608 B4DIR3
FIS1 fission 1 (mitochondrial outer membrane) homolog (S. cerevisiae) Human DNA Binding 51024 Q9Y3D6
FITM2 fat storage-inducing transmembrane protein 2 Human DNA Binding 128486 Q8N6M3
FIZ1 FLT3-interacting zinc finger 1 Human DNA Binding 84922 Q96SL8
FKBP14 FK506 binding protein 14, 22 kDa Human DNA Binding 55033 Q9NWM8
FKBP1B FK506 binding protein 1B, 12.6 kDa Human DNA Binding NM_054033 P68106
FKBP4 FK506 binding protein 4, 59kDa Human DNA Binding 2288 Q02790
FKBP7 Peptidyl-prolyl cis-trans isomerase FKBP7 Human DNA Binding 51661 Q9Y680
FKRP fukutin related protein Human DNA Binding 79147 Q9H9S5
FLAD1 FAD1 flavin adenine dinucleotide synthetase homolog (S. cerevisiae) Human DNA Binding 80308 Q8NFF5
FLJ10038 Human DNA Binding 55056 NA
FLJ22536 cancer susceptibility candidate 15 (non-protein coding) Human DNA Binding NR_015410
FLJ31306 PSMA3 antisense RNA 1 Human DNA Binding 379025 NA
FLJ33630 long intergenic non-protein coding RNA 1184 Human DNA Binding NR_015360
FLJ37453 cDNA FLJ37453 fis, clone BRAWH2010754 Human DNA Binding 729614 Q8N9F6
FLJ39739 long intergenic non-protein coding RNA 1138 Human DNA Binding NR_027468
FLJ42709 NR2F1 antisense RNA 1 Human DNA Binding 441094 NA
FLOT1 flotillin 1 Human DNA Binding 10211 O75955
FLRT2 Leucine-rich repeat transmembrane protein FLRT2 Human DNA Binding 23768 O43155
FLVCR1 feline leukemia virus subgroup C cellular receptor 1 Human DNA Binding 28982 B2RB38
FLVCR1-AS1 FLVCR1 antisense RNA 1 (head to head) Human DNA Binding 642946 Q8TAF5
FMNL3 formin-like 3 Human DNA Binding 91010 Q8IVF7
FNBP4 formin binding protein 4 Human DNA Binding 23360 B3KNP0
FNDC3A fibronectin type III domain containing 3A Human DNA Binding 22862 Q9Y2H6
FOSL2 FOS-like antigen 2 Human DNA Binding 2355 P15408
FOXJ2 TNIP2 Human DNA Binding 55810 Q9P0K8
FOXJ3 forkhead box J3 Human DNA Binding 22887 Q9UPW0
FOXN2 forkhead box N2 Human DNA Binding 3344 P32314
FOXO1 forkhead box O1 Human DNA Binding 2308 Q12778
FOXO3 forkhead box O3 Human DNA Binding 2309 O43524
FRA10AC1 Protein FRA10AC1 Human DNA Binding 118924 Q70Z53
FRAS1 Fraser syndrome 1 Human DNA Binding 80144 A2RRR8
FRG1 FSHD region gene 1 Human DNA Binding 2483 Q14331
FRS2 fibroblast growth factor receptor substrate 2 Human DNA Binding 10818 Q8WU20
FSD1L fibronectin type III and SPRY domain containing 1-like Human DNA Binding NM_031919 Q8N450
FSIP1 fibrous sheath interacting protein 1 Human DNA Binding NM_152597 A0A024R9J2
FTSJD2 FtsJ methyltransferase domain containing 2 Human DNA Binding 23070 Q8N1G2
FUBP3 far upstream element (FUSE) binding protein 3 Human DNA Binding 8939 Q96I24
FUK TSC1 Human DNA Binding 197258 Q8N0W3
FUNDC2 FUN14 domain containing 2 Human DNA Binding 65991 Q9BWH2
FUS fused in sarcoma Human DNA Binding 2521 P35637
FUT10 fucosyltransferase 10 (alpha (1,3) fucosyltransferase) Human DNA Binding 84750 Q6P4F1
FUT11 fucosyltransferase 11 (alpha (1,3) fucosyltransferase) Human DNA Binding 170384 Q495W5
FUZ fuzzy planar cell polarity protein Human DNA Binding 80199 Q9BT04
FXN frataxin Human DNA Binding 2395 Q16595
FXR1 Fragile X retardation 1 Human DNA Binding 8087 P51114
FYN FYN oncogene related to SRC, FGR, YES Human DNA Binding 2534 P06241
FZD2 frizzled family receptor 2 Human DNA Binding 2535 Q14332
FZD8 frizzled family receptor 8 Human DNA Binding 8325 Q9H461
G3BP2 GTPase activating protein (SH3 domain) binding protein 2 Human DNA Binding 9908 Q9UN86
GABBR1 Human DNA Binding
GABPA GA binding protein transcription factor, alpha subunit 60kDa Human DNA Binding 2551 A8IE48
GABPB1 GA binding protein transcription factor, beta subunit 1 Human DNA Binding 2553 Q06547
GABPB1-AS1 GABPB1 antisense RNA 1 Human DNA Binding 100129387 NA
GAD1 glutamate decarboxylase 1 (brain, 67kDa) Human DNA Binding 2571 Q8IVA8
GADD45A growth arrest and DNA-damage-inducible, alpha Human DNA Binding NM_001924 P24522
GADD45GIP1 growth arrest and DNA-damage-inducible, gamma interacting protein 1 Human DNA Binding 90480 Q8TAE8
GALE UDP-glucose 4-epimerase Human DNA Binding 2582 Q14376
GALK2 galactokinase 2 Human DNA Binding 2585 Q01415
GALNT7 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7) Human DNA Binding 51809 Q86SF2
GALR1 galanin receptor 1 Human DNA Binding NM_001480 P47211
GANC glucosidase, alpha; neutral C Human DNA Binding 2595 Q8TET4
GAPVD1 GTPase activating protein and VPS9 domains 1 Human DNA Binding 26130 B3KN67
GAR1 GAR1 ribonucleoprotein homolog (yeast) Human DNA Binding 54433 Q9NY12
GARS glycyl-tRNA synthetase Human DNA Binding 2617 P41250
GART phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase Human DNA Binding 2618 P22102
GAS1 growth arrest-specific 1 Human DNA Binding 2619 P54826
GAS5 growth arrest-specific 5 (non-protein coding) Human DNA Binding NR_002578
GATAD2B GATA zinc finger domain containing 2B Human DNA Binding 57459 Q8WXI9
GBA WNT2 Human DNA Binding 2629 P04062
GBA2 glucosidase, beta (bile acid) 2 Human DNA Binding 57704 Q9HCG7
GBE1 glucan (1,4-alpha-), branching enzyme 1 Human DNA Binding NM_000158 Q04446
GBF1 golgi brefeldin A resistant guanine nucleotide exchange factor 1 Human DNA Binding 8729 Q92538
GCC1 GRIP and coiled-coil domain containing 1 Human DNA Binding 79571 Q96CN9
GCLM glutamate-cysteine ligase, modifier subunit Human DNA Binding 2730 P48507
GCSH glycine cleavage system protein H (aminomethyl carrier) Human DNA Binding NM_004483 P23434
GDI2 GDP dissociation inhibitor 2 Human DNA Binding 2665 P50395
GEMIN4 gem (nuclear organelle) associated protein 4 Human DNA Binding 50628 P57678
GEMIN5 gem (nuclear organelle) associated protein 5 Human DNA Binding 25929 B7ZLC9
GEMIN7 gem (nuclear organelle) associated protein 7 Human DNA Binding 79760 Q9H840
GEMIN8 gem (nuclear organelle) associated protein 8 Human DNA Binding 54960 Q9NWZ8
GET4 golgi to ER traffic protein 4 homolog (S. cerevisiae) Human DNA Binding 51608 Q7L5D6
GFM2 G elongation factor, mitochondrial 2 Human DNA Binding 84340 Q969S9
GFOD2 glucose-fructose oxidoreductase domain containing 2 Human DNA Binding 81577 Q3B7J2
GGA1 golgi-associated, gamma adaptin ear containing, ARF binding protein 1 Human DNA Binding 26088 Q9UJY5
GGA3 golgi-associated, gamma adaptin ear containing, ARF binding protein 3 Human DNA Binding 23163 Q9NZ52
GGNBP2 gametogenetin binding protein 2 Human DNA Binding 79893 Q9H3C7
GGPS1 geranylgeranyl diphosphate synthase 1 Human DNA Binding 9453 O95749
GHITM growth hormone inducible transmembrane protein Human DNA Binding 27069 Q9H3K2
GID8 Glucose-induced degradation protein 8 homolog Human DNA Binding 54994 Q9NWU2
GIN1 gypsy retrotransposon integrase 1 Human DNA Binding NM_017676 Q9NXP7
GINS1 GINS complex subunit 1 (Psf1 homolog) Human DNA Binding 9837 Q14691
GIT1 G protein-coupled receptor kinase interacting ArfGAP 1 Human DNA Binding 28964 Q59FC3
GJA3 gap junction protein, alpha 3, 46kDa Human DNA Binding 2700 Q9Y6H8
GJA9 gap junction protein, alpha 9, 59kDa Human DNA Binding NM_030772 P57773
GLG1 golgi glycoprotein 1 Human DNA Binding 2734 Q92896
GLOD4 glyoxalase domain containing 4 Human DNA Binding 51031 Q9HC38
GLTSCR1 glioma tumor suppressor candidate region gene 1 Human DNA Binding 29998 Q9NZM4
GLUD1 glutamate dehydrogenase 1 Human DNA Binding 2746 E9KL48
GMFB glia maturation factor, beta Human DNA Binding 2764 P60983
GMNN geminin, DNA replication inhibitor Human DNA Binding 51053 O75496
GMPR2 guanosine monophosphate reductase 2 Human DNA Binding NM_016576 Q9P2T1
GMPS guanine monphosphate synthetase Human DNA Binding 8833 A8K639
GNA13 guanine nucleotide binding protein (G protein), alpha 13 Human DNA Binding 10672 Q14344
GNAL guanine nucleotide binding protein (G protein), alpha activating activity polypeptide, olfactory type Human DNA Binding NM_002071 A8K1Y9
GNB1L guanine nucleotide binding protein (G protein), beta polypeptide 1-like Human DNA Binding 54584 Q9BYB4
GNL3 guanine nucleotide binding protein-like 3 (nucleolar) Human DNA Binding 26354 Q9BVP2
GNL3L guanine nucleotide binding protein-like 3 (nucleolar)-like Human DNA Binding 54552 Q05DU1
GNPAT glyceronephosphate O-acyltransferase Human DNA Binding 8443 O15228
GNPNAT1 glucosamine-phosphate N-acetyltransferase 1 Human DNA Binding 64841 Q96EK6
GNS glucosamine (N-acetyl)-6-sulfatase Human DNA Binding 2799 P15586
GOLGA4 golgin A4 Human DNA Binding 2803 Q13439
GOLGA6L6 golgin A6 family-like 6 Human DNA Binding NM_001145004 A8MZA4
GOLGB1 golgin B1 Human DNA Binding 2804 F1T0J2
GON4L gon-4-like (C. elegans) Human DNA Binding 54856 Q3T8J9
GORAB golgin, RAB6-interacting Human DNA Binding NM_001146039 Q5T7V8
GORASP2 golgi reassembly stacking protein 2, 55kDa Human DNA Binding 26003 Q9H8Y8
GOSR1 golgi SNAP receptor complex member 1 Human DNA Binding 9527 O95249
GOSR2 golgi SNAP receptor complex member 2 Human DNA Binding 9570 O14653
GOT2 glutamic-oxaloacetic transaminase 2, mitochondrial (aspartate aminotransferase 2) Human DNA Binding 2806 P00505
GPATCH1 G patch domain containing 1 Human DNA Binding 55094 Q9BRR8
GPATCH8 G patch domain containing 8 Human DNA Binding 23131 Q9UKJ3
GPBP1 GC-rich promoter binding protein 1 Human DNA Binding 65056 Q86WP2
GPBP1L1 GC-rich promoter binding protein 1-like 1 Human DNA Binding 60313 Q9HC44
GPC1 glypican 1 Human DNA Binding 2817 P35052
GPR101 G protein-coupled receptor 101 Human DNA Binding 83550 Q96P66
GPR108 G protein-coupled receptor 108 Human DNA Binding 56927 Q9NPR9
GPR126 G protein-coupled receptor 126 Human DNA Binding 57211 Q86SQ4
GPR137 Integral membrane protein GPR137 Human DNA Binding 56834 Q96N19
GPR177 wntless Wnt ligand secretion mediator Human DNA Binding NM_024911 Q5T9L3
GPR63 G protein-coupled receptor 63 Human DNA Binding 81491 A8K1C4
GPR84 G protein-coupled receptor 84 Human DNA Binding NM_020370 Q9NQS5
GPSM3 G-protein signaling modulator 3 Human DNA Binding NM_022107 A0A024RCP6
GPX8 glutathione peroxidase 8 (putative) Human DNA Binding 493869 Q8TED1
GRAMD1A GRAM domain containing 1A Human DNA Binding 57655 Q96CP6
GRAP GRB2-related adaptor protein Human DNA Binding NM_006613 Q13588
GRID2 glutamate receptor, ionotropic, delta 2 Human DNA Binding 2895 O43424
GRIN2D glutamate receptor, ionotropic, N-methyl D-aspartate 2D Human DNA Binding 2906 O15399
GRIPAP1 GRIP1 associated protein 1 Human DNA Binding 56850 Q4V328
GRK4 G protein-coupled receptor kinase 4 Human DNA Binding 2868 P32298
GRPEL1 GrpE-like 1, mitochondrial (E. coli) Human DNA Binding 80273 Q9HAV7
GRPEL2 GrpE-like 2, mitochondrial (E. coli) Human DNA Binding 134266 Q8TAA5
GRSF1 G-rich RNA sequence binding factor 1 Human DNA Binding 2926 Q12849
GRWD1 glutamate-rich WD repeat containing 1 Human DNA Binding 83743 Q9BQ67
GSE1 Genetic suppressor element 1 Human DNA Binding 23199 Q14687
GSK3A glycogen synthase kinase 3 alpha Human DNA Binding 2931 P49840
GSPT1 G1 to S phase transition 1 Human DNA Binding 2935 P15170
GSR glutathione reductase Human DNA Binding 2936 P00390
GSTA4 glutathione S-transferase alpha 4 Human DNA Binding NM_001512 A0A024RD58
GSTCD glutathione S-transferase, C-terminal domain containing Human DNA Binding 79807 Q8NEC7
GSTO2 glutathione S-transferase omega 2 Human DNA Binding NM_183239 Q9H4Y5
GTF2A1 general transcription factor IIA, 1, 19/37kDa Human DNA Binding 2957 P52655
GTF2H4 general transcription factor IIH, polypeptide 4, 52kDa Human DNA Binding NM_001517 Q92759
GTF2IRD1 GTF2I repeat domain containing 1 Human DNA Binding 9569 Q9UHL9
GTF3C4 general transcription factor IIIC, polypeptide 4, 90kDa Human DNA Binding 9329 B3KNH2
GTPBP1 GTP binding protein 1 Human DNA Binding 9567 O00178
GTPBP3 GTP binding protein 3 (mitochondrial) Human DNA Binding 84705 B7Z563
GTSF1 gametocyte specific factor 1 Human DNA Binding NM_144594 A0A024RB57
GUCD1 Protein GUCD1 Human DNA Binding 83606 Q96NT3
GULP1 GULP, engulfment adaptor PTB domain containing 1 Human DNA Binding 51454 Q9UBP9
H19 H19 fetal liver mRNA Human DNA Binding 14955 N/A
H1FX H1 histone family, member X Human DNA Binding 8971 Q92522
H1FX-AS1 H1FX antisense RNA 1 Human DNA Binding 339942 Q4G0G2
H2AFV H2A histone family, member V Human DNA Binding 94239 Q71UI9
H2AFY2 Core histone macro-H2A.2 Human DNA Binding 55506 Q9P0M6
H2AFZ H2A histone family, member Z Human DNA Binding 3015 P0C0S5
H3F3AP4 H3 histone, family 3A, pseudogene 4 Human DNA Binding 440926 NA
HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 Human DNA Binding 57531 Q8IYU2
HAND1 heart and neural crest derivatives expressed 1 Human Direct Regulation 15110 O96004
HAUS1 HAUS augmin-like complex, subunit 1 Human DNA Binding 115106 Q96CS2
HBS1L HBS1-like (S. cerevisiae) Human DNA Binding 10767 Q9Y450
HCFC1 host cell factor C1 (VP16-accessory protein) Human DNA Binding 3054 P51610
HCFC2 host cell factor C2 Human DNA Binding 29915 Q9Y5Z7
HDGF hepatoma-derived growth factor Human DNA Binding 3068 P51858
HEATR2 HEAT repeat containing 2 Human DNA Binding 54919 B3KPE2
HEATR6 HEAT repeat containing 6 Human DNA Binding 63897 Q6AI08
HEBP1 heme binding protein 1 Human DNA Binding NM_015987 A0A024RAS8
HECTD1 HECT domain containing E3 ubiquitin protein ligase 1 Human DNA Binding 25831 Q9ULT8
HECTD2 HECT domain containing E3 ubiquitin protein ligase 2 Human DNA Binding 143279 B3KV18
HELLS helicase, lymphoid-specific Human DNA Binding 3070 Q9NRZ9
HELZ helicase with zinc finger Human DNA Binding 9931 P42694
HERC3 HECT and RLD domain containing E3 ubiquitin protein ligase 3 Human DNA Binding 8916 B4DK41
HERC4 HECT and RLD domain containing E3 ubiquitin protein ligase 4 Human DNA Binding 26091 Q5GLZ8
HES7 hes family bHLH transcription factor 7 Human DNA Binding NM_001165967 Q9BYE0
HEXIM2 hexamethylene bis-acetamide inducible 2 Human DNA Binding 124790 Q96MH2
HEY1 hes-related family bHLH transcription factor with YRPW motif 1 Human DNA Binding NM_012258 Q9Y5J3
HFE hemochromatosis Human DNA Binding 3077 Q30201
HHLA3 HERV-H LTR-associating 3 Human DNA Binding NM_001036646 Q9XRX5
HIAT1 hippocampus abundant transcript 1 Human DNA Binding 64645 Q96MC6
HINT2 histidine triad nucleotide binding protein 2 Human DNA Binding NM_032593 Q9BX68
HIPK2 homeodomain interacting protein kinase 2 Human DNA Binding 28996 Q9H2X6
HIPK3 Human DNA Binding
HIRA HIR histone cell cycle regulation defective homolog A (S. cerevisiae) Human DNA Binding 7290 P54198
HIST1H1B histone cluster 1, H1b Human DNA Binding 3009 P16401
HIST1H1C histone cluster 1, H1c Human DNA Binding 3006 P16403
HIST1H2AB histone cluster 1, H2ab Human DNA Binding 8335 P04908
HIST1H2AC histone cluster 1, H2ac Human DNA Binding 8334 Q93077
HIST1H2AG histone cluster 1, H2ag Human DNA Binding 8969 A4FTV9
HIST1H2AI histone cluster 1, H2ai Human DNA Binding 8329 A4FTV9
HIST1H2BF histone cluster 1, H2bf Human DNA Binding 8343 B2R4S9
HIST1H2BH histone cluster 1, H2bh Human DNA Binding NM_003524 Q93079
HIST1H2BJ histone cluster 1, H2bj Human DNA Binding 8970 P06899
HIST1H2BL histone cluster 1, H2bl Human DNA Binding NM_003519 Q99880
HIST1H2BN histone cluster 1, H2bn Human DNA Binding 8341 Q99877
HIST1H2BO histone cluster 1, H2bo Human DNA Binding 8348 P23527
HIST1H3B histone cluster 1, H3b Human DNA Binding 8358 P68431
HIST1H3D histone cluster 1, H3d Human DNA Binding 8351 P68431
HIST1H3E histone cluster 1, H3e Human DNA Binding 8353 P68431
HIST1H3F histone cluster 1, H3f Human DNA Binding 8968 P68431
HIST1H3H histone cluster 1, H3h Human DNA Binding 8357 P68431
HIST1H4B histone cluster 1, H4b Human DNA Binding 8366 B2R4R0
HIST1H4C histone cluster 1, H4c Human DNA Binding 8364 B2R4R0
HIST1H4E histone cluster 1, H4e Human DNA Binding 8367 B2R4R0
HIST1H4J histone cluster 1, H4j Human DNA Binding 8363 B2R4R0
HIST1H4K histone cluster 1, H4k Human DNA Binding 8362 B2R4R0
HIST2H2AA3 histone cluster 2, H2aa3 Human DNA Binding 8337 Q6FI13
HIST2H2AB histone cluster 2, H2ab Human DNA Binding 317772 Q8IUE6
HIST2H2AC histone cluster 2, H2ac Human DNA Binding 8338 Q16777
HJURP Holliday junction recognition protein Human DNA Binding 55355 Q8NCD3
HMBOX1 homeobox containing 1 Human DNA Binding 79618 Q6NT76
HMBS hydroxymethylbilane synthase Human DNA Binding NM_000190 P08397
HMG20A high mobility group 20A Human DNA Binding 10363 Q9NP66
HMGB1 high-mobility group box 1 Human DNA Binding 3146 P09429
HMGB2 high mobility group box 2 Human DNA Binding 3148 P26583
HMGN1 high mobility group nucleosome binding domain 1 Human DNA Binding 3150 P05114
HMGN2 high mobility group nucleosomal binding domain 2 Human DNA Binding 3151 P05204
HMGN4 high mobility group nucleosomal binding domain 4 Human DNA Binding 10473 O00479
HMGXB4 HMG box domain containing 4 Human DNA Binding 10042 Q7Z641
HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 Human DNA Binding 3178 P09651
HNRNPA1P10 heterogeneous nuclear ribonucleoprotein A1 pseudogene 10 Human DNA Binding 664709 NA
HNRNPA3 heterogeneous nuclear ribonucleoprotein A3 Human DNA Binding 220988 P51991
HNRNPC heterogeneous nuclear ribonucleoprotein C (C1/C2) Human DNA Binding 3183 P07910
HNRNPH3 heterogeneous nuclear ribonucleoprotein H3 (2H9) Human DNA Binding 3189 P31942
HNRNPR heterogeneous nuclear ribonucleoprotein R Human DNA Binding 10236 O43390
HNRNPUL1 heterogeneous nuclear ribonucleoprotein U-like 1 Human DNA Binding 11100 Q9BUJ2
HNRNPUL2-BSCL2 HNRNPUL2-BSCL2 readthrough (NMD candidate) Human DNA Binding 100534595 NA
HNRPA1L-2 heterogeneous nuclear ribonucleoprotein A1 pseudogene 10 Human DNA Binding NR_002944
HNRPDL heterogeneous nuclear ribonucleoprotein D-like Human DNA Binding 9987 O14979
HNRPLL heterogeneous nuclear ribonucleoprotein L-like Human DNA Binding 92906 A8K894
HOMER3 homer homolog 3 (Drosophila) Human DNA Binding 9454 Q9NSC5
HOMEZ homeobox and leucine zipper encoding Human DNA Binding NM_020834 Q8IX15
HOXA2 homeobox A2 Human DNA Binding 3199 O43364
HOXA3 homeobox A3 Human DNA Binding 3200 O43365
HOXB2 homeobox B2 Human DNA Binding 3212 P14652
HOXB3 homeobox B3 Human DNA Binding 3213 B3KNJ7
HOXB4 homeobox B4 Human DNA Binding NM_024015 P17483
HOXB7 homeobox B7 Human DNA Binding 3217 P09629
HOXB8 homeobox B8 Human DNA Binding NM_024016 P17481
HOXB9 homeobox B9 Human DNA Binding NM_024017 B3KPJ1
HOXC10 homeobox C10 Human DNA Binding NM_017409 Q53XI4
HOXC6 homeobox C6 Human DNA Binding 3223 P09630
HOXC9 homeobox C9 Human DNA Binding NM_006897 A0A024RAZ6
HP1BP3 heterochromatin protein 1, binding protein 3 Human DNA Binding 50809 Q5SSJ5
HPD 4-hydroxyphenylpyruvate dioxygenase Human DNA Binding 3242 P32754
HPS4 Hermansky-Pudlak syndrome 4 Human DNA Binding 89781 A8K2E6
HSD17B11 hydroxysteroid (17-beta) dehydrogenase 11 Human DNA Binding NM_016245 Q8NBQ5
HSD17B14 hydroxysteroid (17-beta) dehydrogenase 14 Human DNA Binding NM_016246 Q9BPX1
HSP90AB1 heat shock protein 90kDa alpha (cytosolic), class B member 1 Human DNA Binding 3326 P08238
HSPA6 heat shock 70kDa protein 6 (HSP70B') Human DNA Binding 3310 P17066
HSPA8 heat shock 70kDa protein 8 Human DNA Binding 3312 P11142
HSPBAP1 HSPB1-associated protein 1 Human DNA Binding 79663 Q96EW2
HSPBP1 HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1 Human DNA Binding 23640 Q9NZL4
HSPE1 heat shock 10kDa protein 1 (chaperonin 10) Human DNA Binding 3336 P61604
HUNK hormonally up-regulated Neu-associated kinase Human DNA Binding 30811 P57058
HUS1 HUS1 checkpoint homolog (S. pombe) Human DNA Binding 3364 A4D2F2
IARS isoleucyl-tRNA synthetase Human DNA Binding 3376 P41252
IBA57 IBA57, iron-sulfur cluster assembly homolog (S. cerevisiae) Human DNA Binding 200205 Q5T440
IBTK inhibitor of Bruton agammaglobulinemia tyrosine kinase Human DNA Binding 25998 Q9P2D0
ICA1L islet cell autoantigen 1,69kDa-like Human DNA Binding NM_178231 A0A024R3W3
ICK intestinal cell (MAK-like) kinase Human DNA Binding 22858 Q9UPZ9
ICT1 immature colon carcinoma transcript 1 Human DNA Binding 3396 Q14197
ID1 inhibitor of DNA binding 1, dominant negative helix-loop-helix protein Human DNA Binding 3397 P41134
ID3 inhibitor of DNA binding 3, dominant negative helix-loop-helix protein Human DNA Binding 3399 Q02535
IER2 immediate early response 2 Human DNA Binding 9592 Q9BTL4
IER3IP1 immediate early response 3 interacting protein 1 Human DNA Binding 51124 Q9Y5U9
IER5 immediate early response 5 Human DNA Binding 51278 Q5VY09
IFFO2 intermediate filament family orphan 2 Human DNA Binding 126917 Q5TF58
IFRD1 interferon-related developmental regulator 1 Human DNA Binding 3475 A4D0U1
IFRD2 interferon-related developmental regulator 2 Human DNA Binding 7866 Q12894
IFT52 intraflagellar transport 52 homolog (Chlamydomonas) Human DNA Binding 51098 Q9Y366
IFT74 intraflagellar transport 74 Human DNA Binding NM_001099222 A0PJM7
IFT80 intraflagellar transport 80 homolog (Chlamydomonas) Human DNA Binding 57560 Q9P2H3
IGDCC3 Immunoglobulin superfamily DCC subclass member 3 Human DNA Binding 9543 Q8IVU1
IGF2BP1 insulin-like growth factor 2 mRNA binding protein 1 Human DNA Binding 10642 Q9NZI8
IGF2BP3 insulin-like growth factor 2 mRNA binding protein 3 Human DNA Binding 10643 O00425
IGFBP3 insulin-like growth factor binding protein 3 Human DNA Binding NM_000598 B3KPF0
IGFL4 IGF-like family member 4 Human DNA Binding NM_001002923 Q6B9Z1
IGHMBP2 immunoglobulin mu binding protein 2 Human DNA Binding 3508 P38935
IKBIP IKBKB interacting protein Human DNA Binding 121457 Q70UQ0
IKBKAP inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein Human DNA Binding 8518 O95163
IKBKB inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta Human DNA Binding 3551 O14920
IKZF5 IKAROS family zinc finger 5 (Pegasus) Human DNA Binding 64376 Q9H5V7
IL6ST interleukin 6 signal transducer (gp130, oncostatin M receptor) Human DNA Binding 3572 P40189
ILF2 interleukin enhancer binding factor 2 Human DNA Binding 3608 Q12905
ILF3 interleukin enhancer binding factor 3, 90kDa Human DNA Binding 3609 Q12906
IMAA solute carrier family 7 (amino acid transporter light chain, L system), member 5 pseudogene 2 Human DNA Binding NR_002594 Q9GIP4
IMMP1L IMP1 inner mitochondrial membrane peptidase-like (S. cerevisiae) Human DNA Binding 196294 Q96LU5
IMP4 IMP4, U3 small nucleolar ribonucleoprotein, homolog (yeast) Human DNA Binding 92856 Q3ZTT3
IMPA2 inositol(myo)-1(or 4)-monophosphatase 2 Human DNA Binding NM_014214 O14732
IMPDH1 IMP (inosine 5'-monophosphate) dehydrogenase 1 Human DNA Binding 3614 A4D0Z6
INA internexin neuronal intermediate filament protein, alpha Human DNA Binding 9118 Q16352
ING1 inhibitor of growth family, member 1 Human DNA Binding 3621 Q9UK53
ING3 inhibitor of growth family, member 3 Human DNA Binding 54556 Q9NXR8
ING4 inhibitor of growth family, member 4 Human DNA Binding NM_001127583 Q9UNL4
INHBC inhibin, beta C Human DNA Binding NM_005538 P55103
INO80 INO80 homolog (S. cerevisiae) Human DNA Binding 54617 Q9NUK2
INO80C INO80 complex subunit C Human DNA Binding NM_194281 Q6PI98
INO80D INO80 complex subunit D Human DNA Binding 54891 Q53TQ3
INSIG2 insulin induced gene 2 Human DNA Binding NM_016133 A0A024RAI2
INSR insulin receptor Human DNA Binding 3643 P06213
INTS2 integrator complex subunit 2 Human DNA Binding 57508 Q9H0H0
INTS6 integrator complex subunit 6 Human DNA Binding 26512 Q9UL03
INTS8 integrator complex subunit 8 Human DNA Binding 55656 Q75QN2
INTS9 integrator complex subunit 9 Human DNA Binding 55756 Q9NV88
INVS inversin Human DNA Binding 27130 Q2M1I4
IP6K2 inositol hexakisphosphate kinase 2 Human DNA Binding 51447 B2RCP4
IPO11 importin 11 Human DNA Binding 51194 Q9UI26
IPO7 importin 7 Human DNA Binding 10527 B3KNG9
IQCG IQ motif containing G Human DNA Binding NM_032263 Q9H095
IRAK1BP1 interleukin-1 receptor-associated kinase 1 binding protein 1 Human DNA Binding NM_001010844 Q5VVH5
IRF2 interferon regulatory factor 2 Human DNA Binding 3660 P14316
IRF2BP1 interferon regulatory factor 2 binding protein 1 Human DNA Binding 26145 Q8IU81
IRF2BPL interferon regulatory factor 2 binding protein-like Human DNA Binding 64207 Q9H1B7
IRF8 interferon regulatory factor 8 Human Direct Regulation 3394 Q02556
IRGQ immunity-related GTPase family, Q Human DNA Binding 126298 Q8WZA9
IRS2 insulin receptor substrate 2 Human DNA Binding 8660 Q9P084
ISCU iron-sulfur cluster scaffold homolog (E. coli) Human DNA Binding 23479 Q9H1K1
ISG20L2 interferon stimulated exonuclease gene 20kDa-like 2 Human DNA Binding 81875 Q9H9L3
ISL2 ISL LIM homeobox 2 Human DNA Binding 64843 Q96A47
IST1 IST1 homolog Human DNA Binding 9798 P53990
ITFG1 integrin alpha FG-GAP repeat containing 1 Human DNA Binding 81533 Q8TB96
ITFG2 Integrin-alpha FG-GAP repeat-containing protein 2 Human DNA Binding 55846 Q969R8
ITFG3 integrin alpha FG-GAP repeat containing 3 Human DNA Binding 83986 Q9H0X4
ITGB1 integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12) Human DNA Binding 3688 P05556
ITPK1 inositol-tetrakisphosphate 1-kinase Human DNA Binding 3705 Q13572
ITPKC inositol-trisphosphate 3-kinase C Human DNA Binding 80271 Q96DU7
ITSN1 intersectin 1 (SH3 domain protein) Human DNA Binding 6453 Q15811
JARID2 jumonji, AT rich interactive domain 2 Human DNA Binding 3720 Q92833
JMJD5 lysine (K)-specific demethylase 8 Human DNA Binding NM_001145348 Q8N371
JMY junction mediating and regulatory protein, p53 cofactor Human DNA Binding 133746 Q8N9B5
JRKL jerky homolog-like (mouse) Human DNA Binding 8690 Q9Y4A0
JTB jumping translocation breakpoint Human DNA Binding 10899 O76095
JUB ajuba LIM protein Human DNA Binding 84962 Q96IF1
JUND jun D proto-oncogene Human DNA Binding 3727 P17535
KAAG1 kidney associated antigen 1 Human DNA Binding NM_181337 Q9UBP8
KANSL1 KAT8 regulatory NSL complex subunit 1 Human DNA Binding 284058 Q7Z3B3
KANSL1-AS1 KANSL1 antisense RNA 1 Human DNA Binding 644246 NA
KAT6A K(lysine) acetyltransferase 6A Human DNA Binding 7994 A5PKX7
KAT6B K(lysine) acetyltransferase 6B Human DNA Binding 23522 B2RWN8
KATNA1 katanin p60 (ATPase containing) subunit A 1 Human DNA Binding 11104 O75449
KAZALD1 Kazal-type serine peptidase inhibitor domain 1 Human DNA Binding 81621 Q96I82
KBTBD2 kelch repeat and BTB (POZ) domain containing 2 Human DNA Binding 25948 Q8IY47
KBTBD3 Kelch repeat and BTB domain-containing protein 3 Human DNA Binding 143879 Q8NAB2
KBTBD4 kelch repeat and BTB (POZ) domain containing 4 Human DNA Binding 55709 Q9NVX7
KCMF1 potassium channel modulatory factor 1 Human DNA Binding 56888 Q9P0J7
KCNG3 potassium voltage-gated channel, subfamily G, member 3 Human DNA Binding 170850 Q8TAE7
KCNH1 potassium voltage-gated channel, subfamily H (eag-related), member 1 Human DNA Binding NM_002238 O95259
KCTD1 potassium channel tetramerisation domain containing 1 Human DNA Binding 284252 Q719H9
KCTD15 potassium channel tetramerisation domain containing 15 Human DNA Binding 79047 Q96SI1
KCTD20 potassium channel tetramerisation domain containing 20 Human DNA Binding 222658 Q7Z5Y7
KCTD3 potassium channel tetramerisation domain containing 3 Human DNA Binding 51133 Q9Y597
KDELC1 KDEL (Lys-Asp-Glu-Leu) containing 1 Human DNA Binding 79070 Q6UW63
KDELC2 KDEL (Lys-Asp-Glu-Leu) containing 2 Human DNA Binding 143888 Q7Z4H8
KDELR2 KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2 Human DNA Binding 11014 P33947
KDM1A lysine (K)-specific demethylase 1A Human DNA Binding 23028 O60341
KDM2A lysine (K)-specific demethylase 2A Human DNA Binding 22992 D4QA03
KDM2B lysine (K)-specific demethylase 2B Human DNA Binding 84678 Q8NHM5
KDM3A lysine (K)-specific demethylase 3A Human DNA Binding 55818 Q9Y4C1
KDM3B lysine (K)-specific demethylase 3B Human DNA Binding 51780 Q7LBC6
KDM4A lysine (K)-specific demethylase 4A Human DNA Binding 9682 O75164
KDM4C lysine (K)-specific demethylase 4C Human DNA Binding 23081 Q9H3R0
KDM4D lysine (K)-specific demethylase 4D Human DNA Binding 55693 Q6B0I6
KDM5A lysine (K)-specific demethylase 5A Human DNA Binding 5927 P29375
KDM5B-AS1 prostate cancer associated transcript 6 (non-protein coding) Human DNA Binding 100506696 NA
KDM6A lysine (K)-specific demethylase 6A Human DNA Binding 7403 O15550
KDSR 3-ketodihydrosphingosine reductase Human DNA Binding 2531 Q06136
KIAA0101 KIAA0101 Human DNA Binding 9768 A6NNU5
KIAA0182 Gse1 coiled-coil protein Human DNA Binding 23199 Q14687
KIAA0195 KIAA0195 Human DNA Binding 9772 Q12767
KIAA0232 KIAA0232 Human DNA Binding 9778 Q92628
KIAA0317 apoptosis resistant E3 ubiquitin protein ligase 1 Human DNA Binding NM_001039479 O15033
KIAA0355 KIAA0355 Human DNA Binding 9710 O15063
KIAA0391 KIAA0391 Human DNA Binding 9692 O15091
KIAA0406 TELO2 interacting protein 1 Human DNA Binding NM_014657 O43156
KIAA0415 adaptor-related protein complex 5, zeta 1 subunit Human DNA Binding 9907 O43299
KIAA0495 TP73 antisense RNA 1 Human DNA Binding NM_207306 Q9UF72
KIAA0564 von Willebrand factor A domain containing 8 Human DNA Binding 23078 A3KMH1
KIAA0586 KIAA0586 Human DNA Binding 9786 Q6UV20
KIAA0753 KIAA0753 Human DNA Binding 9851 Q2KHM9
KIAA0907 KIAA0907 Human DNA Binding 22889 Q7Z7F0
KIAA0913 zinc finger, SWIM-type containing 8 Human DNA Binding NM_015037 A7E2V4
KIAA1267 KAT8 regulatory NSL complex subunit 1 Human DNA Binding 284058 Q7Z3B3
KIAA1310 KAT8 regulatory NSL complex subunit 3 Human DNA Binding 55683 Q9P2N6
KIAA1429 KIAA1429 Human DNA Binding 25962 Q69YN4
KIAA1430 cilia and flagella associated protein 97 Human DNA Binding NM_020827 Q9P2B7
KIAA1524 KIAA1524 Human DNA Binding 57650 Q8TCG1
KIAA1539 family with sequence similarity 214, member B Human DNA Binding NM_025182 Q7L5A3
KIAA1549 KIAA1549 Human DNA Binding 57670 Q9HCM3
KIAA1551 Uncharacterized protein KIAA1551 Human DNA Binding 55196 Q9HCM1
KIAA1586 KIAA1586 Human DNA Binding 57691 Q9HCI6
KIAA1737 KIAA1737 Human DNA Binding 85457 Q9C0C6
KIAA1958 KIAA1958 Human DNA Binding 158405 Q8N8K9
KIAA1984-AS1 CCDC183 antisense RNA 1 Human DNA Binding 100131193 NA
KIAA2026 KIAA2026 Human DNA Binding 158358 Q5HYC2
KIF11 kinesin family member 11 Human DNA Binding 3832 P52732
KIF13A kinesin family member 13A Human DNA Binding 63971 Q9H1H9
KIF18A kinesin family member 18A Human DNA Binding 81930 Q8NI77
KIF1B kinesin family member 1B Human DNA Binding 23095 O60333
KIF20B kinesin family member 20B Human DNA Binding 9585 Q96Q89
KIF27 kinesin family member 27 Human DNA Binding NM_017576 Q86VH2
KIF3C kinesin family member 3C Human DNA Binding 3797 O14782
KIF9-AS1 KIF9 antisense RNA 1 Human DNA Binding 285352 NA
KIFC1 kinesin family member C1 Human DNA Binding 3833 Q9BW19
KISS1R KISS1 receptor Human DNA Binding NM_032551 Q969F8
KLC1 kinesin light chain 1 Human DNA Binding 3831 Q07866
KLC2 kinesin light chain 2 Human DNA Binding 64837 Q9H0B6
KLF12 Kruppel-like factor 12 Human DNA Binding 11278 Q8WWI3
KLF7 Krueppel-like factor 7 Human DNA Binding 8609 O75840
KLHDC2 kelch domain containing 2 Human DNA Binding 23588 Q9Y2U9
KLHL18 kelch-like family member 18 Human DNA Binding 23276 O94889
KLHL21 kelch-like family member 21 Human DNA Binding 9903 Q9UJP4
KLHL24 kelch-like family member 24 Human DNA Binding 54800 Q6TFL4
KLHL28 kelch-like 28 (Drosophila) Human DNA Binding 54813 Q9NXS3
KLHL35 Kelch-like protein 35 Human DNA Binding 283212 Q6PF15
KLHL42 kelch-like family member 42 Human DNA Binding 57542 B2RNT7
KLHL8 kelch-like family member 8 Human DNA Binding 57563 Q49A95
KLLN Killin Human DNA Binding 100144748 B2CW77
KNTC1 kinetochore associated 1 Human DNA Binding 9735 P50748
KPNA1 karyopherin alpha 1 (importin alpha 5) Human DNA Binding 3836 P52294
KPNA4 karyopherin alpha 4 (importin alpha 3) Human DNA Binding 3840 O00629
KPNA5 karyopherin alpha 5 (importin alpha 6) Human DNA Binding 3841 O15131
KPNA6 karyopherin alpha 6 (importin alpha 7) Human DNA Binding 23633 O60684
KPTN kaptin (actin binding protein) Human DNA Binding 11133 Q9Y664
KRIT1 KRIT1, ankyrin repeat containing Human DNA Binding NM_004912 O00522
KRR1 KRR1, small subunit (SSU) processome component, homolog (yeast) Human DNA Binding 11103 Q13601
LACE1 lactation elevated 1 Human DNA Binding 246269 Q8WV93
LANCL1 LanC lantibiotic synthetase component C-like 1 (bacterial) Human DNA Binding 10314 O43813
LANCL2 LanC lantibiotic synthetase component C-like 2 (bacterial) Human DNA Binding 55915 B3KTN5
LAPTM4B lysosomal protein transmembrane 4 beta Human DNA Binding 55353 Q86VI4
LARP7 La ribonucleoprotein domain family, member 7 Human DNA Binding NM_015454 Q4G0J3
LAS1L LAS1-like (S. cerevisiae) Human DNA Binding 81887 Q9Y4W2
LASP1 LIM and SH3 protein 1 Human DNA Binding NM_006148 B4DIC4
LASS5 ceramide synthase 5 Human DNA Binding NM_147190 Q8N5B7
LBR lamin B receptor Human DNA Binding 3930 Q14739
LCA5 Leber congenital amaurosis 5 Human DNA Binding 167691 Q86VQ0
LCMT1 leucine carboxyl methyltransferase 1 Human DNA Binding NM_016309 Q9UIC8
LCORL Ligand-dependent nuclear receptor corepressor-like protein Human DNA Binding 254251 Q8N3X6
LDB1 LIM domain binding 1 Human DNA Binding 8861 Q86U70
LDHA lactate dehydrogenase A Human DNA Binding 3939 P00338
LDLRAD4 Low-density lipoprotein receptor class A domain-containing protein 4 Human DNA Binding 753 O15165
LENG1 leukocyte receptor cluster (LRC) member 1 Human DNA Binding NM_024316 Q96BZ8
LENG9 leukocyte receptor cluster (LRC) member 9 Human DNA Binding NM_198988 Q96B70
LETM2 leucine zipper-EF-hand containing transmembrane protein 2 Human DNA Binding 137994 Q2VYF4
LIAS lipoic acid synthetase Human DNA Binding NM_194451 O43766
LIG3 ligase III, DNA, ATP-dependent Human DNA Binding 3980 E5KLB6
LIG4 ligase IV, DNA, ATP-dependent Human DNA Binding 3981 P49917
LIMD1-AS1 LIMD1 antisense RNA 1 Human DNA Binding 644714 NA
LIMD2 LIM domain-containing protein 2 Human DNA Binding 80774 Q9BT23
LIMS1 LIM and senescent cell antigen-like domains 1 Human DNA Binding 3987 P48059
LIN28B lin-28 homolog B (C. elegans) Human DNA Binding 389421 Q6ZN17
LIN52 lin-52 DREAM MuvB core complex component Human DNA Binding NM_001024674 B3KN83
LIN7B lin-7 homolog B (C. elegans) Human DNA Binding NM_022165 Q9HAP6
LINC00167 long intergenic non-protein coding RNA 167 Human DNA Binding 440072 Q96N53
LINC00461 long intergenic non-protein coding RNA 461 Human DNA Binding 645323 NA
LINS lines homolog (Drosophila) Human DNA Binding 55180 Q8NG48
LIPT1 lipoyltransferase 1 Human DNA Binding NM_145198 Q9Y234
LMAN2 lectin, mannose-binding 2 Human DNA Binding 10960 Q12907
LMAN2L lectin, mannose-binding 2-like Human DNA Binding 81562 Q9H0V9
LMBR1 limb region 1 homolog (mouse) Human DNA Binding 64327 Q8WVP7
LMTK2 lemur tyrosine kinase 2 Human DNA Binding 22853 Q8IWU2
LNPEP leucyl/cystinyl aminopeptidase Human DNA Binding 4012 Q9UIQ6
LOC100009676 ZBTB11 antisense RNA 1 Human DNA Binding NR_024407
LOC100128164 Human DNA Binding 100128164 NA
LOC100128191 TMPO antisense RNA 1 Human DNA Binding NR_027157
LOC100128398 cDNA FLJ37429 fis, clone BRAWH2001666 Human DNA Binding 100128398 Q8N9G5
LOC100128788 SRRM2 antisense RNA 1 Human DNA Binding NR_027275
LOC100128822 long intergenic non-protein coding RNA 1003 Human DNA Binding 100128822 NA
LOC100129250 TOPORS antisense RNA 1 Human DNA Binding 100129250 NA
LOC100129361 small integral membrane protein 10 like 1 Human DNA Binding 100129361 NA
LOC100129387 GABPB1 antisense RNA 1 Human DNA Binding NR_024490
LOC100129716 ARRDC3 antisense RNA 1 Human DNA Binding NR_027435
LOC100129722 C9orf173 antisense RNA 1 Human DNA Binding 100129722 NA
LOC100129726 long intergenic non-protein coding RNA 1126 Human DNA Binding NR_027251
LOC100129961 CCNT2 antisense RNA 1 Human DNA Binding 100129961 NA
LOC100130155 MIR124-2 host gene Human DNA Binding 100130155 NA
LOC100130522 PARD6G antisense RNA 1 Human DNA Binding NR_028339
LOC100130581 long intergenic non-protein coding RNA 910 Human DNA Binding NR_027412
LOC100131691 MZF1 antisense RNA 1 Human DNA Binding NR_027334
LOC100133091 Human DNA Binding NR_029411
LOC100133315 Putative short transient receptor potential channel 2-like protein Human DNA Binding NR_029192 Q6ZNB5
LOC100133612 long intergenic non-protein coding RNA 1134 Human DNA Binding 100133612 NA
LOC100216545 KMT2E antisense RNA 1 (head to head) Human DNA Binding NR_024586
LOC100272217 Human DNA Binding 100272217 NA
LOC100289230 Human DNA Binding 100289230 NA
LOC100289361 Human DNA Binding 100289361 NA
LOC100289509 KCNIP2 antisense RNA 1 Human DNA Binding 100289509 NA
LOC100289511 Human DNA Binding NR_029378
LOC100302401 RASAL2 antisense RNA 1 Human DNA Binding NR_027982
LOC100306951 PITPNA antisense RNA 1 Human DNA Binding NR_028514
LOC100499489 Human DNA Binding 100499489 NA
LOC100506421 long intergenic non-protein coding RNA 1158 Human DNA Binding 100506421 NA
LOC100506714 NUP50 antisense RNA 1 (head to head) Human DNA Binding 100506714 NA
LOC100506834 Human DNA Binding 100506834 NA
LOC100507217 long intergenic non-protein coding RNA 1578 Human DNA Binding 100507217 NA
LOC100507266 STX18 antisense RNA 1 (head to head) Human DNA Binding 100507266 NA
LOC100507557 Human DNA Binding 100507557 NA
LOC100507634 Human DNA Binding 100507634 NA
LOC100630918 Human DNA Binding 100630918 NA
LOC145783 Human DNA Binding 145783 NA
LOC150381 PRR34 antisense RNA 1 Human DNA Binding NR_027034
LOC153684 Human DNA Binding NR_015447
LOC202781 PAXIP1 antisense RNA 1 (head to head) Human DNA Binding 202781 NA
LOC254100 SSSCA1 antisense RNA 1 (head to head) Human DNA Binding 254100 NA
LOC254128 NIFK antisense RNA 1 Human DNA Binding 254128 NA
LOC256880 Human DNA Binding 256880 NA
LOC282997 PDCD4 antisense RNA 1 Human DNA Binding 282997 NA
LOC285550 family with sequence similarity 200, member B Human DNA Binding NM_001145191 P0CF97
LOC285696 HCG1815023 Human DNA Binding 285696 Q8NB94
LOC286016 triosephosphate isomerase 1 pseudogene 2 Human DNA Binding NR_002187
LOC286190 LACTB2 antisense RNA 1 Human DNA Binding 286190 NA
LOC338799 long intergenic non-protein coding RNA 1089 Human DNA Binding NR_002809
LOC344967 Putative cytosolic acyl coenzyme A thioester hydrolase-like Human DNA Binding 344967 Q6ZUV0
LOC388692 Human DNA Binding NR_027002
LOC388789 long intergenic non-protein coding RNA 493 Human DNA Binding NR_015432
LOC389791 Putative uncharacterized protein FLJ37218 Human DNA Binding 389791 Q8N1Y9
LOC400027 long intergenic non-protein coding RNA 938 Human DNA Binding NR_028408
LOC400657 long intergenic non-protein coding RNA 909 Human DNA Binding 400657 NA
LOC400684 LOC400684 protein Human DNA Binding 400684 Q9BVU7
LOC400931 MIRLET7B host gene (non-protein coding) Human DNA Binding NR_027033
LOC440926 H3 histone, family 3A, pseudogene 4 Human DNA Binding NR_002315
LOC492303 gem (nuclear organelle) associated protein 8 pseudogene 4 Human DNA Binding NR_002830
LOC550643 long intergenic non-protein coding RNA 1420 Human DNA Binding NR_015367
LOC554203 JPX transcript, XIST activator (non-protein coding) Human DNA Binding NR_024582
LOC642502 Human DNA Binding NM_001089593
LOC642826 BMS1 pseudogene 6 Human DNA Binding NR_024495
LOC644656 LOC644656 protein Human DNA Binding 644656 Q9BT31
LOC644961 actin gamma 1 pseudogene 20 Human DNA Binding 644961 NA
LOC646719 NIPBL antisense RNA 1 (head to head) Human DNA Binding 646719 NA
LOC646903 Human DNA Binding 646903 NA
LOC729013 ZBED5 antisense RNA 1 Human DNA Binding 729013 NA
LOC729683 Human DNA Binding 729683 NA
LOC729970 Human DNA Binding 729970 NA
LOC730183 Human DNA Binding 730183 NA
LOC84989 JMJD1C antisense RNA 1 Human DNA Binding NR_027182
LOC93622 Human DNA Binding NR_015433
LOX lysyl oxidase Human Direct Regulation 4015 B7ZAJ4
LPGAT1 lysophosphatidylglycerol acyltransferase 1 Human DNA Binding 9926 Q53YL2
LPIN1 lipin 1 Human DNA Binding 23175 B4DGS4
LPIN2 lipin 2 Human DNA Binding NM_014646 Q92539
LPXN leupaxin Human DNA Binding 9404 O60711
LRCH4 Leucine-rich repeat and calponin homology domain-containing protein 4 Human DNA Binding 4034 O75427
LRFN1 leucine rich repeat and fibronectin type III domain containing 1 Human DNA Binding 57622 Q9P244
LRFN3 leucine rich repeat and fibronectin type III domain containing 3 Human DNA Binding 79414 Q9BTN0
LRFN4 leucine rich repeat and fibronectin type III domain containing 4 Human DNA Binding 78999 Q6PJG9
LRP12 low density lipoprotein receptor-related protein 12 Human DNA Binding 29967 Q59H02
LRP3 Human DNA Binding
LRP4-AS1 LRP4 antisense RNA 1 Human DNA Binding 100507401 NA
LRP6 low density lipoprotein receptor-related protein 6 Human DNA Binding 4040 O75581
LRP8 low density lipoprotein receptor-related protein 8, apolipoprotein e receptor Human DNA Binding 7804 Q14114
LRRC14 leucine rich repeat containing 14 Human DNA Binding 9684 Q15048
LRRC16A leucine rich repeat containing 16A Human DNA Binding 55604 Q5VZK9
LRRC20 leucine rich repeat containing 20 Human DNA Binding 55222 Q8TCA0
LRRC27 leucine rich repeat containing 27 Human DNA Binding 80313 B3KUK5
LRRC37B2 leucine rich repeat containing 37B pseudogene 1 Human DNA Binding NR_015341
LRRC41 leucine rich repeat containing 41 Human DNA Binding NM_006369 Q15345
LRRC47 leucine rich repeat containing 47 Human DNA Binding 57470 Q8N1G4
LRRC48 leucine rich repeat containing 48 Human DNA Binding NM_001130092 B3KSC6
LRRC4B Human DNA Binding
LRRC8C leucine rich repeat containing 8 family, member C Human DNA Binding 84230 Q8TDW0
LRRFIP2 leucine rich repeat (in FLII) interacting protein 2 Human DNA Binding 9209 Q9Y608
LSM1 LSM1 homolog, U6 small nuclear RNA associated (S. cerevisiae) Human DNA Binding 27257 O15116
LSM14A LSM14A, SCD6 homolog A (S. cerevisiae) Human DNA Binding 26065 Q8ND56
LSM14B LSM14B, SCD6 homolog B (S. cerevisiae) Human DNA Binding 149986 Q9BX40
LSM2 LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae) Human DNA Binding 57819 Q9Y333
LSM4 LSM4 homolog, U6 small nuclear RNA associated (S. cerevisiae) Human DNA Binding 25804 Q9Y4Z0
LSM8 LSM8 homolog, U6 small nuclear RNA associated (S. cerevisiae) Human DNA Binding NM_016200 A4D0W0
LSMD1 LSM domain containing 1 Human DNA Binding 84316 Q9BRA0
LTA4H leukotriene A4 hydrolase Human DNA Binding 4048 P09960
LTV1 LTV1 homolog (S. cerevisiae) Human DNA Binding 84946 Q96GA3
LUC7L LUC7-like (S. cerevisiae) Human DNA Binding 55692 Q9NQ29
LUC7L2 LUC7-like 2 (S. cerevisiae) Human DNA Binding 51631 Q9Y383
LYPLA1 lysophospholipase I Human DNA Binding 10434 O75608
LYRM2 LYR motif containing 2 Human DNA Binding 57226 Q9NU23
LZIC leucine zipper and CTNNBIP1 domain containing Human DNA Binding 84328 Q8WZA0
LZTFL1 leucine zipper transcription factor-like 1 Human DNA Binding NM_020347 Q9NQ48
LZTR1 leucine-zipper-like transcription regulator 1 Human DNA Binding 8216 Q8N653
MAD2L1BP MAD2L1 binding protein Human DNA Binding 9587 E9PAT7
MAD2L2 MAD2 mitotic arrest deficient-like 2 (yeast) Human DNA Binding 10459 Q9UI95
MAEA macrophage erythroblast attacher Human DNA Binding 10296 Q7L5Y9
MAF1 MAF1 homolog (S. cerevisiae) Human DNA Binding 84232 Q9H063
MAFG v-maf musculoaponeurotic fibrosarcoma oncogene homolog G (avian) Human Protein Binding 4097 O15525
MAGEF1 melanoma antigen family F, 1 Human DNA Binding 64110 Q9HAY2
MAGI1 membrane associated guanylate kinase, WW and PDZ domain containing 1 Human DNA Binding 9223 Q96QZ7
MALAT1 metastasis associated lung adenocarcinoma transcript 1 (non-protein coding) Human DNA Binding NR_002819
MALT1 mucosa associated lymphoid tissue lymphoma translocation gene 1 Human DNA Binding 10892 Q9UDY8
MAML1 mastermind-like 1 (Drosophila) Human DNA Binding 9794 Q92585
MAML3 mastermind-like 3 (Drosophila) Human DNA Binding 55534 Q96JK9
MAN2C1 Alpha-mannosidase 2C1 Human DNA Binding 4123 Q9NTJ4
MANBA mannosidase, beta A, lysosomal Human DNA Binding 4126 O00462
MANEAL mannosidase, endo-alpha-like Human DNA Binding 149175 Q5VSG8
MANF mesencephalic astrocyte-derived neurotrophic factor Human DNA Binding NM_006010 A8K878
MAP2 Microtubule-associated protein 2 Human DNA Binding 4133 P11137
MAP2K4 mitogen-activated protein kinase kinase 4 Human DNA Binding 6416 P45985
MAP2K5 mitogen-activated protein kinase kinase 5 Human DNA Binding 5607 Q13163
MAP3K1 mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase Human DNA Binding 4214 Q13233
MAP3K12 mitogen-activated protein kinase kinase kinase 12 Human DNA Binding 7786 Q12852
MAP3K4 mitogen-activated protein kinase kinase kinase 4 Human DNA Binding 4216 Q9P1M2
MAP3K7 mitogen-activated protein kinase kinase kinase 7 Human DNA Binding 6885 O43318
MAP3K7IP2 TGF-beta activated kinase 1/MAP3K7 binding protein 2 Human DNA Binding NM_015093 Q9NYJ8
MAP3K8 mitogen-activated protein kinase kinase kinase 8 Human DNA Binding NM_005204 P41279
MAP4 microtubule-associated protein 4 Human DNA Binding 4134 P27816
MAP4K4 mitogen-activated protein kinase kinase kinase kinase 4 Human DNA Binding 9448 O95819
MAP4K5 mitogen-activated protein kinase kinase kinase kinase 5 Human DNA Binding 11183 B3KWC4
MAP6D1 MAP6 domain containing 1 Human DNA Binding NM_024871 Q9H9H5
MAPK1 mitogen-activated protein kinase 1 Human DNA Binding 5594 P28482
MAPK11 mitogen-activated protein kinase 11 Human DNA Binding 5600 Q15759
MAPK1IP1L mitogen-activated protein kinase 1 interacting protein 1-like Human DNA Binding 93487 Q8NDC0
MAPK8IP2 mitogen-activated protein kinase 8 interacting protein 2 Human DNA Binding 23542 Q13387
MAPKAPK5 mitogen-activated protein kinase-activated protein kinase 5 Human DNA Binding 8550 Q8IW41
MAPKAPK5-AS1 MAPKAPK5 antisense RNA 1 Human DNA Binding 51275 Q8N8E1
MAPKBP1 mitogen-activated protein kinase binding protein 1 Human DNA Binding NM_001128608 O60336
MARCH7 E3 ubiquitin-protein ligase MARCH7 Human DNA Binding 64844 Q9H992
MARK2 MAP/microtubule affinity-regulating kinase 2 Human DNA Binding 2011 Q7KZI7
MARS methionyl-tRNA synthetase Human DNA Binding 4141 P56192
MARS2 methionyl-tRNA synthetase 2, mitochondrial Human DNA Binding 92935 Q96GW9
MASTL microtubule associated serine/threonine kinase-like Human DNA Binding 84930 Q96GX5
MAT2A methionine adenosyltransferase II, alpha Human DNA Binding 4144 P31153
MAT2B methionine adenosyltransferase II, beta Human DNA Binding 27430 Q9NZL9
MATR3 matrin 3 Human DNA Binding 9782 P43243
MBL1P1 mannose-binding lectin (protein A) 1, pseudogene Human DNA Binding NR_002724
MBLAC2 Metallo-beta-lactamase domain-containing protein 2 Human DNA Binding 153364 Q68D91
MBNL1 muscleblind-like splicing regulator 1 Human DNA Binding 4154 Q9NR56
MBOAT2 membrane bound O-acyltransferase domain containing 2 Human DNA Binding 129642 Q6ZWT7
MBTD1 mbt domain containing 1 Human DNA Binding 54799 Q05BQ5
MBTPS1 membrane-bound transcription factor peptidase, site 1 Human DNA Binding 8720 Q14703
MCCC1 Methylcrotonoyl-CoA carboxylase subunit alpha, mitochondrial Human DNA Binding 56922 Q96RQ3
MCL1 myeloid cell leukemia sequence 1 (BCL2-related) Human DNA Binding 4170 C8YZ26
MCM3APAS MCM3AP antisense RNA 1 Human DNA Binding NR_002776
MDH1 malate dehydrogenase 1, NAD (soluble) Human DNA Binding 4190 P40925
MDP1 magnesium-dependent phosphatase 1 Human DNA Binding NM_138476 Q86V88
ME2 malic enzyme 2, NAD(+)-dependent, mitochondrial Human DNA Binding 4200 P23368
MEAF6 MYST/Esa1-associated factor 6 Human DNA Binding 64769 Q9HAF1
MED1 mediator complex subunit 1 Human DNA Binding 5469 Q15648
MED12L mediator complex subunit 12-like Human DNA Binding 116931 Q86YW9
MED13 Human DNA Binding
MED13L mediator complex subunit 13-like Human DNA Binding NM_015335 Q71F56
MED15 mediator complex subunit 15 Human DNA Binding 51586 Q96RN5
MED16 Human DNA Binding
MED18 mediator complex subunit 18 Human DNA Binding 54797 Q9BUE0
MED25 mediator complex subunit 25 Human DNA Binding 81857 Q71SY5
MED28 mediator complex subunit 28 Human DNA Binding 80306 Q9H204
MED29 mediator complex subunit 29 Human DNA Binding 55588 B4DUA7
MED31 mediator complex subunit 31 Human DNA Binding NM_016060 Q9Y3C7
MED6 mediator complex subunit 6 Human DNA Binding 10001 O75586
MED7 mediator complex subunit 7 Human DNA Binding 9443 O43513
MEF2A myocyte enhancer factor 2A Human DNA Binding 4205 Q02078
MEF2BNB Protein MEF2BNB Human DNA Binding 729991 Q96FH0
MEF2BNB-MEF2B Myocyte-specific enhancer factor 2B Human DNA Binding 4207 Q02080
MEF2D myocyte enhancer factor 2D Human DNA Binding NM_005920 Q14814
MEIG1 meiosis/spermiogenesis associated 1 Human DNA Binding NM_001080836 Q5JSS6
MEIS3 Meis homeobox 3 Human DNA Binding 56917 Q99687
MEMO1 mediator of cell motility 1 Human DNA Binding 51072 Q9Y316
MEPCE methylphosphate capping enzyme Human DNA Binding 56257 Q7L2J0
MESDC1 mesoderm development candidate 1 Human DNA Binding 59274 Q9H1K6
METAP2 methionyl aminopeptidase 2 Human DNA Binding 10988 P50579
METTL11A N-terminal Xaa-Pro-Lys N-methyltransferase 1 Human DNA Binding 28989 Q9BV86
METTL13 methyltransferase like 13 Human DNA Binding 51603 Q8N6R0
METTL14 methyltransferase like 14 Human DNA Binding 57721 Q9HCE5
METTL3 methyltransferase like 3 Human DNA Binding 56339 Q86U44
METTL6 methyltransferase like 6 Human DNA Binding 131965 Q8TCB7
METTL9 methyltransferase like 9 Human DNA Binding 51108 Q9H1A3
MEX3B mex-3 homolog B (C. elegans) Human DNA Binding 84206 Q6ZN04
MEX3C mex-3 homolog C (C. elegans) Human DNA Binding 51320 B3KTW5
MFAP1 microfibrillar-associated protein 1 Human DNA Binding 4236 P55081
MFN2 mitofusin 2 Human DNA Binding 9927 O95140
MFSD11 UNC93-like protein MFSD11 Human DNA Binding 79157 O43934
MGAT1 mannosyl (alpha-1,3-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase Human DNA Binding 4245 P26572
MGAT2 mannosyl (alpha-1,6-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase Human DNA Binding 4247 Q10469
MGAT4B mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme B Human DNA Binding 11282 Q9UQ53
MGAT5B mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isozyme B Human DNA Binding 146664 Q3V5L5
MGC16275 Human DNA Binding NR_026914
MGC3771 ZNF205 antisense RNA 1 Human DNA Binding NR_024166
MGC45800 Human DNA Binding NR_027107
MGEA5 meningioma expressed antigen 5 (hyaluronidase) Human DNA Binding 10724 E9PGF9
MGME1 Mitochondrial genome maintenance exonuclease 1 Human DNA Binding 92667 Q9BQP7
MGRN1 mahogunin ring finger 1, E3 ubiquitin protein ligase Human DNA Binding 23295 O60291
MIER1 mesoderm induction early response 1 homolog (Xenopus laevis) Human DNA Binding 57708 Q8N108
MIER3 mesoderm induction early response 1, family member 3 Human DNA Binding 166968 Q7Z3K6
MINPP1 multiple inositol-polyphosphate phosphatase 1 Human DNA Binding 9562 Q9UNW1
MIR10A microRNA 10a Human DNA Binding 406902 N/A
MIR125B1 microRNA 125b-1 Human DNA Binding 406911 NA
MIR1281 microRNA 1281 Human DNA Binding 100302237 NA
MIR129-1 microRNA 129-1 Human DNA Binding NR_029596
MIR1470 microRNA 1470 Human DNA Binding 100302127 NA
MIR1538 microRNA 1538 Human DNA Binding 100302119 NA
MIR17 microRNA 17 Human DNA Binding 406952 NA
MIR17HG miR-17-92 cluster host gene Human DNA Binding 407975 NA
MIR181A2HG MIR181A2 host gene Human DNA Binding 100379345 NA
MIR191 microRNA 191 Human DNA Binding 406966 NA
MIR1915 microRNA 1915 Human DNA Binding 100302129 NA
MIR196A2 microRNA 196a-2 Human DNA Binding NR_029617
MIR2861 microRNA 2861 Human DNA Binding 100422910 NA
MIR3184 microRNA 3184 Human DNA Binding 100423003 NA
MIR3188 microRNA 3188 Human DNA Binding 100422833 NA
MIR3610 microRNA 3610 Human DNA Binding 100500914 NA
MIR3613 microRNA 3613 Human DNA Binding 100500908 NA
MIR3661 microRNA 3661 Human DNA Binding 100500905 NA
MIR3665 microRNA 3665 Human DNA Binding 100500861 NA
MIR3913-1 microRNA 3913-1 Human DNA Binding 100500903 NA
MIR3917 microRNA 3917 Human DNA Binding 100500808 NA
MIR3960 microRNA 3960 Human DNA Binding 100616250 NA
MIR423 microRNA 423 Human DNA Binding 494335 NA
MIR425 microRNA 425 Human DNA Binding 494337 NA
MIR4442 microRNA 4442 Human DNA Binding 100616477 NA
MIR4444-1 microRNA 4444-1 Human DNA Binding 100616394 NA
MIR4466 microRNA 4466 Human DNA Binding 100616154 NA
MIR4523 microRNA 4523 Human DNA Binding 100616122 NA
MIR4665 microRNA 4665 Human DNA Binding 100616288 NA
MIR4738 microRNA 4738 Human DNA Binding 100616282 NA
MIR4740 microRNA 4740 Human DNA Binding 100616294 NA
MIR5188 microRNA 5188 Human DNA Binding 100847004 NA
MIR548AO microRNA 548ao Human DNA Binding 100847068 NA
MIR5703 microRNA 5703 Human DNA Binding 100847081 NA
MIR636 microRNA 636 Human DNA Binding 693221 NA
MIR760 microRNA 760 Human DNA Binding 100126348 NA
MIR933 microRNA 933 Human DNA Binding 100126350 NA
MIRLET7I microRNA let-7i Human DNA Binding 406891 NA
MIS18BP1 MIS18 binding protein 1 Human DNA Binding 55320 Q6P0N0
MKI67IP MKI67 (FHA domain) interacting nucleolar phosphoprotein Human DNA Binding 84365 Q9BYG3
MKLN1 muskelin 1, intracellular mediator containing kelch motifs Human DNA Binding 4289 B4DG30
MKRN1 makorin ring finger protein 1 Human DNA Binding 23608 Q9UHC7
MLF2 myeloid leukemia factor 2 Human DNA Binding 8079 A8K1F4
MLL lysine (K)-specific methyltransferase 2A Human DNA Binding 4297 Q03164
MLL2 lysine (K)-specific methyltransferase 2D Human DNA Binding 8085 O14686
MLL5 lysine (K)-specific methyltransferase 2E Human DNA Binding NM_018682 Q8IZD2
MLLT10 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 Human DNA Binding 8028 Q59EQ6
MMAA methylmalonic aciduria (cobalamin deficiency) cblA type Human DNA Binding 166785 Q8IVH4
MMAB methylmalonic aciduria (cobalamin deficiency) cblB type Human DNA Binding 326625 Q96EY8
MMP15 matrix metallopeptidase 15 (membrane-inserted) Human DNA Binding 4324 P51511
MNT MNT, MAX dimerization protein Human DNA Binding 4335 Q99583
MOB4 MOB family member 4, phocein Human DNA Binding 25843 Q9Y3A3
MOBKL1A MOB kinase activator 1B Human DNA Binding 92597 B3KSH6
MOBKL1B MOB kinase activator 1A Human DNA Binding 55233 Q9H8S9
MOBKL3 MOB1, Mps One Binder kinase activator-like 3 (yeast) Human DNA Binding 25843 Q9Y3A3
MOGS mannosyl-oligosaccharide glucosidase Human DNA Binding 7841 F5H6D0
MORC2 MORC family CW-type zinc finger 2 Human DNA Binding 22880 Q9Y6X9
MORC3 MORC family CW-type zinc finger 3 Human DNA Binding 23515 Q14149
MORN1 MORN repeat-containing protein 1 Human DNA Binding 79906 Q5T089
MORN4 MORN repeat containing 4 Human DNA Binding 118812 A6XB87
MOV10 Mov10, Moloney leukemia virus 10, homolog (mouse) Human DNA Binding 4343 Q9HCE1
MPC1 Mitochondrial pyruvate carrier 1 Human DNA Binding 51660 Q9Y5U8
MPDU1 mannose-P-dolichol utilization defect 1 Human DNA Binding 9526 O75352
MPHOSPH10 M-phase phosphoprotein 10 (U3 small nucleolar ribonucleoprotein) Human DNA Binding 10199 O00566
MPHOSPH8 M-phase phosphoprotein 8 Human DNA Binding 54737 Q99549
MPLKIP M-phase-specific PLK1-interacting protein Human DNA Binding 136647 Q8TAP9
MPND MPN domain-containing protein Human DNA Binding 84954 Q8N594
MPPE1 metallophosphoesterase 1 Human DNA Binding 65258 Q53F39
MPV17L2 MPV17 mitochondrial membrane protein-like 2 Human DNA Binding 84769 Q567V2
MPZL1 myelin protein zero-like 1 Human DNA Binding 9019 O95297
MRAS Ras-related protein M-Ras Human DNA Binding 22808 O14807
MRFAP1 Morf4 family associated protein 1 Human DNA Binding 93621 Q9Y605
MRFAP1L1 Morf4 family associated protein 1-like 1 Human DNA Binding 114932 Q96HT8
MRM1 mitochondrial rRNA methyltransferase 1 homolog (S. cerevisiae) Human DNA Binding 79922 Q6IN84
MROH8 Protein MROH8 Human DNA Binding 140699 Q9H579
MRPL1 mitochondrial ribosomal protein L1 Human DNA Binding 65008 Q9BYD6
MRPL11 mitochondrial ribosomal protein L11 Human DNA Binding 65003 Q9Y3B7
MRPL13 mitochondrial ribosomal protein L13 Human DNA Binding 28998 Q9BYD1
MRPL15 mitochondrial ribosomal protein L15 Human DNA Binding 29088 Q9P015
MRPL16 mitochondrial ribosomal protein L16 Human DNA Binding 54948 Q9NX20
MRPL18 mitochondrial ribosomal protein L18 Human DNA Binding NM_014161 Q9H0U6
MRPL19 mitochondrial ribosomal protein L19 Human DNA Binding 9801 P49406
MRPL22 mitochondrial ribosomal protein L22 Human DNA Binding 29093 Q9NWU5
MRPL3 mitochondrial ribosomal protein L3 Human DNA Binding 11222 P09001
MRPL30 mitochondrial ribosomal protein L30 Human DNA Binding NM_145212 Q8TCC3
MRPL35 mitochondrial ribosomal protein L35 Human DNA Binding 51318 Q9NZE8
MRPL38 mitochondrial ribosomal protein L38 Human DNA Binding 64978 Q96DV4
MRPL39 mitochondrial ribosomal protein L39 Human DNA Binding 54148 Q9NYK5
MRPL40 39S ribosomal protein L40, mitochondrial Human DNA Binding 64976 Q9NQ50
MRPL42 mitochondrial ribosomal protein L42 Human DNA Binding 28977 Q9Y6G3
MRPL44 mitochondrial ribosomal protein L44 Human DNA Binding 65080 Q9H9J2
MRPL48 39S ribosomal protein L48, mitochondrial Human DNA Binding 51642 Q96GC5
MRPS10 mitochondrial ribosomal protein S10 Human DNA Binding 55173 P82664
MRPS14 mitochondrial ribosomal protein S14 Human DNA Binding NM_022100 O60783
MRPS18B mitochondrial ribosomal protein S18B Human DNA Binding 28973 B0S7P4
MRPS24 mitochondrial ribosomal protein S24 Human DNA Binding 64951 Q96EL2
MRPS33 mitochondrial ribosomal protein S33 Human DNA Binding 51650 A4D1T3
MRPS35 mitochondrial ribosomal protein S35 Human DNA Binding 60488 P82673
MRPS5 mitochondrial ribosomal protein S5 Human DNA Binding 64969 P82675
MRPS7 mitochondrial ribosomal protein S7 Human DNA Binding 51081 Q9Y2R9
MRTO4 mRNA turnover 4 homolog (S. cerevisiae) Human DNA Binding 51154 Q9UKD2
MSANTD3 Myb/SANT-like DNA-binding domain-containing protein 3 Human DNA Binding 91283 Q96H12
MSH3 mutS homolog 3 (E. coli) Human DNA Binding 4437 A1L480
MSI1 musashi RNA-binding protein 1 Human DNA Binding 4440 O43347
MSI2 musashi RNA-binding protein 2 Human DNA Binding 124540 Q96DH6
MSL1 male-specific lethal 1 homolog (Drosophila) Human DNA Binding 339287 B3KWR7
MSL2 male-specific lethal 2 homolog (Drosophila) Human DNA Binding 55167 G5E9I1
MSRA methionine sulfoxide reductase A Human DNA Binding 4482 Q9UJ68
MSTP2 macrophage stimulating 1 (hepatocyte growth factor-like) pseudogene 2 Human DNA Binding NR_027504
MTAP methylthioadenosine phosphorylase Human DNA Binding 4507 Q13126
MTCH1 mitochondrial carrier 1 Human DNA Binding 23787 Q9NZJ7
MTDH metadherin Human DNA Binding 92140 Q86UE4
MTERF mitochondrial transcription termination factor Human DNA Binding 7978 Q99551
MTERFD2 MTERF domain containing 2 Human DNA Binding 130916 Q7Z6M4
MTF2 metal response element binding transcription factor 2 Human DNA Binding 22823 B4DZ69
MTFP1 Mitochondrial fission process protein 1 Human DNA Binding 51537 Q9UDX5
MTFR1 mitochondrial fission regulator 1 Human DNA Binding 9650 E7EP84
MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase Human DNA Binding 10797 P13995
MTHFD2L methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2-like Human DNA Binding NM_001144978 Q9H903
MTHFR methylenetetrahydrofolate reductase (NAD(P)H) Human DNA Binding 4524 P42898
MTMR10 myotubularin related protein 10 Human DNA Binding 54893 Q9NXD2
MTMR11 myotubularin related protein 11 Human DNA Binding NM_181873 A4FU01
MTMR15 FANCD2/FANCI-associated nuclease 1 Human DNA Binding NM_001146096 Q9Y2M0
MTMR2 myotubularin related protein 2 Human DNA Binding 8898 Q13614
MTMR4 myotubularin related protein 4 Human DNA Binding NM_004687 Q9NYA4
MTMR9 myotubularin related protein 9 Human DNA Binding 66036 Q96QG7
MTPAP mitochondrial poly(A) polymerase Human DNA Binding 55149 Q9NVV4
MTR 5-methyltetrahydrofolate-homocysteine methyltransferase Human DNA Binding 4548 Q99707
MTX1 metaxin 1 Human DNA Binding NM_002455 Q13505
MTX2 metaxin 2 Human DNA Binding 10651 O75431
MVB12B Multivesicular body subunit 12B Human DNA Binding 89853 Q9H7P6
MVK Mevalonate kinase Human DNA Binding 4598 Q03426
MXI1 MAX interactor 1 Human DNA Binding 4601 P50539
MYEF2 myelin expression factor 2 Human DNA Binding 50804 Q9P2K5
MYL12A myosin, light chain 12A, regulatory, non-sarcomeric Human DNA Binding 10627 P19105
MYL12B myosin, light chain 12B, regulatory Human DNA Binding NM_001144946 O14950
MYLK-AS1 MYLK antisense RNA 1 Human DNA Binding 100506826 NA
MYNN myoneurin Human DNA Binding 55892 Q9NPC7
MYO18A myosin XVIIIA Human DNA Binding 399687 Q92614
MYO1B myosin IB Human DNA Binding 4430 B0I1S9
MYO5A Human DNA Binding
MYO9A myosin IXA Human DNA Binding 4649 B2RTY4
MYST2 K(lysine) acetyltransferase 7 Human DNA Binding 11143 B4DGY4
MYST4 K(lysine) acetyltransferase 6B Human DNA Binding NM_012330 B2RWN8
MZT2B Mitotic-spindle organizing protein 2B Human DNA Binding 80097 Q6NZ67
N4BP1 NEDD4 binding protein 1 Human DNA Binding 9683 O75113
N4BP2 NEDD4 binding protein 2 Human DNA Binding 55728 Q86UW6
N4BP2L2 NEDD4 binding protein 2-like 2 Human DNA Binding 10443 Q92802
N6AMT2 N-6 adenine-specific DNA methyltransferase 2 (putative) Human DNA Binding 221143 Q8WVE0
NAA15 N(alpha)-acetyltransferase 15, NatA auxiliary subunit Human DNA Binding 80155 Q58F05
NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit Human DNA Binding 80018 Q14CX7
NAA30 N(alpha)-acetyltransferase 30, NatC catalytic subunit Human DNA Binding 122830 B3KS28
NAB1 NGFI-A binding protein 1 (EGR1 binding protein 1) Human DNA Binding 4664 Q13506
NADK NAD kinase Human DNA Binding 65220 O95544
NADKD1 NAD kinase domain containing 1 Human DNA Binding 133686 Q4G0N4
NAE1 NEDD8 activating enzyme E1 subunit 1 Human DNA Binding 8883 Q13564
NAMPT nicotinamide phosphoribosyltransferase Human DNA Binding 10135 P43490
NAPA-AS1 NAPA antisense RNA 1 Human DNA Binding 100505681 NA
NAPG N-ethylmaleimide-sensitive factor attachment protein, gamma Human DNA Binding 8774 Q6FHY4
NARF nuclear prelamin A recognition factor Human DNA Binding 26502 B3KPX2
NARG1 N(alpha)-acetyltransferase 15, NatA auxiliary subunit Human DNA Binding NM_057175 Q58F05
NARG1L N(alpha)-acetyltransferase 16, NatA auxiliary subunit Human DNA Binding NM_018527 Q6N069
NARG2 NMDA receptor regulated 2 Human DNA Binding 79664 G3V0H6
NARR Ras-related protein Rab-34, isoform NARR Human DNA Binding 100861437 P0DI83
NARS asparaginyl-tRNA synthetase Human DNA Binding 4677 O43776
NAT10 N-acetyltransferase 10 (GCN5-related) Human DNA Binding 55226 B4DFD5
NAT12 N(alpha)-acetyltransferase 30, NatC catalytic subunit Human DNA Binding NM_001011713 B3KS28
NAT13 N(alpha)-acetyltransferase 50, NatE catalytic subunit Human DNA Binding NM_025146 Q9GZZ1
NAT5 N(alpha)-acetyltransferase 20, NatB catalytic subunit Human DNA Binding NM_181527 P61599
NAT8L N-acetyltransferase 8-like (GCN5-related, putative) Human DNA Binding 339983 Q8N9F0
NBAS neuroblastoma amplified sequence Human DNA Binding 51594 A2RRP1
NBN nibrin Human DNA Binding 4683 O60934
NBPF14 neuroblastoma breakpoint family, member 14 Human DNA Binding 25832 Q5TI25
NBR1 neighbor of BRCA1 gene 1 Human DNA Binding 4077 Q14596
NBR2 neighbor of BRCA1 gene 2 (non-protein coding) Human DNA Binding NR_003108
NCAM2 Neural cell adhesion molecule 2 Human DNA Binding 4685 O15394
NCAPG non-SMC condensin I complex, subunit G Human DNA Binding 64151 Q9BPX3
NCL nucleolin Human DNA Binding 4691 B3KM80
NCLN nicalin Human DNA Binding 56926 Q969V3
NCOA4 nuclear receptor coactivator 4 Human DNA Binding 8031 E9PAV7
NCOA5 nuclear receptor coactivator 5 Human DNA Binding 57727 Q9HCD5
NCOA7 nuclear receptor coactivator 7 Human DNA Binding 135112 B3KXK4
NCOR2 nuclear receptor corepressor 2 Human DNA Binding 9612 Q9Y618
NCRNA00120 Human DNA Binding NR_002767
NCRNA00188 LRRC75A antisense RNA 1 Human DNA Binding NR_027179 Q8N1F1
NDC80 NDC80 kinetochore complex component Human DNA Binding 10403 A8K031
NDFIP1 Nedd4 family interacting protein 1 Human DNA Binding 80762 Q9BT67
NDST2 N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 2 Human DNA Binding 8509 B4E139
NDUFA12 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 12 Human DNA Binding 55967 F8VQS7
NDUFA2 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 2, 8kDa Human DNA Binding NM_002488 O43678
NDUFA3 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 3, 9kDa Human DNA Binding NM_004542 O95167
NDUFA4L2 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4-like 2 Human DNA Binding 56901 Q9NRX3
NDUFA9 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 9, 39kDa Human DNA Binding 4704 Q16795
NDUFAF2 NADH dehydrogenase (ubiquinone) complex I, assembly factor 2 Human DNA Binding 91942 Q8N183
NDUFAF5 NADH dehydrogenase [ubiquinone] 1 alpha subcomplex assembly factor 5 Human DNA Binding 79133 Q5TEU4
NDUFB1 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 1, 7kDa Human DNA Binding 4707 O75438
NDUFB10 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10, 22kDa Human DNA Binding 4716 A8K761
NDUFB11 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 11, 17.3kDa Human DNA Binding NM_001135998 Q9NX14
NDUFB3 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 3, 12kDa Human DNA Binding NM_002491 A0A024R413
NDUFB5 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5, 16kDa Human DNA Binding NM_002492 O43674
NDUFB6 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 6, 17kDa Human DNA Binding NM_182739 O95139
NDUFB8 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 8, 19kDa Human DNA Binding NM_005004 O95169
NDUFC1 NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 1, 6kDa Human DNA Binding NM_002494 O43677
NDUFC2 NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2, 14.5kDa Human DNA Binding 4718 E9PNU8
NDUFS1 NADH dehydrogenase (ubiquinone) Fe-S protein 1, 75kDa (NADH-coenzyme Q reductase) Human DNA Binding 4719 P28331
NDUFS4 NADH dehydrogenase (ubiquinone) Fe-S protein 4, 18kDa (NADH-coenzyme Q reductase) Human DNA Binding NM_002495 O43181
NDUFS7 NADH dehydrogenase [ubiquinone] iron-sulfur protein 7, mitochondrial Human DNA Binding 374291 O75251
NEAT1 nuclear paraspeckle assembly transcript 1 (non-protein coding) Human DNA Binding 283131 NA
NEBL nebulette Human DNA Binding 10529 O76041
NECAP1 NECAP endocytosis associated 1 Human DNA Binding 25977 Q8NC96
NEDD1 neural precursor cell expressed, developmentally down-regulated 1 Human DNA Binding 121441 A8K1Z3
NEDD4L neural precursor cell expressed, developmentally down-regulated 4-like, E3 ubiquitin protein ligase Human DNA Binding 23327 Q96PU5
NEGR1 Neuronal growth regulator 1 Human DNA Binding 257194 Q7Z3B1
NEK1 NIMA (never in mitosis gene a)-related kinase 1 Human DNA Binding 4750 Q96PY6
NEK4 NIMA-related kinase 4 Human DNA Binding 6787 P51957
NELFA Negative elongation factor A Human DNA Binding 7469 Q9H3P2
NELFB Negative elongation factor B Human DNA Binding 25920 Q8WX92
NEURL4 neuralized homolog 4 (Drosophila) Human DNA Binding 84461 Q96JN8
NFAT5 nuclear factor of activated T-cells 5, tonicity-responsive Human DNA Binding 10725 O94916
NFATC2IP nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein Human Protein Binding 84901 Q8NCF5
NFATC3 nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 3 Human DNA Binding 4775 B5B2S0
NFE2L1 nuclear factor (erythroid-derived 2)-like 1 Human DNA Binding 4779 Q14494
NFE2L2 nuclear factor (erythroid-derived 2)-like 2 Human DNA Binding 4780 Q16236
NFIL3 nuclear factor, interleukin 3 regulated Human DNA Binding NM_005384 A0A024R241
NFKB1 nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 Human DNA Binding 4790 P19838
NFKBIA nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha Human DNA Binding NM_020529 P25963
NFKBIB nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta Human DNA Binding 4793 Q15653
NFKBIL1 nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 1 Human DNA Binding 4795 A8K778
NFU1 NFU1 iron-sulfur cluster scaffold Human DNA Binding NM_001002757 Q9UMS0
NFX1 nuclear transcription factor, X-box binding 1 Human DNA Binding 4799 Q12986
NFXL1 nuclear transcription factor, X-box binding-like 1 Human DNA Binding 152518 Q6ZNB6
NFYA nuclear transcription factor Y, alpha Human DNA Binding 4800 P23511
NFYB nuclear transcription factor Y, beta Human DNA Binding NM_006166 A0A024RBG7
NFYC nuclear transcription factor Y, gamma Human DNA Binding 4802 F8VWM3
NGDN neuroguidin, EIF4E binding protein Human DNA Binding 25983 Q8NEJ9
NGRN neugrin, neurite outgrowth associated Human DNA Binding 51335 Q9NPE2
NHEJ1 nonhomologous end-joining factor 1 Human DNA Binding NM_024782 Q9H9Q4
NHLRC2 NHL repeat containing 2 Human DNA Binding 374354 Q7Z658
NHLRC3 NHL repeat containing 3 Human DNA Binding 387921 Q5JS37
NIF3L1 NIF3 NGG1 interacting factor 3-like 1 (S. cerevisiae) Human DNA Binding 60491 Q9GZT8
NINJ2 ninjurin 2 Human DNA Binding NM_016533 Q9NZG7
NIP7 NIP7, nucleolar pre-rRNA processing protein Human DNA Binding 51388 Q9Y221
NIPA1 non imprinted in Prader-Willi/Angelman syndrome 1 Human DNA Binding 123606 Q7RTP0
NIPA2 non imprinted in Prader-Willi/Angelman syndrome 2 Human DNA Binding 81614 Q8N8Q9
NIPAL3 NIPA-like domain containing 3 Human DNA Binding 57185 Q6P499
NIPBL Nipped-B homolog (Drosophila) Human DNA Binding 25836 Q6KC79
NKD2 naked cuticle homolog 2 (Drosophila) Human DNA Binding 85409 Q969F2
NKIRAS2 NFKB inhibitor interacting Ras-like 2 Human DNA Binding 28511 Q9NYR9
NKTR natural killer-tumor recognition sequence Human DNA Binding 4820 P30414
NLN neurolysin (metallopeptidase M3 family) Human DNA Binding 57486 Q9BYT8
NMD3 NMD3 homolog (S. cerevisiae) Human DNA Binding 51068 Q96D46
NME1 NME/NM23 nucleoside diphosphate kinase 1 Human DNA Binding NM_198175 P15531
NME5 Nucleoside diphosphate kinase homolog 5 Human DNA Binding 8382 P56597
NME6 NME/NM23 nucleoside diphosphate kinase 6 Human DNA Binding 10201 O75414
NMNAT1 nicotinamide nucleotide adenylyltransferase 1 Human DNA Binding 64802 Q9HAN9
NMT1 N-myristoyltransferase 1 Human DNA Binding 4836 P30419
NOL11 nucleolar protein 11 Human DNA Binding 25926 Q9H8H0
NOL12 nucleolar protein 12 Human DNA Binding 79159 Q9UGY1
NOL7 nucleolar protein 7, 27kDa Human DNA Binding 51406 Q9UMY1
NOL8 nucleolar protein 8 Human DNA Binding 55035 A6H8Z4
NOM1 nucleolar protein with MIF4G domain 1 Human DNA Binding 64434 Q5C9Z4
NOP14 NOP14 nucleolar protein Human DNA Binding 8602 P78316
NOP2 NOP2 nucleolar protein Human DNA Binding 4839 P46087
NOP56 NOP56 ribonucleoprotein Human DNA Binding 10528 O00567
NOP58 NOP58 ribonucleoprotein Human DNA Binding 51602 Q9Y2X3
NOSIP nitric oxide synthase interacting protein Human DNA Binding 51070 Q9Y314
NPAT nuclear protein, ataxia-telangiectasia locus Human DNA Binding 4863 Q14207
NPC1 Niemann-Pick disease, type C1 Human DNA Binding 4864 O15118
NPC2 Niemann-Pick disease, type C2 Human DNA Binding NM_006432 A0A024R6C0
NPDC1 neural proliferation, differentiation and control, 1 Human DNA Binding 56654 Q9NQX5
NPM1 nucleophosmin (nucleolar phosphoprotein B23, numatrin) Human DNA Binding 4869 P06748
NPM3 nucleophosmin/nucleoplasmin 3 Human DNA Binding NM_006993 O75607
NR1D2 nuclear receptor subfamily 1, group D, member 2 Human DNA Binding 9975 B4DXD3
NR1H3 nuclear receptor subfamily 1, group H, member 3 Human DNA Binding NM_001130102 Q13133
NR2C1 nuclear receptor subfamily 2, group C, member 1 Human DNA Binding 7181 H9NIM3
NR2C2 nuclear receptor subfamily 2, group C, member 2 Human DNA Binding 7182 F2YGU2
NR4A3 nuclear receptor subfamily 4, group A, member 3 Human DNA Binding NM_173199 A0A024R168
NR6A1 nuclear receptor subfamily 6, group A, member 1 Human DNA Binding 2649 Q15406
NRBF2 nuclear receptor binding factor 2 Human DNA Binding 29982 Q96F24
NRBP1 nuclear receptor binding protein 1 Human DNA Binding 29959 Q9UHY1
NRD1 nardilysin (N-arginine dibasic convertase) Human DNA Binding 4898 O43847
NRG2 neuregulin 2 Human DNA Binding 9542 F5GZS7
NRIP1 Human DNA Binding
NSA2 NSA2 ribosome biogenesis homolog (S. cerevisiae) Human DNA Binding 10412 O95478
NSL1 NSL1, MIND kinetochore complex component, homolog (S. cerevisiae) Human DNA Binding 25936 Q53FM2
NSMAF neutral sphingomyelinase (N-SMase) activation associated factor Human DNA Binding 8439 Q92636
NSRP1 nuclear speckle splicing regulatory protein 1 Human DNA Binding 84081 B7ZL27
NT5C2 5'-nucleotidase, cytosolic II Human DNA Binding 22978 A8K6K2
NT5C3 5'-nucleotidase, cytosolic IIIA Human DNA Binding 51251 Q9H0P0
NT5DC2 5'-nucleotidase domain containing 2 Human DNA Binding 64943 E9PAL9
NUAK1 NUAK family, SNF1-like kinase, 1 Human DNA Binding 9891 O60285
NUAK2 NUAK family, SNF1-like kinase, 2 Human DNA Binding NM_030952 Q9H093
NUBPL nucleotide binding protein-like Human DNA Binding 80224 B4DWB0
NUCB1 nucleobindin 1 Human DNA Binding 4924 A8K7Q1
NUDCD2 NudC domain containing 2 Human DNA Binding 134492 Q8WVJ2
NUDT1 nudix (nucleoside diphosphate linked moiety X)-type motif 1 Human DNA Binding NM_198952 A0A024R819
NUDT13 nudix (nucleoside diphosphate linked moiety X)-type motif 13 Human DNA Binding NM_015901 Q86X67
NUDT2 nudix (nucleoside diphosphate linked moiety X)-type motif 2 Human DNA Binding NM_001161 P50583
NUDT5 nudix (nucleoside diphosphate linked moiety X)-type motif 5 Human DNA Binding 11164 Q9UKK9
NUF2 NUF2, NDC80 kinetochore complex component, homolog (S. cerevisiae) Human DNA Binding 83540 Q9BZD4
NUMB numb homolog (Drosophila) Human DNA Binding 8650 P49757
NUP205 nucleoporin 205kDa Human DNA Binding 23165 Q92621
NUP35 nucleoporin 35kDa Human DNA Binding NM_138285 B4DYB4
NUP43 nucleoporin 43kDa Human DNA Binding 348995 Q8NFH3
NUP50 nucleoporin 50kDa Human DNA Binding 10762 Q9UKX7
NUSAP1 nucleolar and spindle associated protein 1 Human DNA Binding 51203 Q9BXS6
NVL nuclear VCP-like Human DNA Binding 4931 B4DF43
NXN nucleoredoxin Human DNA Binding 64359 Q6DKJ4
NXT1 NTF2-like export factor 1 Human DNA Binding 29107 Q9UKK6
OARD1 O-acetyl-ADP-ribose deacetylase 1 Human DNA Binding 221443 Q9Y530
OAZ3 ornithine decarboxylase antizyme 3 Human DNA Binding NM_001134939 Q6GMR0
OCIAD1 OCIA domain containing 1 Human DNA Binding 54940 Q9NX40
ODC1 ornithine decarboxylase 1 Human DNA Binding 4953 P11926
OFD1 oral-facial-digital syndrome 1 Human DNA Binding 8481 E9KL37
OGDH oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide) Human DNA Binding 4967 Q02218
OGFOD2 2-oxoglutarate and iron-dependent oxygenase domain-containing protein 2 Human DNA Binding 79676 Q6N063
OLA1 Obg-like ATPase 1 Human DNA Binding 29789 Q9NTK5
OPA1 optic atrophy 1 (autosomal dominant) Human DNA Binding 4976 O60313
ORAI1 ORAI calcium release-activated calcium modulator 1 Human DNA Binding 84876 Q96D31
ORC6 origin recognition complex, subunit 6 Human DNA Binding 23594 Q9Y5N6
ORC6L origin recognition complex, subunit 6 Human DNA Binding NM_014321 A0A024R6R3
ORMDL1 ORM1-like 1 (S. cerevisiae) Human DNA Binding 94101 Q9P0S3
OSBP oxysterol binding protein Human DNA Binding 5007 P22059
OSBPL11 oxysterol binding protein-like 11 Human DNA Binding 114885 Q9BXB4
OSBPL3 oxysterol binding protein-like 3 Human DNA Binding NM_145322 Q9H4L5
OSBPL5 oxysterol binding protein-like 5 Human DNA Binding 114879 A8KAD5
OSBPL9 oxysterol binding protein-like 9 Human DNA Binding 114883 J3KPA3
OSGEPL1 O-sialoglycoprotein endopeptidase-like 1 Human DNA Binding 64172 Q9H4B0
OSGIN2 oxidative stress induced growth inhibitor family member 2 Human DNA Binding 734 Q9Y236
OSTF1 osteoclast stimulating factor 1 Human DNA Binding 26578 Q92882
OTUB2 OTU domain, ubiquitin aldehyde binding 2 Human DNA Binding 78990 Q96DC9
OTUD6B OTU domain containing 6B Human DNA Binding 51633 Q8N6M0
OTUD7B OTU domain containing 7B Human DNA Binding 56957 Q6GQQ9
PAAF1 proteasomal ATPase-associated factor 1 Human DNA Binding 80227 Q9BRP4
PABPC1 poly(A) binding protein, cytoplasmic 1 Human DNA Binding 26986 P11940
PABPN1 poly(A) binding protein, nuclear 1 Human DNA Binding 8106 Q86U42
PACRGL PARK2 co-regulated-like Human DNA Binding 133015 Q8N7B6
PACS1 phosphofurin acidic cluster sorting protein 1 Human DNA Binding NM_018026 A0A024R5H6
PAFAH1B2 platelet-activating factor acetylhydrolase 1b, catalytic subunit 2 (30kDa) Human DNA Binding 5049 P68402
PAFAH1B3 platelet-activating factor acetylhydrolase 1b, catalytic subunit 3 (29kDa) Human DNA Binding 5050 Q15102
PAIP1 poly(A) binding protein interacting protein 1 Human DNA Binding 10605 Q9H074
PAIP2 poly(A) binding protein interacting protein 2 Human DNA Binding 51247 Q9BPZ3
PAK1IP1 PAK1 interacting protein 1 Human DNA Binding 55003 Q9NWT1
PAK2 p21 protein (Cdc42/Rac)-activated kinase 2 Human DNA Binding 5062 A8K5M4
PALM paralemmin Human DNA Binding 5064 O75781
PAN2 PAN2 poly(A) specific ribonuclease subunit homolog (S. cerevisiae) Human DNA Binding 9924 Q504Q3
PAN3 PAN3 poly(A) specific ribonuclease subunit homolog (S. cerevisiae) Human DNA Binding 255967 Q58A45
PAN3-AS1 PAN3 antisense RNA 1 Human DNA Binding 100288730 NA
PANK3 pantothenate kinase 3 Human DNA Binding 79646 Q9H999
PANX1 pannexin 1 Human DNA Binding 24145 Q96RD7
PAPD4 PAP associated domain containing 4 Human DNA Binding 167153 Q6PIY7
PAPD7 PAP associated domain containing 7 Human DNA Binding 11044 B7ZLL4
PAPOLA poly(A) polymerase alpha Human DNA Binding 10914 P51003
PAPOLG poly(A) polymerase gamma Human DNA Binding 64895 Q59G05
PAQR3 progestin and adipoQ receptor family member III Human DNA Binding 152559 Q6TCH7
PARD3 par-3 partitioning defective 3 homolog (C. elegans) Human DNA Binding 56288 Q8TEW0
PARD3B par-3 partitioning defective 3 homolog B (C. elegans) Human DNA Binding 117583 E9PE87
PARK7 Parkinson disease (autosomal recessive, early onset) 7 Human DNA Binding 11315 Q99497
PARL presenilin associated, rhomboid-like Human DNA Binding NM_018622 Q9H300
PARP4 poly (ADP-ribose) polymerase family, member 4 Human DNA Binding 143 Q9UKK3
PASK PAS domain containing serine/threonine kinase Human DNA Binding 23178 Q96RG2
PATZ1 POZ (BTB) and AT hook containing zinc finger 1 Human DNA Binding 23598 Q9HBE1
PAWR PRKC, apoptosis, WT1, regulator Human DNA Binding 5074 Q96IZ0
PAXBP1 PAX3- and PAX7-binding protein 1 Human DNA Binding 94104 Q9Y5B6
PAXIP1 PAX interacting (with transcription-activation domain) protein 1 Human DNA Binding 22976 Q6ZW49
PBK PDZ binding kinase Human DNA Binding 55872 Q96KB5
PBX1 pre-B-cell leukemia homeobox 1 Human DNA Binding 5087 P40424
PBX3 pre-B-cell leukemia homeobox 3 Human DNA Binding 5090 E9PB27
PCBP1-AS1 PCBP1 antisense RNA 1 Human DNA Binding 400960 NA
PCBP4 poly(rC) binding protein 4 Human DNA Binding 57060 P57723
PCCA propionyl CoA carboxylase, alpha polypeptide Human DNA Binding 5095 P05165
PCED1A PC-esterase domain-containing protein 1A Human DNA Binding 64773 Q9H1Q7
PCF11 PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae) Human DNA Binding 51585 O94913
PCGF1 polycomb group ring finger 1 Human DNA Binding NM_032673 Q9BSM1
PCGF2 polycomb group ring finger 2 Human DNA Binding 7703 P35227
PCID2 PCI domain containing 2 Human DNA Binding 55795 Q5JVF3
PCIF1 PDX1 C-terminal inhibiting factor 1 Human DNA Binding 63935 Q9H4Z3
PCM1 pericentriolar material 1 Human DNA Binding 5108 Q15154
PCNA proliferating cell nuclear antigen Human DNA Binding 5111 P12004
PCNX pecanex homolog (Drosophila) Human DNA Binding 22990 Q96RV3
PCTK2 cyclin-dependent kinase 17 Human DNA Binding NM_002595 Q00537
PDCD11 programmed cell death 11 Human DNA Binding 22984 Q14690
PDCD4 programmed cell death 4 (neoplastic transformation inhibitor) Human DNA Binding 27250 B4DKX4
PDCD7 programmed cell death 7 Human DNA Binding 10081 Q6IEG3
PDE12 phosphodiesterase 12 Human DNA Binding 201626 Q6L8Q7
PDE3B phosphodiesterase 3B, cGMP-inhibited Human DNA Binding 5140 A7E2E5
PDE6D phosphodiesterase 6D, cGMP-specific, rod, delta Human DNA Binding NM_002601 B8ZZK5
PDE7A phosphodiesterase 7A Human DNA Binding 5150 Q13946
PDF peptide deformylase (mitochondrial) Human DNA Binding 64146 Q9HBH1
PDHX pyruvate dehydrogenase complex, component X Human DNA Binding 8050 E9PB14
PDIA4 protein disulfide isomerase family A, member 4 Human DNA Binding 9601 P13667
PDIK1L PDLIM1 interacting kinase 1 like Human DNA Binding 149420 Q8N165
PDK1 pyruvate dehydrogenase kinase, isozyme 1 Human DNA Binding NM_002610 Q15118
PDLIM5 PDZ and LIM domain 5 Human DNA Binding 10611 Q96HC4
PDS5A PDS5, regulator of cohesion maintenance, homolog A (S. cerevisiae) Human DNA Binding 23244 G1UI16
PDZD8 PDZ domain containing 8 Human DNA Binding 118987 Q8NEN9
PEAK1 Pseudopodium-enriched atypical kinase 1 Human DNA Binding 79834 Q9H792
PEBP1 phosphatidylethanolamine binding protein 1 Human DNA Binding 5037 P30086
PECI enoyl-CoA delta isomerase 2 Human DNA Binding NM_001166010 O75521
PELI2 pellino E3 ubiquitin protein ligase family member 2 Human DNA Binding 57161 Q9H716
PELP1 Proline-, glutamic acid- and leucine-rich protein 1 Human DNA Binding 27043 Q8IZL8
PET117 Protein PET117 homolog, mitochondrial Human DNA Binding 100303755 Q6UWS5
PEX12 peroxisomal biogenesis factor 12 Human DNA Binding NM_000286 O00623
PEX3 Peroxisomal biogenesis factor 3 Human DNA Binding 8504 P56589
PEX5 peroxisomal biogenesis factor 5 Human DNA Binding 5830 P50542
PEX7 peroxisomal biogenesis factor 7 Human DNA Binding NM_000288 O00628
PFDN1 prefoldin subunit 1 Human DNA Binding NM_002622 O60925
PFDN2 prefoldin subunit 2 Human DNA Binding 5202 B1AQP2
PFDN4 prefoldin subunit 4 Human DNA Binding 5203 Q9NQP4
PFDN6 prefoldin subunit 6 Human DNA Binding NM_014260 O15212
PFKM phosphofructokinase, muscle Human DNA Binding 5213 P08237
PFN4 profilin family, member 4 Human DNA Binding NM_199346 Q8NHR9
PGAM1 phosphoglycerate mutase 1 (brain) Human DNA Binding 5223 P18669
PGBD4 PiggyBac transposable element-derived protein 4 Human DNA Binding 161779 Q96DM1
PGRMC2 progesterone receptor membrane component 2 Human DNA Binding 10424 O15173
PHACTR4 phosphatase and actin regulator 4 Human DNA Binding 65979 Q8IZ21
PHC2 polyhomeotic homolog 2 (Drosophila) Human DNA Binding 1912 Q8IXK0
PHC3 polyhomeotic homolog 3 (Drosophila) Human DNA Binding 80012 Q8NDX5
PHF10 PHD finger protein 10 Human DNA Binding 55274 Q8WUB8
PHF12 PHD finger protein 12 Human DNA Binding 57649 Q96QT6
PHF13 PHD finger protein 13 Human DNA Binding 148479 Q86YI8
PHF17 PHD finger protein 17 Human DNA Binding 79960 Q6IE81
PHF2 PHD finger protein 2 Human DNA Binding 5253 O75151
PHF20 PHD finger protein 20 Human DNA Binding 51230 Q9BVI0
PHF21A PHD finger protein 21A Human DNA Binding 51317 Q96BD5
PHF21B PHD finger protein 21B Human DNA Binding 112885 Q96EK2
PHF23 PHD finger protein 23 Human DNA Binding 79142 Q9BUL5
PHF5A PHD finger protein 5A Human DNA Binding 84844 Q7RTV0
PHIP pleckstrin homology domain interacting protein Human DNA Binding 55023 A7J992
PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 Human DNA Binding 23239 O60346
PHOSPHO2 phosphatase, orphan 2 Human DNA Binding NM_001008489 Q8TCD6
PHPT1 14 kDa phosphohistidine phosphatase Human DNA Binding 29085 Q9NRX4
PHTF1 putative homeodomain transcription factor 1 Human DNA Binding 10745 Q9UMS5
PI4KB phosphatidylinositol 4-kinase, catalytic, beta Human DNA Binding 5298 Q9UBF8
PIAS2 protein inhibitor of activated STAT, 2 Human DNA Binding 9063 O75928
PIAS4 protein inhibitor of activated STAT, 4 Human DNA Binding 51588 Q8N2W9
PIGL phosphatidylinositol glycan anchor biosynthesis, class L Human DNA Binding 9487 Q9Y2B2
PIGM phosphatidylinositol glycan anchor biosynthesis, class M Human DNA Binding 93183 Q9H3S5
PIGP phosphatidylinositol glycan anchor biosynthesis, class P Human DNA Binding 51227 P57054
PIGS phosphatidylinositol glycan anchor biosynthesis, class S Human DNA Binding 94005 Q8NBL9
PIGU phosphatidylinositol glycan anchor biosynthesis, class U Human DNA Binding NM_080476 Q9H490
PIGV phosphatidylinositol glycan anchor biosynthesis, class V Human DNA Binding NM_017837 Q9NUD9
PIGW phosphatidylinositol glycan anchor biosynthesis, class W Human DNA Binding 284098 Q7Z7B1
PIM1 pim-1 oncogene Human DNA Binding 5292 P11309
PIM3 pim-3 oncogene Human DNA Binding 415116 Q86V86
PIP4K2B phosphatidylinositol-5-phosphate 4-kinase, type II, beta Human DNA Binding 8396 P78356
PIP5K1A phosphatidylinositol-4-phosphate 5-kinase, type I, alpha Human DNA Binding 8394 Q99755
PIP5K1B phosphatidylinositol-4-phosphate 5-kinase, type I, beta Human DNA Binding NM_003558 O14986
PITPNC1 phosphatidylinositol transfer protein, cytoplasmic 1 Human DNA Binding NM_181671 Q9UKF7
PITX1 paired-like homeodomain 1 Human DNA Binding 5307 P78337
PJA2 praja ring finger 2, E3 ubiquitin protein ligase Human DNA Binding 9867 O43164
PKD2 polycystic kidney disease 2 (autosomal dominant) Human DNA Binding 5311 Q13563
PKIG cAMP-dependent protein kinase inhibitor gamma Human DNA Binding 11142 Q9Y2B9
PKM pyruvate kinase, muscle Human DNA Binding 5315 P14618
PKN2 protein kinase N2 Human DNA Binding 5586 Q16513
PLA2G1B phospholipase A2, group IB (pancreas) Human DNA Binding NM_000928 P04054
PLA2G4C phospholipase A2, group IVC (cytosolic, calcium-independent) Human DNA Binding NM_003706 Q9UP65
PLAG1 pleiomorphic adenoma gene 1 Human DNA Binding 5324 Q6DJT9
PLAGL2 pleiomorphic adenoma gene-like 2 Human DNA Binding 5326 Q9UPG8
PLD3 phospholipase D family, member 3 Human DNA Binding 23646 Q8IV08
PLDN biogenesis of lysosomal organelles complex-1, subunit 6, pallidin Human DNA Binding 26258 B3KY40
PLEKHA3 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 3 Human DNA Binding 65977 Q9HB20
PLEKHA6 pleckstrin homology domain containing, family A member 6 Human DNA Binding 22874 Q9Y2H5
PLEKHO1 pleckstrin homology domain containing, family O member 1 Human DNA Binding 51177 Q53GL0
PLRG1 pleiotropic regulator 1 Human Protein Binding 5356 O43660
PLXDC1 plexin domain containing 1 Human DNA Binding 57125 Q8IUK5
PLXNB1 plexin B1 Human DNA Binding 5364 O43157
PM20D2 peptidase M20 domain containing 2 Human DNA Binding NM_001010853 Q8IYS1
PMPCB peptidase (mitochondrial processing) beta Human DNA Binding 9512 B3KM34
PMS2L3 postmeiotic segregation increased 2 pseudogene 3 Human DNA Binding NR_028059 Q13401
PNKP polynucleotide kinase 3'-phosphatase Human DNA Binding 11284 Q96T60
PNN pinin, desmosome associated protein Human DNA Binding 5411 Q9H307
PNPLA4 patatin-like phospholipase domain containing 4 Human DNA Binding NM_004650 A0A024RBU8
PNRC1 proline-rich nuclear receptor coactivator 1 Human DNA Binding 10957 Q12796
POFUT1 protein O-fucosyltransferase 1 Human DNA Binding 23509 Q9H488
POLA2 polymerase (DNA directed), alpha 2, accessory subunit Human DNA Binding 23649 Q14181
POLD1 polymerase (DNA directed), delta 1, catalytic subunit Human DNA Binding 5424 P28340
POLE3 polymerase (DNA directed), epsilon 3, accessory subunit Human DNA Binding 54107 Q9NRF9
POLQ polymerase (DNA directed), theta Human DNA Binding 10721 O75417
POLR1C polymerase (RNA) I polypeptide C, 30kDa Human DNA Binding 9533 O15160
POLR1D polymerase (RNA) I polypeptide D, 16kDa Human DNA Binding 51082 Q9Y2S0
POLR2A polymerase (RNA) II (DNA directed) polypeptide A, 220kDa Human DNA Binding 5430 P24928
POLR2B polymerase (RNA) II (DNA directed) polypeptide B, 140kDa Human DNA Binding 5431 P30876
POLR2C polymerase (RNA) II (DNA directed) polypeptide C, 33kDa Human DNA Binding 5432 P19387
POLR2H polymerase (RNA) II (DNA directed) polypeptide H Human DNA Binding 5437 P52434
POLR2K polymerase (RNA) II (DNA directed) polypeptide K, 7.0kDa Human DNA Binding NM_005034 A0A024R9G0
POLR2L polymerase (RNA) II (DNA directed) polypeptide L, 7.6kDa Human DNA Binding 5441 P62875
POLR3A polymerase (RNA) III (DNA directed) polypeptide A, 155kDa Human DNA Binding 11128 O14802
POLR3C polymerase (RNA) III (DNA directed) polypeptide C (62kD) Human DNA Binding 10623 Q9BUI4
POLR3G polymerase (RNA) III (DNA directed) polypeptide G (32kD) Human DNA Binding 10622 O15318
POLR3K polymerase (RNA) III (DNA directed) polypeptide K, 12.3 kDa Human DNA Binding 51728 Q9Y2Y1
POP5 processing of precursor 5, ribonuclease P/MRP subunit (S. cerevisiae) Human DNA Binding NM_015918 Q969H6
POU2F1 POU class 2 homeobox 1 Human DNA Binding 5451 P14859
PPA1 pyrophosphatase (inorganic) 1 Human DNA Binding 5464 Q15181
PPA2 pyrophosphatase (inorganic) 2 Human DNA Binding 27068 Q9H2U2
PPAN peter pan homolog (Drosophila) Human DNA Binding 56342 Q9NQ55
PPAN-P2RY11 PPAN-P2RY11 readthrough Human DNA Binding 692312 Q9NQ55
PPAT phosphoribosyl pyrophosphate amidotransferase Human DNA Binding 5471 A8K4H7
PPCS phosphopantothenoylcysteine synthetase Human DNA Binding 79717 Q9HAB8
PPDPF pancreatic progenitor cell differentiation and proliferation factor homolog (zebrafish) Human DNA Binding 79144 Q9H3Y8
PPFIA3 protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3 Human DNA Binding 8541 O75145
PPFIBP1 PTPRF interacting protein, binding protein 1 (liprin beta 1) Human DNA Binding 8496 Q86W92
PPHLN1 periphilin 1 Human DNA Binding 51535 Q8NEY8
PPIA peptidylprolyl isomerase A (cyclophilin A) Human DNA Binding 5478 P62937
PPIAL4D peptidylprolyl isomerase A (cyclophilin A)-like 4D Human DNA Binding NM_001164261 F5H284
PPIB peptidylprolyl isomerase B (cyclophilin B) Human DNA Binding 5479 P23284
PPIG peptidylprolyl isomerase G (cyclophilin G) Human Protein Binding 9360 Q13427
PPIL1 peptidylprolyl isomerase (cyclophilin)-like 1 Human DNA Binding 51645 Q9Y3C6
PPIL3 peptidylprolyl isomerase (cyclophilin)-like 3 Human DNA Binding NM_131916 Q9H2H8
PPIL6 peptidylprolyl isomerase (cyclophilin)-like 6 Human DNA Binding 285755 Q8IXY8
PPM1G protein phosphatase, Mg2+/Mn2+ dependent, 1G Human DNA Binding 5496 O15355
PPP1CC protein phosphatase 1, catalytic subunit, gamma isozyme Human DNA Binding 5501 P36873
PPP1R10 protein phosphatase 1, regulatory subunit 10 Human DNA Binding 5514 Q96QC0
PPP1R15B protein phosphatase 1, regulatory subunit 15B Human DNA Binding 84919 Q5SWA1
PPP1R21 Protein phosphatase 1 regulatory subunit 21 Human DNA Binding 129285 Q6ZMI0
PPP1R3E protein phosphatase 1, regulatory subunit 3E Human DNA Binding NR_026862 Q9H7J1
PPP1R8 protein phosphatase 1, regulatory subunit 8 Human DNA Binding 5511 Q12972
PPP1R9A protein phosphatase 1, regulatory subunit 9A Human DNA Binding 55607 Q9ULJ8
PPP1R9B protein phosphatase 1, regulatory (inhibitor) subunit 9B Human DNA Binding 84687 Q96SB3
PPP2CB protein phosphatase 2, catalytic subunit, beta isozyme Human DNA Binding 5516 P62714
PPP2R2A protein phosphatase 2, regulatory subunit B, alpha Human DNA Binding 5520 P63151
PPP2R3A protein phosphatase 2, regulatory subunit B'', alpha Human DNA Binding 5523 B4DNU1
PPP2R5A protein phosphatase 2, regulatory subunit B', alpha Human DNA Binding 5525 Q15172
PPP2R5C protein phosphatase 2, regulatory subunit B', gamma Human DNA Binding 5527 B4DYJ8
PPP2R5E protein phosphatase 2, regulatory subunit B', epsilon isoform Human DNA Binding 5529 Q16537
PPP3R1 protein phosphatase 3, regulatory subunit B, alpha Human DNA Binding 5534 P63098
PPP4R1 protein phosphatase 4, regulatory subunit 1 Human DNA Binding 9989 Q8TF05
PPP5D1 Protein PPP5D1 Human DNA Binding 100506012 E7EU14
PPP6R3 protein phosphatase 6, regulatory subunit 3 Human DNA Binding 55291 Q5H9R7
PPRC1 peroxisome proliferator-activated receptor gamma, coactivator-related 1 Human DNA Binding 23082 Q5VV67
PPTC7 PTC7 protein phosphatase homolog (S. cerevisiae) Human DNA Binding 160760 Q8NI37
PPWD1 peptidylprolyl isomerase domain and WD repeat containing 1 Human DNA Binding 23398 Q96BP3
PRADC1 Protease-associated domain-containing protein 1 Human DNA Binding 84279 Q9BSG0
PRCC papillary renal cell carcinoma (translocation-associated) Human DNA Binding 5546 Q92733
PRDM15 PR domain containing 15 Human DNA Binding 63977 E9PF37
PRDM2 PR domain containing 2, with ZNF domain Human Direct Regulation 7799 Q13029
PRDM5 PR domain containing 5 Human DNA Binding NM_018699 Q9NQX1
PRDX1 peroxiredoxin 1 Human DNA Binding 5052 Q06830
PRELID1 PRELI domain containing 1 Human DNA Binding 27166 D6RD25
PRH1-PRR4 Human DNA Binding 100533464 NA
PRICKLE1 prickle homolog 1 (Drosophila) Human DNA Binding 144165 B3KVG3
PRIM1 primase, DNA, polypeptide 1 (49kDa) Human DNA Binding 5557 P49642
PRKAA1 protein kinase, AMP-activated, alpha 1 catalytic subunit Human DNA Binding 5562 Q13131
PRKACB protein kinase, cAMP-dependent, catalytic, beta Human DNA Binding NM_207578 P22694
PRKAR1B protein kinase, cAMP-dependent, regulatory, type I, beta Human DNA Binding 5575 P31321
Prkar2b protein kinase, cAMP-dependent, regulatory, type II, beta Rat Protein Binding 24679 P12369
PRKCG protein kinase C, gamma Human DNA Binding 5582 P05129
PRKCSH protein kinase C substrate 80K-H Human DNA Binding 5589 P14314
PRKD2 protein kinase D2 Human DNA Binding 25865 Q9BZL6
PRKG1 protein kinase, cGMP-dependent, type I Human DNA Binding 5592 Q13976
PRKRIP1 PRKR interacting protein 1 (IL11 inducible) Human DNA Binding 79706 Q9H875
PRMT2 protein arginine methyltransferase 2 Human DNA Binding 3275 P55345
PRMT3 protein arginine methyltransferase 3 Human DNA Binding 10196 Q8WUV3
PRMT7 protein arginine methyltransferase 7 Human DNA Binding 54496 Q9NVM4
PROSC Proline synthase co-transcribed bacterial homolog protein Human DNA Binding 11212 O94903
PROSER1 proline and serine rich 1 Human DNA Binding 80209 Q86XN7
PRPF3 PRP3 pre-mRNA processing factor 3 homolog (S. cerevisiae) Human DNA Binding 9129 O43395
PRPF40A PRP40 pre-mRNA processing factor 40 homolog A (S. cerevisiae) Human DNA Binding 55660 O75400
PRPSAP2 phosphoribosyl pyrophosphate synthetase-associated protein 2 Human DNA Binding 5636 O60256
PRR11 proline rich 11 Human DNA Binding 55771 Q96HE9
PRR12 Human DNA Binding
PRR14 proline rich 14 Human DNA Binding 78994 Q9BWN1
PRR19 Proline-rich protein 19 Human DNA Binding 284338 A6NJB7
PRR3 proline rich 3 Human DNA Binding 80742 B3KQA4
PRRC2A proline-rich coiled-coil 2A Human DNA Binding 7916 P48634
PSD Human DNA Binding
PSIP1 PC4 and SFRS1 interacting protein 1 Human DNA Binding 11168 O75475
PSKH1 protein serine kinase H1 Human DNA Binding 5681 P11801
PSMA2 proteasome (prosome, macropain) subunit, alpha type, 2 Human DNA Binding 5683 P25787
PSMA3 proteasome (prosome, macropain) subunit, alpha type, 3 Human DNA Binding 5684 P25788
PSMA4 proteasome (prosome, macropain) subunit, alpha type, 4 Human DNA Binding 5685 P25789
PSMA5 proteasome (prosome, macropain) subunit, alpha type, 5 Human DNA Binding 5686 B4E2V4
PSMA7 proteasome (prosome, macropain) subunit, alpha type, 7 Human DNA Binding 5688 O14818
PSMB1 proteasome (prosome, macropain) subunit, beta type, 1 Human DNA Binding 5689 P20618
PSMB10 proteasome (prosome, macropain) subunit, beta type, 10 Human DNA Binding NM_002801 P40306
PSMB2 proteasome (prosome, macropain) subunit, beta type, 2 Human DNA Binding 5690 B7Z478
PSMB3 proteasome (prosome, macropain) subunit, beta type, 3 Human DNA Binding 5691 P49720
PSMB5 proteasome (prosome, macropain) subunit, beta type, 5 Human DNA Binding 5693 E9PAV2
PSMB6 proteasome (prosome, macropain) subunit, beta type, 6 Human DNA Binding 5694 P28072
PSMB9 proteasome (prosome, macropain) subunit, beta type, 9 Human DNA Binding 5698 P28065
PSMC2 proteasome (prosome, macropain) 26S subunit, ATPase, 2 Human DNA Binding 5701 B7Z571
PSMC3 proteasome (prosome, macropain) 26S subunit, ATPase, 3 Human Protein Binding 5702 P17980
PSMC3IP PSMC3 interacting protein Human DNA Binding 29893 C5ILB7
PSMC4 proteasome (prosome, macropain) 26S subunit, ATPase, 4 Human DNA Binding 5704 A8K2M0
PSMC6 proteasome (prosome, macropain) 26S subunit, ATPase, 6 Human DNA Binding 5706 P62333
PSMD11 proteasome (prosome, macropain) 26S subunit, non-ATPase, 11 Human DNA Binding 5717 O00231
PSMD12 proteasome (prosome, macropain) 26S subunit, non-ATPase, 12 Human DNA Binding 5718 O00232
PSMD13 proteasome (prosome, macropain) 26S subunit, non-ATPase, 13 Human DNA Binding 5719 Q9UNM6
PSMD14 proteasome (prosome, macropain) 26S subunit, non-ATPase, 14 Human DNA Binding 10213 O00487
PSMD9 proteasome (prosome, macropain) 26S subunit, non-ATPase, 9 Human DNA Binding 5715 O00233
PSME3 proteasome (prosome, macropain) activator subunit 3 (PA28 gamma; Ki) Human Protein Binding 10197 P61289
PSME4 proteasome (prosome, macropain) activator subunit 4 Human DNA Binding 23198 Q14997
PSMG1 proteasome (prosome, macropain) assembly chaperone 1 Human DNA Binding NM_003720 O95456
PSMG2 proteasome (prosome, macropain) assembly chaperone 2 Human DNA Binding 56984 Q969U7
PSMG4 proteasome (prosome, macropain) assembly chaperone 4 Human DNA Binding 389362 Q5JS54
PSPC1 paraspeckle component 1 Human DNA Binding 55269 B4DWI8
PTBP1 polypyrimidine tract binding protein 1 Human DNA Binding 5725 P26599
PTBP2 polypyrimidine tract binding protein 2 Human DNA Binding 58155 Q9UKA9
PTBP3 Polypyrimidine tract-binding protein 3 Human DNA Binding 9991 O95758
PTCD3 pentatricopeptide repeat domain 3 Human DNA Binding 55037 Q96EY7
PTCHD2 Patched domain-containing protein 2 Human DNA Binding 57540 Q9P2K9
PTGES2 Prostaglandin E synthase 2 Human DNA Binding 80142 Q9H7Z7
PTGES3 prostaglandin E synthase 3 (cytosolic) Human DNA Binding 10728 Q15185
PTGR2 prostaglandin reductase 2 Human DNA Binding NM_001146154 Q8N8N7
PTK2 PTK2 protein tyrosine kinase 2 Human DNA Binding 5747 Q05397
PTMA prothymosin, alpha Human DNA Binding 5757 P06454
PTMS parathymosin Human DNA Binding 5763 P20962
PTOV1 prostate tumor overexpressed 1 Human DNA Binding 53635 Q86YD1
PTP4A1 protein tyrosine phosphatase type IVA, member 1 Human DNA Binding 7803 Q93096
PTP4A2 protein tyrosine phosphatase type IVA, member 2 Human DNA Binding 8073 Q12974
PTPLAD1 protein tyrosine phosphatase-like A domain containing 1 Human DNA Binding 51495 Q9P035
PTPLB protein tyrosine phosphatase-like (proline instead of catalytic arginine), member b Human DNA Binding 201562 Q6Y1H2
PTPN12 protein tyrosine phosphatase, non-receptor type 12 Human DNA Binding 5782 B4E105
PTPN14 protein tyrosine phosphatase, non-receptor type 14 Human DNA Binding 5784 A8K6H6
PTPN2 protein tyrosine phosphatase, non-receptor type 2 Human DNA Binding 5771 P17706
PTPN9 protein tyrosine phosphatase, non-receptor type 9 Human DNA Binding 5780 P43378
PTPRJ protein tyrosine phosphatase, receptor type, J Human DNA Binding 5795 Q12913
PTPRS protein tyrosine phosphatase, receptor type, S Human DNA Binding 5802 Q13332
PTRH2 peptidyl-tRNA hydrolase 2 Human DNA Binding 51651 Q9Y3E5
PURB purine-rich element binding protein B Human DNA Binding 5814 Q96QR8
PUS10 Putative tRNA pseudouridine synthase Pus10 Human DNA Binding 150962 Q3MIT2
PVRL1 poliovirus receptor-related 1 (herpesvirus entry mediator C) Human DNA Binding 5818 Q15223
PWWP2B PWWP domain containing 2B Human DNA Binding 170394 H9KV61
PXDN peroxidasin homolog (Drosophila) Human DNA Binding 7837 Q92626
PXK PX domain containing serine/threonine kinase Human DNA Binding 54899 Q7Z7A4
PYGB phosphorylase, glycogen; brain Human DNA Binding 5834 P11216
PYGL phosphorylase, glycogen, liver Human DNA Binding 5836 P06737
PYGO1 pygopus homolog 1 (Drosophila) Human DNA Binding 26108 Q9Y3Y4
PYGO2 pygopus homolog 2 (Drosophila) Human DNA Binding 90780 Q5T170
QARS glutaminyl-tRNA synthetase Human DNA Binding 5859 P47897
QKI quaking homolog, KH domain RNA binding (mouse) Human DNA Binding 9444 Q96PU8
QSER1 glutamine and serine rich 1 Human DNA Binding 79832 B3KWV1
R3HDM1 Human DNA Binding
RAB11A RAB11A, member RAS oncogene family Human DNA Binding 8766 P62491
RAB13 RAB13, member RAS oncogene family Human DNA Binding NM_002870 P51153
RAB14 RAB14, member RAS oncogene family Human DNA Binding 51552 P61106
RAB1B RAB1B, member RAS oncogene family Human DNA Binding 81876 Q9H0U4
RAB2A RAB2A, member RAS oncogene family Human DNA Binding 5862 P61019
RAB30 RAB30, member RAS oncogene family Human DNA Binding 27314 A8K5R1
RAB34 RAB34, member RAS oncogene family Human DNA Binding 83871 B4DNC0
RAB39 RAB39A, member RAS oncogene family Human DNA Binding 54734 Q14964
RAB5B RAB5B, member RAS oncogene family Human DNA Binding 5869 P61020
RAB5C RAB5C, member RAS oncogene family Human DNA Binding 5878 P51148
RAB9A RAB9A, member RAS oncogene family Human DNA Binding 9367 P51151
RABGAP1L RAB GTPase activating protein 1-like Human DNA Binding 9910 Q5R372
RABGGTB Rab geranylgeranyltransferase, beta subunit Human DNA Binding 5876 P53611
RABIF RAB interacting factor Human DNA Binding 5877 P47224
RABL3 RAB, member of RAS oncogene family-like 3 Human DNA Binding 285282 Q5HYI8
RABL6 Rab-like protein 6 Human DNA Binding 55684 Q3YEC7
RAC3 ras-related C3 botulinum toxin substrate 3 (rho family, small GTP binding protein Rac3) Human DNA Binding 5881 P60763
RACGAP1 Rac GTPase activating protein 1 Human DNA Binding 29127 B2RE34
RAD21 RAD21 homolog (S. pombe) Human DNA Binding 5885 O60216
RAD21-AS1 RAD21 antisense RNA 1 Human DNA Binding 644660 NA
RAD51AP1 RAD51 associated protein 1 Human DNA Binding 10635 Q96B01
RAD52 RAD52 homolog (S. cerevisiae) Human DNA Binding 5893 P43351
RAG1AP1 solute carrier family 50 (sugar efflux transporter), member 1 Human DNA Binding NM_018845 Q9BRV3
RAI1 retinoic acid induced 1 Human DNA Binding 10743 Q7Z5J4
RALA v-ral simian leukemia viral oncogene homolog A (ras related) Human DNA Binding 5898 P11233
RALBP1 ralA binding protein 1 Human DNA Binding 10928 Q15311
RANBP1 RAN binding protein 1 Human DNA Binding 5902 P43487
RAP2B RAP2B, member of RAS oncogene family Human DNA Binding 5912 P61225
RAPGEF2 Human DNA Binding
RAPGEF6 Rap guanine nucleotide exchange factor (GEF) 6 Human DNA Binding 51735 B2RTU6
RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 Human DNA Binding 65059 Q70E73
RASA2 RAS p21 protein activator 2 Human DNA Binding 5922 Q15283
RASSF3 Ras association (RalGDS/AF-6) domain family member 3 Human DNA Binding 283349 Q86WH2
RAVER2 ribonucleoprotein, PTB-binding 2 Human DNA Binding 55225 Q9HCJ3
RBBP6 retinoblastoma binding protein 6 Human DNA Binding 5930 Q7Z6E9
RBBP8 retinoblastoma binding protein 8 Human DNA Binding 5932 Q99708
RBL1 retinoblastoma-like 1 (p107) Human DNA Binding 5933 P28749
RBM12 RNA binding motif protein 12 Human DNA Binding 10137 Q9NTZ6
RBM15 RNA binding motif protein 15 Human DNA Binding 64783 Q96T37
RBM15B RNA binding motif protein 15B Human DNA Binding 29890 Q8NDT2
RBM16 SR-related CTD-associated factor 8 Human DNA Binding NM_014892 B7Z3A4
RBM17 RNA binding motif protein 17 Human DNA Binding 84991 Q96I25
RBM19 RNA binding motif protein 19 Human DNA Binding 9904 A8K5X9
RBM23 RNA binding motif protein 23 Human DNA Binding 55147 Q86U06
RBM25 RNA binding motif protein 25 Human DNA Binding 58517 P49756
RBM26-AS1 RBM26 antisense RNA 1 Human DNA Binding 100505538 NA
RBM27 RNA binding motif protein 27 Human DNA Binding 54439 Q9P2N5
RBM3 RNA binding motif (RNP1, RRM) protein 3 Human DNA Binding 5935 P98179
RBM34 RNA binding motif protein 34 Human DNA Binding 23029 P42696
RBM39 RNA binding motif protein 39 Human DNA Binding 9584 Q14498
RBM4 RNA binding motif protein 4 Human DNA Binding 5936 Q9BWF3
RBM5 RNA binding motif protein 5 Human DNA Binding 10181 P52756
RBM6 RNA binding motif protein 6 Human DNA Binding 10180 A8K6Q4
RBM7 RNA binding motif protein 7 Human DNA Binding 10179 Q9Y580
RBM8A RNA binding motif protein 8A Human DNA Binding 9939 Q9Y5S9
RBX1 ring-box 1, E3 ubiquitin protein ligase Human DNA Binding 9978 P62877
RCBTB2 regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 2 Human DNA Binding 1102 O95199
RCC1 regulator of chromosome condensation 1 Human DNA Binding 1104 P18754
RCC2 regulator of chromosome condensation 2 Human DNA Binding 55920 Q9P258
RCHY1 ring finger and CHY zinc finger domain containing 1, E3 ubiquitin protein ligase Human DNA Binding 25898 J3KQJ2
RCN1 reticulocalbin 1, EF-hand calcium binding domain Human DNA Binding 5954 Q15293
RCOR2 REST corepressor 2 Human DNA Binding 283248 Q8IZ40
RCOR3 REST corepressor 3 Human DNA Binding NM_001136225 Q9P2K3
RDH14 retinol dehydrogenase 14 (all-trans/9-cis/11-cis) Human DNA Binding 57665 Q53RX3
RDX radixin Human DNA Binding 5962 A7YIJ8
RECQL RecQ protein-like (DNA helicase Q1-like) Human DNA Binding 5965 P46063
REEP3 receptor accessory protein 3 Human DNA Binding 221035 Q6NUK4
REEP5 receptor accessory protein 5 Human DNA Binding 7905 Q00765
REPIN1 replication initiator 1 Human DNA Binding 29803 C9J3L7
RER1 RER1 retention in endoplasmic reticulum 1 homolog (S. cerevisiae) Human DNA Binding 11079 O15258
RERE arginine-glutamic acid dipeptide (RE) repeats Human DNA Binding 473 Q9P2R6
RETSAT retinol saturase (all-trans-retinol 13,14-reductase) Human DNA Binding 54884 Q6NUM9
REV3L REV3-like, polymerase (DNA directed), zeta, catalytic subunit Human DNA Binding 5980 O60673
RFC1 replication factor C (activator 1) 1, 145kDa Human DNA Binding 5981 P35251
RFPL4B Ret finger protein-like 4B Human Protein Binding 442247 Q6ZWI9
RFT1 RFT1 homolog (S. cerevisiae) Human DNA Binding 91869 Q96AA3
RFX3 regulatory factor X, 3 (influences HLA class II expression) Human DNA Binding 5991 P48380
RFX5 regulatory factor X, 5 (influences HLA class II expression) Human DNA Binding 5993 P48382
RFX7 regulatory factor X, 7 Human DNA Binding 64864 Q2KHR2
RG9MTD1 tRNA methyltransferase 10 homolog C (S. cerevisiae) Human DNA Binding 54931 Q7L0Y3
RGL1 ral guanine nucleotide dissociation stimulator-like 1 Human DNA Binding 23179 Q9NZL6
RHBDD3 rhomboid domain containing 3 Human DNA Binding 25807 Q9Y3P4
RHEB Ras homolog enriched in brain Human DNA Binding 6009 Q15382
RHOA ras homolog gene family, member A Human DNA Binding 387 P61586
RHOB ras homolog family member B Human DNA Binding 388 P62745
RHOBTB1 Rho-related BTB domain containing 1 Human DNA Binding 9886 O94844
RHOT1 ras homolog family member T1 Human DNA Binding 55288 Q8IXI2
RIF1 RAP1 interacting factor homolog (yeast) Human DNA Binding 55183 Q5UIP0
RIMS3 regulating synaptic membrane exocytosis 3 Human DNA Binding 9783 Q9UJD0
RIOK2 RIO kinase 2 Human DNA Binding 55781 D6RDI3
RIOK3 RIO kinase 3 (yeast) Human DNA Binding 8780 O14730
RLF rearranged L-myc fusion Human DNA Binding 6018 Q13129
RMND1 Required for meiotic nuclear division protein 1 homolog Human DNA Binding 55005 Q9NWS8
RNF103 ring finger protein 103 Human DNA Binding 7844 O00237
RNF11 ring finger protein 11 Human DNA Binding 26994 Q9Y3C5
RNF126 ring finger protein 126 Human DNA Binding 55658 A8K0Q1
RNF130 ring finger protein 130 Human DNA Binding 55819 Q86XS8
RNF138 ring finger protein 138, E3 ubiquitin protein ligase Human DNA Binding 51444 Q8WVD3
RNF139 ring finger protein 139 Human DNA Binding 11236 Q8WU17
RNF146 ring finger protein 146 Human DNA Binding 81847 Q9NTX7
RNF165 RING finger protein 165 Human DNA Binding 494470 Q6ZSG1
RNF167 ring finger protein 167 Human DNA Binding 26001 Q9H6Y7
RNF168 ring finger protein 168, E3 ubiquitin protein ligase Human DNA Binding 165918 Q8IYW5
RNF19A ring finger protein 19A, E3 ubiquitin protein ligase Human DNA Binding 25897 Q9NV58
RNF208 RING finger protein 208 Human DNA Binding 727800 Q9H0X6
RNF214 ring finger protein 214 Human DNA Binding 257160 Q8ND24
RNF220 ring finger protein 220 Human DNA Binding 55182 Q5VTB9
RNF25 ring finger protein 25 Human DNA Binding NM_022453 Q96BH1
RNF34 ring finger protein 34, E3 ubiquitin protein ligase Human DNA Binding 80196 Q969K3
RNF4 ring finger protein 4 Human DNA Binding 6047 P78317
RNF43 ring finger protein 43 Human DNA Binding 54894 Q68DV7
RNF44 ring finger protein 44 Human DNA Binding 22838 Q7L0R7
RNF6 ring finger protein (C3H2C3 type) 6 Human DNA Binding 6049 Q9Y252
RNF7 ring finger protein 7 Human DNA Binding NM_183237 Q9UBF6
RNH1 ribonuclease/angiogenin inhibitor 1 Human DNA Binding 6050 P13489
RNMTL1 RNA methyltransferase like 1 Human DNA Binding 55178 Q9HC36
RNU12 RNA, U12 small nuclear 2, pseudogene Human DNA Binding NR_000041
RNU12P RNA, U12 small nuclear Human DNA Binding NR_029422
ROBO1 roundabout, axon guidance receptor, homolog 1 (Drosophila) Human DNA Binding 6091 E9PD49
ROCK1 Rho-associated, coiled-coil containing protein kinase 1 Human DNA Binding 6093 Q13464
ROD1 polypyrimidine tract binding protein 3 Human DNA Binding 9991 O95758
RPA2 replication protein A2, 32kDa Human DNA Binding 6118 P15927
RPA3 replication protein A3, 14kDa Human DNA Binding 6119 A4D105
RPAIN RPA interacting protein Human DNA Binding 84268 Q86UA6
RPAP3 RNA polymerase II associated protein 3 Human DNA Binding 79657 Q9H6T3
RPF2 ribosome production factor 2 homolog (S. cerevisiae) Human DNA Binding 84154 Q9H7B2
RPL10 ribosomal protein L10 Human DNA Binding 6134 P27635
RPL11 ribosomal protein L11 Human DNA Binding 6135 P62913
RPL12 ribosomal protein L12 Human DNA Binding 6136 P30050
RPL13 ribosomal protein L13 Human DNA Binding 6137 A8K4C8
RPL13A ribosomal protein L13a Human DNA Binding 23521 P40429
RPL13AP5 ribosomal protein L13a pseudogene 5 Human DNA Binding NR_026712
RPL14 ribosomal protein L14 Human DNA Binding 9045 P50914
RPL15 ribosomal protein L15 Human DNA Binding 6138 P61313
RPL17 ribosomal protein L17 Human DNA Binding 6139 P18621
RPL18 ribosomal protein L18 Human DNA Binding 6141 Q07020
RPL19 ribosomal protein L19 Human DNA Binding 6143 P84098
RPL21P28 ribosomal protein L21 pseudogene 28 Human DNA Binding NR_026911
RPL22 ribosomal protein L22 Human DNA Binding 6146 P35268
RPL23 ribosomal protein L23 Human DNA Binding 9349 P62829
RPL23A ribosomal protein L23a Human DNA Binding 6147 P62750
RPL24 ribosomal protein L24 Human DNA Binding 6152 P83731
RPL26 ribosomal protein L26 Human DNA Binding NM_000987 P61254
RPL27 ribosomal protein L27 Human DNA Binding 6155 P61353
RPL27A ribosomal protein L27a Human DNA Binding 6157 P46776
RPL28 ribosomal protein L28 Human DNA Binding 6158 P46779
RPL3 ribosomal protein L3 Human DNA Binding 6122 P39023
RPL30 ribosomal protein L30 Human DNA Binding 6156 P62888
RPL34 ribosomal protein L34 Human DNA Binding 6164 P49207
RPL35 ribosomal protein L35 Human DNA Binding 11224 P42766
RPL35A ribosomal protein L35a Human DNA Binding 6165 P18077
RPL36 ribosomal protein L36 Human DNA Binding 25873 Q9Y3U8
RPL37 ribosomal protein L37 Human DNA Binding 6167 P61927
RPL37A ribosomal protein L37a Human DNA Binding 6168 P61513
RPL38 ribosomal protein L38 Human DNA Binding 6169 P63173
RPL39 ribosomal protein L39 Human DNA Binding 6170 P62891
RPL39L ribosomal protein L39-like Human DNA Binding NM_052969 Q96EH5
RPL4 ribosomal protein L4 Human DNA Binding 6124 P36578
RPL41 ribosomal protein L41 Human DNA Binding 6171 P62945
RPL7 ribosomal protein L7 Human DNA Binding 6129 P18124
RPL7L1 ribosomal protein L7-like 1 Human DNA Binding 285855 Q6DKI1
RPLP0 ribosomal protein, large, P0 Human DNA Binding 6175 P05388
RPP40 ribonuclease P/MRP 40kDa subunit Human DNA Binding 10799 O75818
RPRD1A regulation of nuclear pre-mRNA domain containing 1A Human DNA Binding 55197 Q96P16
RPRD1B regulation of nuclear pre-mRNA domain containing 1B Human DNA Binding 58490 Q9NQG5
RPRD2 regulation of nuclear pre-mRNA domain containing 2 Human DNA Binding NM_015203 Q5VT52
RPS11 ribosomal protein S11 Human DNA Binding 6205 P62280
RPS12 ribosomal protein S12 Human DNA Binding 6206 P25398
RPS13 ribosomal protein S13 Human DNA Binding 6207 P62277
RPS14 ribosomal protein S14 Human DNA Binding 6208 P62263
RPS15 ribosomal protein S15 Human DNA Binding 6209 P62841
RPS15A ribosomal protein S15a Human DNA Binding 6210 B2R4W8
RPS18 ribosomal protein S18 Human DNA Binding 6222 P62269
RPS19 ribosomal protein S19 Human DNA Binding 6223 B0ZBD0
RPS19BP1 ribosomal protein S19 binding protein 1 Human DNA Binding 91582 Q86WX3
RPS21 ribosomal protein S21 Human DNA Binding 6227 P63220
RPS24 ribosomal protein S24 Human DNA Binding 6229 P62847
RPS25 ribosomal protein S25 Human DNA Binding 6230 P62851
RPS26 ribosomal protein S26 Human DNA Binding 6231 P62854
RPS27A ribosomal protein S27a Human DNA Binding 6233 P62979
RPS29 ribosomal protein S29 Human DNA Binding 6235 P62273
RPS3 ribosomal protein S3 Human DNA Binding 6188 P23396
RPS3A ribosomal protein S3A Human DNA Binding 6189 P61247
RPS4X ribosomal protein S4, X-linked Human DNA Binding 6191 B2R491
RPS6 ribosomal protein S6 Human DNA Binding 6194 A2A3R6
RPS6KC1 ribosomal protein S6 kinase, 52kDa, polypeptide 1 Human DNA Binding 26750 B1APS8
RPS9 ribosomal protein S9 Human DNA Binding 6203 P46781
RPSA ribosomal protein SA Human DNA Binding 3921 P08865
RQCD1 RCD1 required for cell differentiation1 homolog (S. pombe) Human DNA Binding 9125 B7Z1E5
RRM1 ribonucleotide reductase M1 Human DNA Binding 6240 P23921
RRM2 ribonucleotide reductase M2 Human DNA Binding 6241 P31350
RSF1 remodeling and spacing factor 1 Human DNA Binding 51773 Q05DG0
RSL1D1 ribosomal L1 domain containing 1 Human DNA Binding 26156 O76021
RSL24D1 ribosomal L24 domain containing 1 Human DNA Binding 51187 Q9UHA3
RSPRY1 ring finger and SPRY domain containing 1 Human DNA Binding 89970 Q96DX4
RSRC1 arginine/serine-rich coiled-coil 1 Human DNA Binding 51319 Q96IZ7
RSRC2 arginine/serine-rich coiled-coil 2 Human DNA Binding 65117 Q7L4I2
RTEL1 regulator of telomere elongation helicase 1 Human DNA Binding 51750 Q9NZ71
RTF1 Rtf1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae) Human DNA Binding 23168 Q92541
RTN4RL2 reticulon 4 receptor-like 2 Human DNA Binding 349667 Q86UN3
RTTN rotatin Human DNA Binding 25914 Q86VV8
RUFY1 RUN and FYVE domain containing 1 Human DNA Binding 80230 A8K7B1
RUFY2 RUN and FYVE domain-containing protein 2 Human DNA Binding 55680 Q8WXA3
RUFY3 RUN and FYVE domain containing 3 Human DNA Binding 22902 Q7L099
RUNX2 runt-related transcription factor 2 Human DNA Binding 860 Q13950
RUSC2 RUN and SH3 domain containing 2 Human DNA Binding 9853 Q8N2Y8
RUVBL1 RuvB-like 1 (E. coli) Human DNA Binding 8607 Q9Y265
RUVBL2 RuvB-like 2 (E. coli) Human DNA Binding 10856 Q9Y230
RWDD2B RWD domain containing 2B Human DNA Binding 10069 P57060
RYK receptor-like tyrosine kinase Human DNA Binding 6259 P34925
S100A13 Protein S100-A13 Human DNA Binding 6284 Q99584
S100PBP S100P binding protein Human DNA Binding 64766 Q96BU1
SAAL1 serum amyloid A-like 1 Human DNA Binding 113174 G1UCX3
SACM1L SAC1 suppressor of actin mutations 1-like (yeast) Human DNA Binding 22908 Q9NTJ5
SAFB scaffold attachment factor B Human DNA Binding 6294 Q15424
SAFB2 scaffold attachment factor B2 Human DNA Binding 9667 Q14151
SALL4 spalt-like transcription factor 4 Human DNA Binding NM_020436 Q9UJQ4
SAMD1 Atherin Human DNA Binding 90378 Q6SPF0
SAMD10 sterile alpha motif domain containing 10 Human DNA Binding NM_080621 Q9BYL1
SAMD14 Sterile alpha motif domain-containing protein 14 Human DNA Binding 201191 Q8IZD0
SAP30 Sin3A-associated protein, 30kDa Human DNA Binding NM_003864 O75446
SAR1A SAR1 homolog A (S. cerevisiae) Human DNA Binding 56681 Q5SQT9
SARNP SAP domain containing ribonucleoprotein Human DNA Binding NM_033082 P82979
SARS2 seryl-tRNA synthetase 2, mitochondrial Human DNA Binding 54938 Q9NP81
SART3 squamous cell carcinoma antigen recognized by T cells 3 Human DNA Binding 9733 Q15020
SASS6 spindle assembly 6 homolog (C. elegans) Human DNA Binding 163786 Q6UVJ0
SATB2 SATB homeobox 2 Human DNA Binding 23314 Q9UPW6
SBDSP Shwachman-Bodian-Diamond syndrome Human DNA Binding 51119 Q9Y3A5
SC4MOL methylsterol monooxygenase 1 Human DNA Binding 6307 Q15800
SCAF1 SR-related CTD-associated factor 1 Human DNA Binding NM_021228 Q9H7N4