Human Gene Module / Chromosome 1 / FCRL6

FCRL6Fc receptor like 6

SFARI Gene Score
2
Strong Candidate Criteria 2.1
Autism Reports / Total Reports
3 / 4
Rare Variants / Common Variants
19 / 0
Aliases
FCRL6, FcRH6
Associated Syndromes
-
Chromosome Band
1q23.2
Associated Disorders
-
Relevance to Autism

A de novo splice-site variant in the FCRL6 gene was identified in an ASD proband from the Simons Simplex Collection in Sanders et al., 2012. Additional loss-of-function and damaging missense variants in this gene were identified in ASD probands from the Autism Sequencing Consortium in De Rubeis et al., 2014. Rare inherited loss-of-function variants in FCRL6 were identified in ASD probands from the Simons Simplex Collection in Krumm et al., 2015. Transmission and De Novo Association (TADA) analysis of a combined cohort consisting of 536 Chinese ASD probands and 1457 Chinese controls, as well as ASD probands and controls from the Simons Simplex Collection and the Autism Sequencing Consortium, in Guo et al., 2017 identified FCRL6 as an ASD candidate gene with a PTADA of 0.000707.

Molecular Function

This gene is xpressed by cytolytic cells including NK cells, effector and effector-memory CD8+ T-cells and Interacts with PTPN11.

External Links
Gene CardOpen Targets PlatformgnomAD browserPubMed
Human
Entrez GeneOMIMUniProtHumanBaseVariCarta
SFARI Genomic Platforms
GPF browser SFARI genome browser
Reports related to FCRL6 (4 Reports)
# Type Title Author, Year Autism Report Associated Disorders
1 Primary De novo mutations revealed by whole-exome sequencing are strongly associated with autism Sanders SJ , et al. (2012) Yes -
2 Support Synaptic, transcriptional and chromatin genes disrupted in autism De Rubeis S , et al. (2014) Yes -
3 Support Excess of rare, inherited truncating mutations in autism Krumm N , et al. (2015) Yes -
4 Recent Recommendation Targeted sequencing and functional analysis reveal brain-size-related genes and their networks in autism spectrum disorders Li J , et al. (2017) No -
Rare Variants   (19)
Status Allele Change Residue Change Variant Type Inheritance Pattern Parental Transmission Family Type PubMed ID Author, Year
C>T - stop_gained Unknown - - 25363760 De Rubeis S , et al. (2014)
C>T p.Gln174Ter stop_gained Unknown - - 25363760 De Rubeis S , et al. (2014)
c.1147G>T p.Ala383Ser stop_gained Unknown - - 25363760 De Rubeis S , et al. (2014)
c.320-1G>A - splice_site_variant De novo - Simplex 22495306 Sanders SJ , et al. (2012)
c.701C>T p.Ser234Phe missense_variant Unknown - - 25363760 De Rubeis S , et al. (2014)
c.839A>G p.Asn280Ser missense_variant Unknown - - 25363760 De Rubeis S , et al. (2014)
c.391A>G p.Arg131Gly missense_variant Familial - - 25363760 De Rubeis S , et al. (2014)
c.1079A>G p.His360Arg missense_variant Unknown - - 25363760 De Rubeis S , et al. (2014)
C>T p.Arg130Ter stop_gained Familial Maternal Simplex 25961944 Krumm N , et al. (2015)
C>T p.Arg130Ter stop_gained Familial Paternal Simplex 25961944 Krumm N , et al. (2015)
c.367C>T p.Arg123Ter stop_gained Familial Maternal Simplex 25961944 Krumm N , et al. (2015)
c.367C>T p.Arg123Ter stop_gained Familial Paternal Simplex 25961944 Krumm N , et al. (2015)
c.805C>T p.Gln269Ter stop_gained Familial Paternal Simplex 25961944 Krumm N , et al. (2015)
c.1216C>T p.Gln406Ter stop_gained Familial Maternal Simplex 25961944 Krumm N , et al. (2015)
c.1216C>T p.Gln406Ter stop_gained Familial Paternal Simplex 25961944 Krumm N , et al. (2015)
CGTGGGGAGAAAGGTGAGCT>C p.? splice_site_variant Familial - - 25363760 De Rubeis S , et al. (2014)
c.1276dup p.Leu426ProfsTer2 frameshift_variant Familial Maternal Simplex 25961944 Krumm N , et al. (2015)
c.811_823del p.Ala271ProfsTer20 frameshift_variant Familial Paternal Simplex 25961944 Krumm N , et al. (2015)
c.1271_1272insC p.Glu424AspfsTer4 frameshift_variant Familial Paternal Simplex 25961944 Krumm N , et al. (2015)
Common Variants  

No common variants reported.

SFARI Gene score
2

Strong Candidate

A de novo splice-site variant in the FCRL6 gene was identified in an ASD proband from the Simons Simplex Collection in Sanders et al., 2012. Additional loss-of-function and damaging missense variants in this gene were identified in ASD probands from the Autism Sequencing Consortium in De Rubeis et al., 2014. Rare inherited loss-of-function variants in FCRL6 were identified in ASD probands from the Simons Simplex Collection in Krumm et al., 2015. Transmission and De Novo Association (TADA) analysis of a combined cohort consisting of 536 Chinese ASD probands and 1457 Chinese controls, as well as ASD probands and controls from the Simons Simplex Collection and the Autism Sequencing Consortium, in Guo et al., 2017 identified FCRL6 as an ASD candidate gene with a PTADA of 0.000707.

Score Delta: Score remained at 2

criteria met
See SFARI Gene'scoring criteria
2

Strong Candidate

See all Category 2 Genes

We considered a rigorous statistical comparison between cases and controls, yielding genome-wide statistical significance, with independent replication, to be the strongest possible evidence for a gene. These criteria were relaxed slightly for category 2.

4/1/2022
3
icon
2

Decreased from 3 to 2

Description

A de novo splice-site variant in the FCRL6 gene was identified in an ASD proband from the Simons Simplex Collection in Sanders et al., 2012. Additional loss-of-function and damaging missense variants in this gene were identified in ASD probands from the Autism Sequencing Consortium in De Rubeis et al., 2014. Rare inherited loss-of-function variants in FCRL6 were identified in ASD probands from the Simons Simplex Collection in Krumm et al., 2015. Transmission and De Novo Association (TADA) analysis of a combined cohort consisting of 536 Chinese ASD probands and 1457 Chinese controls, as well as ASD probands and controls from the Simons Simplex Collection and the Autism Sequencing Consortium, in Guo et al., 2017 identified FCRL6 as an ASD candidate gene with a PTADA of 0.000707.

10/1/2019
4
icon
3

Decreased from 4 to 3

New Scoring Scheme
Description

A de novo splice-site variant in the FCRL6 gene was identified in an ASD proband from the Simons Simplex Collection in Sanders et al., 2012. Additional loss-of-function and damaging missense variants in this gene were identified in ASD probands from the Autism Sequencing Consortium in De Rubeis et al., 2014. Rare inherited loss-of-function variants in FCRL6 were identified in ASD probands from the Simons Simplex Collection in Krumm et al., 2015. Transmission and De Novo Association (TADA) analysis of a combined cohort consisting of 536 Chinese ASD probands and 1457 Chinese controls, as well as ASD probands and controls from the Simons Simplex Collection and the Autism Sequencing Consortium, in Guo et al., 2017 identified FCRL6 as an ASD candidate gene with a PTADA of 0.000707.

Reports Added
[New Scoring Scheme]
7/1/2017
icon
4

Increased from to 4

Description

A de novo splice-site variant in the FCRL6 gene was identified in an ASD proband from the Simons Simplex Collection in Sanders et al., 2012. Additional loss-of-function and damaging missense variants in this gene were identified in ASD probands from the Autism Sequencing Consortium in De Rubeis et al., 2014. Rare inherited loss-of-function variants in FCRL6 were identified in ASD probands from the Simons Simplex Collection in Krumm et al., 2015. Transmission and De Novo Association (TADA) analysis of a combined cohort consisting of 536 Chinese ASD probands and 1457 Chinese controls, as well as ASD probands and controls from the Simons Simplex Collection and the Autism Sequencing Consortium, in Guo et al., 2017 identified FCRL6 as an ASD candidate gene with a PTADA of 0.000707.

Krishnan Probability Score

Score 0.44720204122619

Ranking 13799/25841 scored genes


[Show Scoring Methodology]
Krishnan and colleagues generated probability scores genome-wide by using a machine learning approach on a human brain-specific gene network. The method was first presented in Nat Neurosci 19, 1454-1462 (2016), and scores for more than 25,000 RefSeq genes can be accessed in column G of supplementary table 3 (see: http://www.nature.com/neuro/journal/v19/n11/extref/nn.4353-S5.xlsx). A searchable browser, with the ability to view networks of associated ASD risk genes, can be found at asd.princeton.edu.
Original Source
ExAC Score

Score 5.0822124060882E-14

Ranking 17544/18225 scored genes


[Show Scoring Methodology]
The Exome Aggregation Consortium (ExAC) is a summary database of 60,706 exomes that has been widely used to estimate 'constraint' on mutation for individual genes. It was introduced by Lek et al. Nature 536, 285-291 (2016), and the ExAC browser can be found at exac.broadinstitute.org. The pLI score was developed as measure of intolerance to loss-of- function mutation. A pLI > 0.9 is generally viewed as highly constrained, and thus any loss-of- function mutations in autism in such a gene would be more likely to confer risk. For a full list of pLI scores see: ftp://ftp.broadinstitute.org/pub/ExAC_release/release0.3.1/functional_gene_constraint/fordist_cle aned_exac_nonTCGA_z_pli_rec_null_data.txt
Original Source
Sanders TADA Score

Score 0.16136505321196

Ranking 91/18665 scored genes


[Show Scoring Methodology]
The TADA score ('Transmission and De novo Association') was introduced by He et al. PLoS Genet 9(8):e1003671 (2013), and is a statistic that integrates evidence from both de novo and transmitted mutations. It forms the basis for the claim of 65 individual genes being strongly associated with autism risk at a false discovery rate of 0.1 (Sanders et al. Neuron 87, 1215-1233 (2015)). The calculated TADA score for 18,665 RefSeq genes can be found in column P of Supplementary Table 6 in the Sanders et al. paper (the column headed 'tadaFdrAscSscExomeSscAgpSmallDel'), which represents a combined analysis of exome data and small de novo deletions (see www.cell.com/cms/attachment/2038545319/2052606711/mmc7.xlsx).
Original Source
Submit New Gene

Report an Error