Human Gene Module / Chromosome 20 / KCNQ2

KCNQ2Potassium voltage-gated channel, KQT-like subfamily, member 2

Score
3
Suggestive Evidence Criteria 3.1
Autism Reports / Total Reports
2 / 18
Rare Variants / Common Variants
47 / 2
Aliases
KCNQ2, RP11-261N11.2,  BFNC,  BFNS1,  EBN,  EBN1,  EIEE7,  ENB1,  HNSPC,  KCNA11,  KV7.2,  KVEBN1
Associated Syndromes
-
Genetic Category
Rare Single Gene Mutation, Syndromic, Genetic Association
Chromosome Band
20q13.33
Associated Disorders
ADHD, ASD, DD/NDD, ID
Relevance to Autism

A paternally-inherited splice-site variant in KCNQ2 was identified in a male ASD proband (who also carried a maternally-inherited AFF2 missense variant); this variant was inherited from a father with Asperger disorder and was also observed in the proband's sister, who was reported to exhibit autistic-like behavior (Jiang et al., 2013).

Molecular Function

Reports related to KCNQ2 (18 Reports)
# Type Title Author, Year Autism Report Associated Disorders
1 Positive association PP2A-Bgamma subunit and KCNQ2 K channels in bipolar disorder. Borsotto M , et al. (2006) No -
2 Recent Recommendation Similar early characteristics but variable neurological outcome of patients with a de novo mutation of KCNQ2. Milh M , et al. (2013) No DD, ID
3 Recent Recommendation Converging Evidence for Epistasis between ANK3 and Potassium Channel Gene KCNQ2 in Bipolar Disorder. Judy JT , et al. (2013) No -
4 Primary Detection of clinically relevant genetic variants in autism spectrum disorder by whole-genome sequencing. Jiang YH , et al. (2013) Yes -
5 Positive association De novo mutations in epileptic encephalopathies. Epi4K Consortium , et al. (2013) No IS, LGS, DD, ID, ASD, ADHD
6 Support De novo insertions and deletions of predominantly paternal origin are associated with autism spectrum disorder. Dong S , et al. (2014) No -
7 Support Large-scale discovery of novel genetic causes of developmental disorders. Deciphering Developmental Disorders Study (2014) No DD, ID
8 Support Gene Mutation Analysis in 253 Chinese Children with Unexplained Epilepsy and Intellectual/Developmental Disabilities. Zhang Y , et al. (2015) No -
9 Support Mutations in HECW2 are associated with intellectual disability and epilepsy. Halvardson J , et al. (2016) No -
10 Support Meta-analysis of 2,104 trios provides support for 10 new genes for intellectual disability. Lelieveld SH , et al. (2016) No -
11 Support Clinical exome sequencing: results from 2819 samples reflecting 1000 families. Trujillano D , et al. (2016) No -
12 Support Diagnostic Targeted Resequencing in 349 Patients with Drug-Resistant Pediatric Epilepsies Identifies Causative Mutations in 30 Different Genes. Parrini E , et al. (2016) No -
13 Support Whole genome sequencing resource identifies 18 new candidate genes for autism spectrum disorder. C Yuen RK , et al. (2017) Yes -
14 Support Genomic diagnosis for children with intellectual disability and/or developmental delay. Bowling KM , et al. (2017) No Hypotonia
15 Support High Rate of Recurrent De Novo Mutations in Developmental and Epileptic Encephalopathies. Hamdan FF , et al. (2017) No DD/ID
16 Support Exome Pool-Seq in neurodevelopmental disorders. Popp B , et al. (2017) No Hypotonia
17 Support Diagnostic exome sequencing of syndromic epilepsy patients in clinical practice. Tumien B , et al. (2017) No -
18 Highly cited A novel potassium channel gene, KCNQ2, is mutated in an inherited epilepsy of newborns. Singh NA , et al. (1998) No -
Rare Variants   (47)
Status Allele Change Residue Change Variant Type Inheritance Pattern Parental Transmission Family Type PubMed ID Author, Year
c.860C>A p.Thr287Asn missense_variant De novo - - 23692823 Milh M , et al. (2013)
c.523G>T p.Val175Leu missense_variant De novo - - 23692823 Milh M , et al. (2013)
c.926C>T p.Ala309Val missense_variant De novo - - 23692823 Milh M , et al. (2013)
c.821C>T p.Thr274Met missense_variant De novo - - 23692823 Milh M , et al. (2013)
c.715G>C p.Gly239Arg missense_variant De novo - - 23692823 Milh M , et al. (2013)
c.881C>T p.Ala294Val missense_variant De novo - - 23692823 Milh M , et al. (2013)
c.911T>C p.Phe304Ser missense_variant De novo - - 23692823 Milh M , et al. (2013)
c.566G>T p.Gly189Val missense_variant De novo - - 23692823 Milh M , et al. (2013)
c.793G>A p.Ala265Thr missense_variant De novo - - 23692823 Milh M , et al. (2013)
c.886A>C p.Thr296Pro missense_variant De novo - - 23692823 Milh M , et al. (2013)
c.2318dupG p.Cys774LeufsTer91 frameshift_variant De novo - - 23692823 Milh M , et al. (2013)
c.471G>A p.Trp157Ter stop_gained De novo - - 23692823 Milh M , et al. (2013)
c.868G>A p.Gly290Ser missense_variant De novo - - 23692823 Milh M , et al. (2013)
c.997C>T p.Arg333Trp missense_variant De novo - - 23692823 Milh M , et al. (2013)
c.1247 + 1G>A - splice_site_variant Familial Paternal Multi-generational 23849776 Jiang YH , et al. (2013)
c.431G>A p.Arg144Gln missense_variant De novo - - 23934111 Epi4K Consortium , et al. (2013)
CCTGCAATTCATCAGGGTCAGGTCACA>C - frameshift_variant De novo - Simplex 25284784 Dong S , et al. (2014)
c.846C>G p.Asp282Glu missense_variant De novo - Simplex 25533962 Deciphering Developmental Disorders Study (2014)
c.1004C>T p.Pro335Leu missense_variant De novo - Simplex 25533962 Deciphering Developmental Disorders Study (2014)
c.841G>A p.Gly281Arg missense_variant De novo - Simplex 25533962 Deciphering Developmental Disorders Study (2014)
c.793G>A p.Ala265Thr missense_variant De novo - Simplex 25533962 Deciphering Developmental Disorders Study (2014)
c.788C>T p.Thr263Ile missense_variant De novo - Multi-generational 25533962 Deciphering Developmental Disorders Study (2014)
c.365C>T p.Ser122Leu missense_variant De novo - Simplex 26544041 Zhang Y , et al. (2015)
c.956A>C p.Lys319Thr missense_variant De novo - Simplex 26544041 Zhang Y , et al. (2015)
c.830C>T p.Thr277Ile missense_variant De novo - Simplex 26544041 Zhang Y , et al. (2015)
c.1655A>C p.Lys552Thr missense_variant De novo - Simplex 26544041 Zhang Y , et al. (2015)
c.1687G>T p.Asp563Tyr missense_variant De novo - Simplex 27334371 Halvardson J , et al. (2016)
c.430C>T p.Arg144Trp missense_variant De novo - - 27479843 Lelieveld SH , et al. (2016)
c.902G>A p.Gly301Asp missense_variant De novo - - 27479843 Lelieveld SH , et al. (2016)
c.1744A>T p.Ile582Phe missense_variant De novo - - 27848944 Trujillano D , et al. (2016)
c.1342C>T p.Arg448Ter stop_gained De novo - - 27848944 Trujillano D , et al. (2016)
c.1742G>A p.Arg581Gln missense_variant De novo - - 27864847 Parrini E , et al. (2016)
c.873G>T p.Arg291Ser missense_variant De novo - - 27864847 Parrini E , et al. (2016)
c.901G>A p.Gly301Ser missense_variant De novo - - 27864847 Parrini E , et al. (2016)
c.802C>T p.Leu268Phe missense_variant De novo - - 27864847 Parrini E , et al. (2016)
c.881C>T p.Ala294Val missense_variant De novo - - 27864847 Parrini E , et al. (2016)
c.798T>A p.Asp266Glu missense_variant De novo - - 27864847 Parrini E , et al. (2016)
insT - frameshift_variant De novo - Multiplex 28263302 C Yuen RK , et al. (2017)
c.916delTTC p.Phe305del inframe_deletion De novo - - 28554332 Bowling KM , et al. (2017)
c.859A>G p.Thr287Ala missense_variant De novo - Simplex 29100083 Hamdan FF , et al. (2017)
c.902G>A p.Gly301Asp missense_variant De novo - - 29158550 Popp B , et al. (2017)
c.1067T>G p.Leu356Arg missense_variant De novo - - 29286531 Tumien B , et al. (2017)
c.283insGT - frameshift_variant Familial Maternal and paternal Multi-generational 9425895 Singh NA , et al. (1998)
c.851A>G p.Tyr284Cys missense_variant Familial - - 9425895 Singh NA , et al. (1998)
c.916G>A p.Ala306Thr missense_variant Familial - - 9425895 Singh NA , et al. (1998)
c.522del13 - frameshift_variant Familial - - 9425895 Singh NA , et al. (1998)
c.544-1G>A - splice_site_variant Familial - - 9425895 Singh NA , et al. (1998)
Common Variants   (2)
Status Allele Change Residue Change Variant Type Inheritance Pattern Paternal Transmission Family Type PubMed ID Author, Year
A/G - intron_variant - - - 16733521 Borsotto M , et al. (2006)
C/T - intron_variant - - - 16733521 Borsotto M , et al. (2006)
SFARI Gene score
3

Suggestive Evidence

A paternally-inherited splice-site variant in KCNQ2 was identified in a male ASD proband; this variant was inherited from a father with Asperger disorder and was also observed in the proband's sister, who was reported to exhibit autistic-like behavior (Jiang et al., 2013). A de novo frameshift variant in the KCNQ2 gene was identified in a male ASD proband from the Simons Simplex Collection (PMID 25284784). Mutations in the KCNQ2 gene are responsible for early infantile epileptic encephalopathy-7 (EIEE7; OMIM 613720) and benign familial neonatal seizures-1 (BFNS1; OMIM 121200).

Score Delta: Score remained at 3

3

Suggestive Evidence

See all Category 3 Genes

The literature is replete with relatively small studies of candidate genes, using either common or rare variant approaches, which do not reach the criteria set out for categories 1 and 2. Genes that had two such lines of supporting evidence were placed in category 3, and those with one line of evidence were placed in category 4. Some additional lines of "accessory evidence" (indicated as "acc" in the score cards) could also boost a gene from category 4 to 3.

1/1/2018
3
icon
3

Score remained at 3

Description

A paternally-inherited splice-site variant in KCNQ2 was identified in a male ASD proband; this variant was inherited from a father with Asperger disorder and was also observed in the proband's sister, who was reported to exhibit autistic-like behavior (Jiang et al., 2013). A de novo frameshift variant in the KCNQ2 gene was identified in a male ASD proband from the Simons Simplex Collection (PMID 25284784). Mutations in the KCNQ2 gene are responsible for early infantile epileptic encephalopathy-7 (EIEE7; OMIM 613720) and benign familial neonatal seizures-1 (BFNS1; OMIM 121200).

10/1/2017
3
icon
3

Score remained at 3

Description

A paternally-inherited splice-site variant in KCNQ2 was identified in a male ASD proband; this variant was inherited from a father with Asperger disorder and was also observed in the proband's sister, who was reported to exhibit autistic-like behavior (Jiang et al., 2013). A de novo frameshift variant in the KCNQ2 gene was identified in a male ASD proband from the Simons Simplex Collection (PMID 25284784). Mutations in the KCNQ2 gene are responsible for early infantile epileptic encephalopathy-7 (EIEE7; OMIM 613720) and benign familial neonatal seizures-1 (BFNS1; OMIM 121200).

4/1/2017
3
icon
3

Score remained at 3

Description

A paternally-inherited splice-site variant in KCNQ2 was identified in a male ASD proband; this variant was inherited from a father with Asperger disorder and was also observed in the proband's sister, who was reported to exhibit autistic-like behavior (Jiang et al., 2013). A de novo frameshift variant in the KCNQ2 gene was identified in a male ASD proband from the Simons Simplex Collection (PMID 25284784). Mutations in the KCNQ2 gene are responsible for early infantile epileptic encephalopathy-7 (EIEE7; OMIM 613720) and benign familial neonatal seizures-1 (BFNS1; OMIM 121200).

Reports Added
[A novel potassium channel gene, KCNQ2, is mutated in an inherited epilepsy of newborns.1998] [Detection of clinically relevant genetic variants in autism spectrum disorder by whole-genome sequencing.2013] [Large-scale discovery of novel genetic causes of developmental disorders.2014] [Diagnostic Targeted Resequencing in 349 Patients with Drug-Resistant Pediatric Epilepsies Identifies Causative Mutations in 30 Different Genes.2016] [Gene Mutation Analysis in 253 Chinese Children with Unexplained Epilepsy and Intellectual/Developmental Disabilities.2015] [Mutations in HECW2 are associated with intellectual disability and epilepsy.2016] [De novo mutations in epileptic encephalopathies.2013] [Clinical exome sequencing: results from 2819 samples reflecting 1000 families.2016] [PP2A-Bgamma subunit and KCNQ2 K channels in bipolar disorder.2006] [Meta-analysis of 2,104 trios provides support for 10 new genes for intellectual disability.2016] [Genomic diagnosis for children with intellectual disability and/or developmental delay.2017] [Similar early characteristics but variable neurological outcome of patients with a de novo mutation of KCNQ2.2013] [Whole genome sequencing resource identifies 18 new candidate genes for autism spectrum disorder.2017] [Converging Evidence for Epistasis between ANK3 and Potassium Channel Gene KCNQ2 in Bipolar Disorder.2013] [De novo insertions and deletions of predominantly paternal origin are associated with autism spectrum disorder.2014]
1/1/2017
3
icon
3

Score remained at 3

Description

A paternally-inherited splice-site variant in KCNQ2 was identified in a male ASD proband; this variant was inherited from a father with Asperger disorder and was also observed in the proband's sister, who was reported to exhibit autistic-like behavior (Jiang et al., 2013). A de novo frameshift variant in the KCNQ2 gene was identified in a male ASD proband from the Simons Simplex Collection (PMID 25284784). Mutations in the KCNQ2 gene are responsible for early infantile epileptic encephalopathy-7 (EIEE7; OMIM 613720) and benign familial neonatal seizures-1 (BFNS1; OMIM 121200).

10/1/2016
3
icon
3

Score remained at 3

Description

A paternally-inherited splice-site variant in KCNQ2 was identified in a male ASD proband; this variant was inherited from a father with Asperger disorder and was also observed in the proband's sister, who was reported to exhibit autistic-like behavior (Jiang et al., 2013). A de novo frameshift variant in the KCNQ2 gene was identified in a male ASD proband from the Simons Simplex Collection (PMID 25284784). Mutations in the KCNQ2 gene are responsible for early infantile epileptic encephalopathy-7 (EIEE7; OMIM 613720) and benign familial neonatal seizures-1 (BFNS1; OMIM 121200).

7/1/2016
3
icon
3

Score remained at 3

Description

A paternally-inherited splice-site variant in KCNQ2 was identified in a male ASD proband; this variant was inherited from a father with Asperger disorder and was also observed in the proband's sister, who was reported to exhibit autistic-like behavior (Jiang et al., 2013). A de novo frameshift variant in the KCNQ2 gene was identified in a male ASD proband from the Simons Simplex Collection (PMID 25284784). Mutations in the KCNQ2 gene are responsible for early infantile epileptic encephalopathy-7 (EIEE7; OMIM 613720) and benign familial neonatal seizures-1 (BFNS1; OMIM 121200).

1/1/2016
3
icon
3

Score remained at 3

Description

A paternally-inherited splice-site variant in KCNQ2 was identified in a male ASD proband; this variant was inherited from a father with Asperger disorder and was also observed in the proband's sister, who was reported to exhibit autistic-like behavior (Jiang et al., 2013). A de novo frameshift variant in the KCNQ2 gene was identified in a male ASD proband from the Simons Simplex Collection (PMID 25284784). Mutations in the KCNQ2 gene are responsible for early infantile epileptic encephalopathy-7 (EIEE7; OMIM 613720) and benign familial neonatal seizures-1 (BFNS1; OMIM 121200).

7/1/2015
icon
3

Increased from to 3

Description

A paternally-inherited splice-site variant in KCNQ2 was identified in a male ASD proband; this variant was inherited from a father with Asperger disorder and was also observed in the proband's sister, who was reported to exhibit autistic-like behavior (Jiang et al., 2013). A de novo frameshift variant in the KCNQ2 gene was identified in a male ASD proband from the Simons Simplex Collection (PMID 25284784). Mutations in the KCNQ2 gene are responsible for early infantile epileptic encephalopathy-7 (EIEE7; OMIM 613720) and benign familial neonatal seizures-1 (BFNS1; OMIM 121200).

Krishnan Probability Score

Score 0.61544698513644

Ranking 116/25841 scored genes


[Show Scoring Methodology]
Krishnan and colleagues generated probability scores genome-wide by using a machine learning approach on a human brain-specific gene network. The method was first presented in Nat Neurosci 19, 1454-1462 (2016), and scores for more than 25,000 RefSeq genes can be accessed in column G of supplementary table 3 (see: http://www.nature.com/neuro/journal/v19/n11/extref/nn.4353-S5.xlsx). A searchable browser, with the ability to view networks of associated ASD risk genes, can be found at asd.princeton.edu.
ExAC Score

Score 0.99935609863785

Ranking 983/18225 scored genes


[Show Scoring Methodology]
The Exome Aggregation Consortium (ExAC) is a summary database of 60,706 exomes that has been widely used to estimate 'constraint' on mutation for individual genes. It was introduced by Lek et al. Nature 536, 285-291 (2016), and the ExAC browser can be found at exac.broadinstitute.org. The pLI score was developed as measure of intolerance to loss-of- function mutation. A pLI > 0.9 is generally viewed as highly constrained, and thus any loss-of- function mutations in autism in such a gene would be more likely to confer risk. For a full list of pLI scores see: ftp://ftp.broadinstitute.org/pub/ExAC_release/release0.3.1/functional_gene_constraint/fordist_cle aned_exac_nonTCGA_z_pli_rec_null_data.txt
Sanders TADA Score

Score 0.35217872398636

Ranking 225/18665 scored genes


[Show Scoring Methodology]
The TADA score ('Transmission and De novo Association') was introduced by He et al. PLoS Genet 9(8):e1003671 (2013), and is a statistic that integrates evidence from both de novo and transmitted mutations. It forms the basis for the claim of 65 individual genes being strongly associated with autism risk at a false discovery rate of 0.1 (Sanders et al. Neuron 87, 1215-1233 (2015)). The calculated TADA score for 18,665 RefSeq genes can be found in column P of Supplementary Table 6 in the Sanders et al. paper (the column headed 'tadaFdrAscSscExomeSscAgpSmallDel'), which represents a combined analysis of exome data and small de novo deletions (see www.cell.com/cms/attachment/2038545319/2052606711/mmc7.xlsx).
Larsen Cumulative Evidence Score

Score 15.5

Ranking 126/461 scored genes


[Show Scoring Methodology]
Larsen and colleagues generated gene scores based on the sum of evidence for all available ASD-associated variants in a gene, with assessments based on mode of inheritance, effect size, and variant frequency in the general population. The approach was first presented in Mol Autism 7:44 (2016), and scores for 461 genes can be found in column I in supplementary table 4 from that paper.
Zhang D Score

Score 0.30659428508961

Ranking 2638/20870 scored genes


[Show Scoring Methodology]
The DAMAGES score (disease-associated mutation analysis using gene expression signatures), or D score, was developed to combine evidence from de novo loss-of- function mutation with evidence from cell-type- specific gene expression in the mouse brain (specifically translational profiles of 24 specific mouse CNS cell types isolated from 6 different brain regions). Genes with positive D scores are more likely to be associated with autism risk, with higher-confidence genes having higher D scores. This statistic was first presented by Zhang & Shen (Hum Mutat 38, 204- 215 (2017), and D scores for more than 20,000 RefSeq genes can be found in column M in supplementary table 2 from that paper.
CNVs associated with KCNQ2(1 CNVs)
20q13.33 29 Deletion-Duplication 46  /  168
Animal Models associated with KCNQ2(1 Models)
KCNQ2_1_VM_HT Genetic
Submit New Gene

Report an Error