Human Gene Module / Chromosome X / MAOA

MAOAmonoamine oxidase A

Score
3
Suggestive Evidence Criteria 3.1
Autism Reports / Total Reports
7 / 16
Rare Variants / Common Variants
9 / 5
Aliases
-
Associated Syndromes
Brunner syndrome
Genetic Category
Rare Single Gene Mutation, Syndromic, Genetic Association, Functional
Chromosome Band
Xp11.3
Associated Disorders
DD/NDD
Relevance to Autism

The 3-repeat MAO-uVNTR (low-activity) allele was associated with increased severity of autism, as measured by parent and teacher reports, IQ, adaptive skills, language assessments and multiple other scoring methods (Cohen et al., 2003 & 2011) and was found to be associated with ASD in a Korean population cohort (Yoo et al., 2009). In addition, genetic association has been found between MAOA and ADHD in an Indian population cohort (Das et al., 2006).

Molecular Function

The encoded protein degrades amine neurotransmitters.

Reports related to MAOA (16 Reports)
# Type Title Author, Year Autism Report Associated Disorders
1 Primary Association of autism severity with a monoamine oxidase A functional polymorphism. Cohen IL , et al. (2003) Yes -
2 Recent Recommendation MAOA, maltreatment, and gene-environment interaction predicting children's mental health: new evidence and a meta-analysis. Kim-Cohen J , et al. (2006) No -
3 Recent Recommendation MAOA promoter polymorphism and attention deficit hyperactivity disorder (ADHD) in indian children. Das M , et al. (2006) No -
4 Positive Association Family- and population-based association studies of monoamine oxidase A and autism spectrum disorders in Korean. Yoo HJ , et al. (2008) Yes -
5 Support Deletion of MAOA and MAOB in a male patient causes severe developmental delay, intermittent hypotonia and stereotypical hand movements. Whibley A , et al. (2010) No -
6 Positive Association Autism severity is associated with child and maternal MAOA genotypes. Cohen IL , et al. (2010) Yes -
7 Support Monoamine oxidase A and A/B knockout mice display autistic-like features. Bortolato M , et al. (2012) No -
8 Support MAOA/B deletion syndrome in male siblings with severe developmental delay and sudden loss of muscle tonus. Saito M , et al. (2013) Yes DD
9 Recent Recommendation 20 ans aprs: a second mutation in MAOA identified by targeted high-throughput sequencing in a family with altered behavior and cognition. Piton A , et al. (2013) Yes -
10 Positive Association Sexual dimorphic effect in the genetic association of monoamine oxidase A (MAOA) markers with autism spectrum disorder. Verma D , et al. (2013) Yes -
11 Recent Recommendation New insights into Brunner syndrome and potential for targeted therapy. Palmer EE , et al. (2015) No -
12 Support Integrated analysis of whole-exome sequencing and transcriptome profiling in males with autism spectrum disorders. Codina-Sol M , et al. (2015) Yes -
13 Support Exome Pool-Seq in neurodevelopmental disorders. Popp B , et al. (2017) No Behavioral anomalies
14 Support Targeted Next-Generation Sequencing in Patients with Suggestive X-Linked Intellectual Disability. Ibarluzea N , et al. (2020) No -
15 Highly Cited Aggressive behavior and altered amounts of brain serotonin and norepinephrine in mice lacking MAOA. Cases O , et al. (1995) No -
16 Highly Cited Abnormal behavior associated with a point mutation in the structural gene for monoamine oxidase A. Brunner HG , et al. (1993) No -
Rare Variants   (9)
Status Allele Change Residue Change Variant Type Inheritance Pattern Parental Transmission Family Type PubMed ID Author, Year
- - copy_number_loss Familial Maternal Multiplex 23414621 Saito M , et al. (2013)
- - copy_number_loss Familial Maternal Multiplex 20485326 Whibley A , et al. (2010)
c.730G>A p.Val244Ile missense_variant Familial Maternal - 29158550 Popp B , et al. (2017)
c.1438-2A>G - splice_site_variant Familial Maternal Multiplex 25969726 Codina-Sol M , et al. (2015)
c.133C>T p.Arg45Trp missense_variant Familial Maternal Multiplex 25807999 Palmer EE , et al. (2015)
c.617G>A p.Arg206Gln missense_variant Familial Maternal Multiplex 31906484 Ibarluzea N , et al. (2020)
c.886C>T p.Gln296Ter stop_gained Familial Maternal Multi-generational 8211186 Brunner HG , et al. (1993)
c.749_750insT p.Ser251LysfsTer2 frameshift_variant Unknown - Multiplex 25807999 Palmer EE , et al. (2015)
c.797_798delinsTT p.Cys266Phe missense_variant Familial Maternal Multi-generational 24169519 Piton A , et al. (2013)
Common Variants   (5)
Status Allele Change Residue Change Variant Type Inheritance Pattern Paternal Transmission Family Type PubMed ID Author, Year
c.-1241_-1212ACCGGCACCGGCACCAGTACCCGCACCAGT(3_5) - microsatellite - - - 16856146 Das M , et al. (2006)
c.-1241_-1212ACCGGCACCGGCACCAGTACCCGCACCAGT(3_5) - microsatellite - - - 19100789 Yoo HJ , et al. (2008)
c.-1241_-1212ACCGGCACCGGCACCAGTACCCGCACCAGT(3_5) - microsatellite - - - 12919132 Cohen IL , et al. (2003)
c.-1241_-1212ACCGGCACCGGCACCAGTACCCGCACCAGT(3_5) - microsatellite - - - 20573161 Cohen IL , et al. (2010)
c.891G>T;c.492G>T p.(=) synonymous_variant - - - 24291416 Verma D , et al. (2013)
SFARI Gene score
3

Suggestive Evidence

Gene has several association studies which are not genome-wide significant.

Score Delta: Score remained at 4

3

Suggestive Evidence

See all Category 3 Genes

The literature is replete with relatively small studies of candidate genes, using either common or rare variant approaches, which do not reach the criteria set out for categories 1 and 2. Genes that had two such lines of supporting evidence were placed in category 3, and those with one line of evidence were placed in category 4. Some additional lines of "accessory evidence" (indicated as "acc" in the score cards) could also boost a gene from category 4 to 3.

1/1/2020
4
icon
4

Score remained at 4

Description

Gene has several association studies which are not genome-wide significant.

10/1/2019
4
icon
3

Decreased from 4 to 3

New Scoring Scheme
Description

Gene has several association studies which are not genome-wide significant.

Reports Added
[New Scoring Scheme]
7/1/2018
4.3
icon
4

Decreased from 4.3 to 4

Description

Gene has several association studies which are not genome-wide significant.

10/1/2017
4
icon
4

Decreased from 4 to 4

Description

Gene has several association studies which are not genome-wide significant.

4/1/2015
7/1/2014
No data
icon
4

Increased from No data to 4

Description

Gene has several association studies which are not genome-wide significant.

4/1/2014
No data
icon
4

Increased from No data to 4

Description

Gene has several association studies which are not genome-wide significant.

Krishnan Probability Score

Score 0.44726448879571

Ranking 13422/25841 scored genes


[Show Scoring Methodology]
Krishnan and colleagues generated probability scores genome-wide by using a machine learning approach on a human brain-specific gene network. The method was first presented in Nat Neurosci 19, 1454-1462 (2016), and scores for more than 25,000 RefSeq genes can be accessed in column G of supplementary table 3 (see: http://www.nature.com/neuro/journal/v19/n11/extref/nn.4353-S5.xlsx). A searchable browser, with the ability to view networks of associated ASD risk genes, can be found at asd.princeton.edu.
ExAC Score

Score 0.99322249050876

Ranking 1648/18225 scored genes


[Show Scoring Methodology]
The Exome Aggregation Consortium (ExAC) is a summary database of 60,706 exomes that has been widely used to estimate 'constraint' on mutation for individual genes. It was introduced by Lek et al. Nature 536, 285-291 (2016), and the ExAC browser can be found at exac.broadinstitute.org. The pLI score was developed as measure of intolerance to loss-of- function mutation. A pLI > 0.9 is generally viewed as highly constrained, and thus any loss-of- function mutations in autism in such a gene would be more likely to confer risk. For a full list of pLI scores see: ftp://ftp.broadinstitute.org/pub/ExAC_release/release0.3.1/functional_gene_constraint/fordist_cle aned_exac_nonTCGA_z_pli_rec_null_data.txt
Sanders TADA Score

Score 0.93089286536752

Ranking 11551/18665 scored genes


[Show Scoring Methodology]
The TADA score ('Transmission and De novo Association') was introduced by He et al. PLoS Genet 9(8):e1003671 (2013), and is a statistic that integrates evidence from both de novo and transmitted mutations. It forms the basis for the claim of 65 individual genes being strongly associated with autism risk at a false discovery rate of 0.1 (Sanders et al. Neuron 87, 1215-1233 (2015)). The calculated TADA score for 18,665 RefSeq genes can be found in column P of Supplementary Table 6 in the Sanders et al. paper (the column headed 'tadaFdrAscSscExomeSscAgpSmallDel'), which represents a combined analysis of exome data and small de novo deletions (see www.cell.com/cms/attachment/2038545319/2052606711/mmc7.xlsx).
Larsen Cumulative Evidence Score

Score 34.5

Ranking 62/461 scored genes


[Show Scoring Methodology]
Larsen and colleagues generated gene scores based on the sum of evidence for all available ASD-associated variants in a gene, with assessments based on mode of inheritance, effect size, and variant frequency in the general population. The approach was first presented in Mol Autism 7:44 (2016), and scores for 461 genes can be found in column I in supplementary table 4 from that paper.
Zhang D Score

Score -0.23396601316553

Ranking 16094/20870 scored genes


[Show Scoring Methodology]
The DAMAGES score (disease-associated mutation analysis using gene expression signatures), or D score, was developed to combine evidence from de novo loss-of- function mutation with evidence from cell-type- specific gene expression in the mouse brain (specifically translational profiles of 24 specific mouse CNS cell types isolated from 6 different brain regions). Genes with positive D scores are more likely to be associated with autism risk, with higher-confidence genes having higher D scores. This statistic was first presented by Zhang & Shen (Hum Mutat 38, 204- 215 (2017), and D scores for more than 20,000 RefSeq genes can be found in column M in supplementary table 2 from that paper.
Submit New Gene

Report an Error

SFARI Gene Update

We are pleased to announce some changes to the ongoing curation of the data in SFARI Gene. In the context of a continued effort to develop the human gene module and its manually curated list of autism risk genes, we are modifying other aspects of the site to focus on the information that is of greatest interest to the research community. The version of SFARI Gene that has been developed until now will be frozen and will remain available as “SFARI Gene Archive”. Please see the announcement for more details.
Close