Human Gene Module / Chromosome X / MECP2

MECP2Methyl CpG binding protein 2

SFARI Gene Score
1S
High Confidence, Syndromic Criteria 1.1, Syndromic
Autism Reports / Total Reports
60 / 160
Rare Variants / Common Variants
337 / 0
EAGLE Score
106.65
Strong Learn More
Aliases
MECP2, RTS,  RTT,  PPMX,  MRX16,  MRX79,  AUTSX3,  DKFZp686A24160
Associated Syndromes
Rett syndrome, Rett syndrome, X-linked intellectual disability, MECP2 duplication syndrome, Atypcial Rett syndrome, ASD, DD, Rett syndrome, ASD, DD, Rett syndrome, DD
Chromosome Band
Xq28
Associated Disorders
SCZ, DD/NDD, ADHD, ID, EP, EPS, ASD
Genetic Category
Rare Single Gene Mutation, Syndromic, Functional
Relevance to Autism

Mutations in the MECP2 gene underlie Rett syndrome, an autism spectrum disorder. Some studies have found that rare variations in the MECP2 gene are associated with autism, while others have looked and found no variants in autistic patients. It appears that EGR2 and MECP2 can regulate each other's expression (Swanberg et al., 2009).

Molecular Function

The encoded protein has methylation-dependent transcriptional repressor activity . It is also involved in regulation of RNA splicing.

SFARI Genomic Platforms
Reports related to MECP2 (160 Reports)
# Type Title Author, Year Autism Report Associated Disorders
1 Primary Rett syndrome is caused by mutations in X-linked MECP2, encoding methyl-CpG-binding protein 2 Amir RE , et al. (1999) No -
2 Support Preserved speech variant is allelic of classic Rett syndrome De Bona C , et al. (2000) No -
3 Support A mutation in the rett syndrome gene, MECP2, causes X-linked mental retardation and progressive spasticity in males Meloni I , et al. (2000) No -
4 Support MECP2 mutation in male patients with non-specific X-linked mental retardation Orrico A , et al. (2000) No -
5 Support MECP2 is highly mutated in X-linked mental retardation Couvert P , et al. (2001) No -
6 Negative Association No mutations in the coding region of the Rett syndrome gene MECP2 in 59 autistic patients Vourc'h P , et al. (2001) No -
7 Support In-frame deletion in MECP2 causes mild nonspecific mental retardation Yntema HG , et al. (2002) No -
8 Support Neurodevelopmental disorders in males related to the gene causing Rett syndrome in females (MECP2) Moog U , et al. (2003) No -
9 Support Study of MECP2 gene in Rett syndrome variants and autistic girls Zappella M , et al. (2003) No ASD
10 Support Identification of MeCP2 mutations in a series of females with autistic disorder Carney RM , et al. (2003) Yes -
11 Support Chromosome 2 deletion encompassing the MAP2 gene in a patient with autism and Rett-like features Pescucci C , et al. (2004) Yes -
12 Positive Association MECP2 structural and 3'-UTR variants in schizophrenia, autism and other psychiatric diseases: a possible association with autism Shibayama A , et al. (2004) Yes SCZ
13 Support Submicroscopic duplication in Xq28 causes increased expression of the MECP2 gene in a boy with severe mental retardation and features of Rett syndrome Meins M , et al. (2005) No RTT
14 Support A novel familial MECP2 mutation in a young boy: clinical and molecular findings Ventura P , et al. (2006) No Epilepsy
15 Recent Recommendation A MECP2 mutation in a highly conserved aminoacid causing mental retardation in a male Campos M Jr , et al. (2008) No -
16 Recent Recommendation Genetic modifiers of MeCP2 function in Drosophila Cukier HN , et al. (2008) No -
17 Recent Recommendation Deletion of Mecp2 in Sim1-expressing neurons reveals a critical role for MeCP2 in feeding behavior, aggression, and the response to stress Fyffe SL , et al. (2008) No -
18 Recent Recommendation MECP2 genomic structure and function: insights from ENCODE Singh J , et al. (2008) No -
19 Recent Recommendation Reciprocal co-regulation of EGR2 and MECP2 is disrupted in Rett syndrome and autism Swanberg SE , et al. (2008) Yes -
20 Recent Recommendation MeCP2 deficiency disrupts axonal guidance, fasciculation, and targeting by altering Semaphorin 3F function Degano AL , et al. (2009) No -
21 Recent Recommendation Neuronal MeCP2 is expressed at near histone-octamer levels and globally alters the chromatin state Skene PJ , et al. (2010) No -
22 Recent Recommendation Dysfunction in GABA signalling mediates autism-like stereotypies and Rett syndrome phenotypes Chao HT , et al. (2010) No -
23 Recent Recommendation L1 retrotransposition in neurons is modulated by MeCP2 Muotri AR , et al. (2010) No -
24 Support A MECP2 missense mutation within the MBD domain in a Brazilian male with autistic disorder Campos M Jr , et al. (2011) Yes -
25 Support Oligogenic heterozygosity in individuals with high-functioning autism spectrum disorders Schaaf CP , et al. (2011) Yes -
26 Recent Recommendation Genome-wide activity-dependent MeCP2 phosphorylation regulates nervous system development and function Cohen S , et al. (2011) No -
27 Support A partial MECP2 duplication in a mildly affected adult male: a putative role for the 3' untranslated region in the MECP2 duplication phenotype Hanchard NA , et al. (2012) Yes ADHD, epilepsy
28 Support Range of genetic mutations associated with severe non-syndromic sporadic intellectual disability: an exome sequencing study Rauch A , et al. (2012) No Epilepsy, ASD
29 Support The expanding role of MBD genes in autism: identification of a MECP2 duplication and novel alterations in MBD5, MBD6, and SETDB1 Cukier HN , et al. (2012) Yes -
30 Recent Recommendation Overexpression of methyl-CpG binding protein 2 impairs T(H)1 responses Yang T , et al. (2012) No -
31 Recent Recommendation MeCP2 binds to 5hmC enriched within active genes and accessible chromatin in the nervous system Melln M , et al. (2012) No -
32 Support Rare complete knockouts in humans: population distribution and significant role in autism spectrum disorders Lim ET , et al. (2013) Yes -
33 Support Using whole-exome sequencing to identify inherited causes of autism Yu TW , et al. (2013) Yes -
34 Recent Recommendation Bisphenol A delays the perinatal chloride shift in cortical neurons by epigenetic effects on the Kcc2 promoter Yeo M , et al. (2013) No -
35 Recent Recommendation An AT-hook domain in MeCP2 determines the clinical course of Rett syndrome and related disorders Baker SA , et al. (2013) No -
36 Recent Recommendation Rett syndrome mutations abolish the interaction of MeCP2 with the NCoR/SMRT co-repressor Lyst MJ , et al. (2013) No -
37 Recent Recommendation Activity-dependent phosphorylation of MeCP2 threonine 308 regulates interaction with NCoR Ebert DH , et al. (2013) No -
38 Recent Recommendation Transcriptional regulation of the MET receptor tyrosine kinase gene by MeCP2 and sex-specific expression in autism and Rett syndrome Plummer JT , et al. (2013) No -
39 Recent Recommendation Oligodendrocyte lineage cells contribute unique features to Rett syndrome neuropathology Nguyen MV , et al. (2013) No -
40 Recent Recommendation Increased binding of MeCP2 to the GAD1 and RELN promoters may be mediated by an enrichment of 5-hmC in autism spectrum disorder (ASD) cerebellum Zhubi A , et al. (2014) No -
41 Support De novo mutations in schizophrenia implicate chromatin remodeling and support a genetic overlap with autism and intellectual disability McCarthy SE , et al. (2014) No -
42 Recent Recommendation GluD1 is a common altered player in neuronal differentiation from both MECP2-mutated and CDKL5-mutated iPS cells Livide G , et al. (2014) No -
43 Support Efficient strategy for the molecular diagnosis of intellectual disability using targeted high-throughput sequencing Redin C , et al. (2014) No -
44 Support Effectiveness of exome and genome sequencing guided by acuity of illness for diagnosis of neurodevelopmental disorders Soden SE , et al. (2014) No ADHD
45 Support Large-scale discovery of novel genetic causes of developmental disorders Deciphering Developmental Disorders Study (2014) No Stereotypic behavior
46 Support Mutations in epilepsy and intellectual disability genes in patients with features of Rett syndrome Olson HE , et al. (2015) No Epilepsy
47 Support MECP2 missense mutations outside the canonical MBD and TRD domains in males with intellectual disability Bianciardi L , et al. (2015) No ASD
48 Support Next-generation sequencing using a pre-designed gene panel for the molecular diagnosis of congenital disorders in pediatric patients Lim EC , et al. (2015) No Developmental regression, hypotonia
49 Support Comprehensive molecular testing in patients with high functioning autism spectrum disorder Alvarez-Mora MI , et al. (2016) Yes -
50 Support The MECP2 variant c.925C>T (p.Arg309Trp) causes intellectual disability in both males and females without classic features of Rett syndrome Schnewolf-Greulich B , et al. (2016) No Epilepsy/seizures
51 Support Identification of Intellectual Disability Genes in Female Patients with a Skewed X-Inactivation Pattern Fieremans N , et al. (2016) No -
52 Support Identification of a RAI1-associated disease network through integration of exome sequencing, transcriptomics, and 3D genomics Loviglio MN , et al. (2016) No Behavioral abnormalities (self-injurious, aggressi
53 Support De novo genic mutations among a Chinese autism spectrum disorder cohort Wang T , et al. (2016) Yes -
54 Support Clinical exome sequencing: results from 2819 samples reflecting 1000 families Trujillano D , et al. (2016) No DD, ID, hypotonia
55 Support Diagnostic Targeted Resequencing in 349 Patients with Drug-Resistant Pediatric Epilepsies Identifies Causative Mutations in 30 Different Genes Parrini E , et al. (2016) No Rett syndrome
56 Support Asperger syndrome and early-onset schizophrenia associated with a novel MECP2 deleterious missense variant Curie A , et al. (2017) Yes SCZ
57 Support Whole genome sequencing resource identifies 18 new candidate genes for autism spectrum disorder C Yuen RK et al. (2017) Yes Rett syndrome
58 Support A clinical utility study of exome sequencing versus conventional genetic testing in pediatric neurology Vissers LE , et al. (2017) No -
59 Support Familial cases and male cases with MECP2 mutations Zhang Q , et al. (2017) No -
60 Support Mapping autosomal recessive intellectual disability: combined microarray and exome sequencing identifies 26 novel candidate genes in 192 consanguineous families Harripaul R , et al. (2017) No -
61 Support Genomic diagnosis for children with intellectual disability and/or developmental delay Bowling KM , et al. (2017) Yes -
62 Support Identification of autism-related MECP2 mutations by whole-exome sequencing and functional validation Wen Z , et al. (2017) Yes -
63 Support Targeted sequencing and functional analysis reveal brain-size-related genes and their networks in autism spectrum disorders Li J , et al. (2017) Yes -
64 Support Clinical and molecular genetic characterization of familial MECP2 duplication syndrome in a Chinese family Li X , et al. (2017) No ASD, ID, epilepsy/seizures
65 Support Diagnostic exome sequencing of syndromic epilepsy patients in clinical practice Tumien B , et al. (2017) No -
66 Recent Recommendation Further delineation of the MECP2 duplication syndrome phenotype in 59 French male patients, with a particular focus on morphological and neurological features Miguet M , et al. (2018) No Stereotypic movements
67 Support Diagnostic value of partial exome sequencing in developmental disorders Gieldon L , et al. (2018) No -
68 Support Mosaic MECP2 variants in males with classical Rett syndrome features, including stereotypical hand movements Schnewolf-Greulich B , et al. (2018) No -
69 Support Inherited and multiple de novo mutations in autism/developmental delay risk genes suggest a multifactorial model Guo H , et al. (2018) Yes -
70 Support Both rare and common genetic variants contribute to autism in the Faroe Islands Leblond CS , et al. (2019) Yes -
71 Support Elucidation of the phenotypic spectrum and genetic landscape in primary and secondary microcephaly Boonsawat P , et al. (2019) No DD, ID
72 Support The combination of whole-exome sequencing and copy number variation sequencing enables the diagnosis of rare neurological disorders Jiao Q , et al. (2019) No ASD, epilepsy/seizures
73 Support Neurological Diseases With Autism Spectrum Disorder: Role of ASD Risk Genes Xiong J , et al. (2019) Yes ID, epilepsy/seizures
74 Support Lessons Learned from Large-Scale, First-Tier Clinical Exome Sequencing in a Highly Consanguineous Population Monies D , et al. (2019) No Epilepsy/seizures, ASD, stereotypies
75 Support Comprehensive Analysis of Rare Variants of 101 Autism-Linked Genes in a Hungarian Cohort of Autism Spectrum Disorder Patients Balicza P , et al. (2019) Yes Rett syndrome
76 Support The Clinical and Genetic Features of Co-occurring Epilepsy and Autism Spectrum Disorder in Chinese Children Long S , et al. (2019) Yes -
77 Support Diagnostic Yields of Trio-WES Accompanied by CNVseq for Rare Neurodevelopmental Disorders Gao C , et al. (2019) No -
78 Support Characterization of intellectual disability and autism comorbidity through gene panel sequencing Aspromonte MC , et al. (2019) Yes -
79 Support Exome sequencing of 457 autism families recruited online provides evidence for autism risk genes Feliciano P et al. (2019) Yes -
80 Support Rare genetic susceptibility variants assessment in autism spectrum disorder: detection rate and practical use Husson T , et al. (2020) Yes -
81 Support Phenotypic and genetic spectrum of epilepsy with myoclonic atonic seizures Tang S et al. (2020) No -
82 Support Next-Generation Sequencing in Korean Children With Autism Spectrum Disorder and Comorbid Epilepsy Lee J et al. (2020) Yes Epilepsy/seizures, Rett syndrome
83 Support Targeted re-sequencing for early diagnosis of genetic causes of childhood epilepsy: the Italian experience from the 'beyond epilepsy' project Amadori E et al. (2020) No Autistic behavior
84 Support Next Generation Sequencing of 134 Children with Autism Spectrum Disorder and Regression Yin J et al. (2020) Yes Developmental regression, epilepsy/seizures
85 Support Graded and pan-neural disease phenotypes of Rett Syndrome linked with dosage of functional MeCP2 Chen X et al. (2020) No -
86 Support - Mojarad BA et al. (2021) No -
87 Support - Brunet T et al. (2021) No -
88 Support - Chen JS et al. (2021) Yes -
89 Support - Zou D et al. (2021) Yes -
90 Support - Arvio M et al. (2021) No -
91 Support - Gardner EJ et al. (2021) No -
92 Support - Du X et al. (2021) Yes Epilepsy/seizures
93 Support - Chen S et al. (2021) Yes DD, ID, epilepsy/seizures
94 Recent Recommendation - Zhou J et al. (2022) No -
95 Support - Xia S et al. (2022) No -
96 Support - Albizzati E et al. (2022) No -
97 Support - Verberne EA et al. (2022) No -
98 Support - Wang Q et al. (2022) No -
99 Support - Brea-Fernández AJ et al. (2022) No -
100 Support - Leite AJDC et al. (2022) No -
101 Support - Chuan Z et al. (2022) No ASD, DD, ID
102 Support - Hu C et al. (2022) Yes -
103 Support - Krgovic D et al. (2022) No Autistic behavior, stereotypy
104 Support - Chen Y et al. (2021) No Stereotypy
105 Support - Zhou X et al. (2022) Yes -
106 Support - Xu M et al. (2022) No -
107 Support - Torres-Prez JV et al. (2022) No -
108 Support - Li X et al. (2023) No -
109 Support - Yuan B et al. (2023) Yes -
110 Support - Miyake N et al. (2023) Yes -
111 Support - Spataro N et al. (2023) No -
112 Support - Hu C et al. (2023) Yes -
113 Support - Wang J et al. (2023) Yes -
114 Support - Cirnigliaro M et al. (2023) Yes -
115 Support - Sanchis-Juan A et al. (2023) No -
116 Support - Sheth F et al. (2023) Yes DD, ID, epilepsy/seizures
117 Support - Ko YJ et al. (2023) Yes -
118 Support - Amerh S Alqahtani et al. (2023) No -
119 Support - Yue Chai et al. (2023) Yes -
120 Support - Karthika Ajit Valaparambil et al. () Yes ADHD, DD, ID, epilepsy/seizures
121 Support - Sabin A Nettles et al. (2023) No -
122 Support - Fang-Xiao Xu et al. (2023) No -
123 Support - M Cecilia Poli et al. () Yes -
124 Support - Aniqa Tasnim et al. (2024) Yes Somatosensory behaviors
125 Support - Luigi Vetri et al. (2024) No -
126 Support - Marketa Wayhelova et al. (2024) No -
127 Support - Purvi Majethia et al. (2024) No DD
128 Support - Tamam Khalaf et al. (2024) No ASD, epilepsy/seizures
129 Support - Kirsten Furley et al. () No ASD, ID
130 Support - Nicholas J Santistevan et al. () No -
131 Recent Recommendation - Yi Liu et al. (2024) No -
132 Support - Ruohao Wu et al. (2024) No ASD, ADHD, epilepsy/seizures
133 Support - Alistair T Pagnamenta et al. (2024) No Autistic features, stereotypy
134 Support - Axel Schmidt et al. (2024) No ID, epilepsy/seizures, stereotypy
135 Support - Karen Lob et al. () Yes ADHD, DD, ID, epilepsy/seizures
136 Support - Liene Thys et al. (2024) No DD, ID, epilepsy/seizures, stereotypy
137 Support - Hosneara Akter et al. () No ASD or autistic behavior, ID
138 Support - Chengyan Li et al. (2024) Yes Epilepsy/seizures
139 Support - Ashlesha Gogate et al. (2024) Yes -
140 Support - Paola Granata et al. (2024) Yes -
141 Support - Davut Pehlivan et al. (2024) No -
142 Support - Maria Cristina Aspromonte et al. (2025) No ASD/autistic traits, epilepsy/seizures
143 Support - Kriti Arora et al. (2025) Yes DD, epilepsy/seizures
144 Support - Peng-Bo Jing et al. (2025) Yes -
145 Support - Eric Chen et al. (2025) Yes -
146 Support - Lyudmila Belenska-Todorova et al. (2025) Yes DD, epilepsy/seizures
147 Support - Sebastian Neuens et al. (2025) No DD, epilepsy/seizures, stereotypy
148 Support - Shruti Bajaj et al. () Yes DD
149 Support - Chris-Tiann Roberts et al. (2025) No ASD
150 Support - Gabriela Repiská et al. (2025) Yes -
151 Support - Ruohao Wu et al. (2025) Yes ADHD
152 Recent Recommendation - Miguel F Tenreiro et al. (2025) No ASD
153 Support - Aslihan Sanri et al. () Yes -
154 Support - Metin Eser et al. (2025) Yes -
155 Support - Yang Sui et al. (2026) Yes -
156 Support - Giancarlo Mancuso et al. (2026) Yes -
157 Support - Gülsüm Kayhan et al. (2026) Yes DD, epilepsy/seizures
158 Support - Yuan Zheng et al. (2026) No Stereotypy
159 Highly Cited MeCP2 is a transcriptional repressor with abundant binding sites in genomic chromatin Nan X , et al. (1997) No -
160 Highly Cited Transcriptional repression by the methyl-CpG-binding protein MeCP2 involves a histone deacetylase complex Nan X , et al. (1998) No -
Rare Variants   (337)
Status Allele Change Residue Change Variant Type Inheritance Pattern Parental Transmission Family Type PubMed ID Author, Year
- - delins De novo - - 34626536 Gardner EJ et al. (2021)
- - deletion De novo - - 34626536 Gardner EJ et al. (2021)
- - copy_number_gain Unknown - - 34773222 Du X et al. (2021)
CT>GT - intron_variant - - - 11309367 Couvert P , et al. (2001)
- - copy_number_loss De novo - - 30945278 Jiao Q , et al. (2019)
- - translocation De novo - - 34626536 Gardner EJ et al. (2021)
- - copy_number_gain De novo - - 29286531 Tumien B , et al. (2017)
IVS2-61C>G - intron_variant - - - 11007980 Orrico A , et al. (2000)
- - copy_number_loss De novo - - 27864847 Parrini E , et al. (2016)
- - copy_number_loss De novo - - 34626536 Gardner EJ et al. (2021)
- - copy_number_loss Unknown - - 38374498 Purvi Majethia et al. (2024)
- - copy_number_gain Familial Maternal - 31178897 Gao C , et al. (2019)
c.502C>T p.Arg168Ter stop_gained - - - 11007980 Orrico A , et al. (2000)
c.763C>T p.Arg255Ter stop_gained - - - 11007980 Orrico A , et al. (2000)
c.656C>T p.(=) synonymous_variant - - - 11007980 Orrico A , et al. (2000)
c.1558insA - frameshift_variant - - - 15211631 Shibayama A , et al. (2004)
c.916C>T p.Arg306Ter stop_gained De novo - - 35741772 Hu C et al. (2022)
c.916C>T p.Arg306Ter stop_gained Unknown - - 35741772 Hu C et al. (2022)
c.837C>T - stop_gained De novo - Simplex 10508514 Amir RE , et al. (1999)
c.1145C>T p.(=) synonymous_variant - - - 11007980 Orrico A , et al. (2000)
c.849C>G p.(=) synonymous_variant - - - 11309367 Couvert P , et al. (2001)
c.808C>T p.Arg270Ter stop_gained De novo - - 39136901 Karen Lob et al. ()
c.880C>T p.Arg294Ter stop_gained De novo - - 39136901 Karen Lob et al. ()
c.1035A>G p.(=) synonymous_variant - - - 11309367 Couvert P , et al. (2001)
c.1363G>T p.Ala455Ser stop_gained Unknown - - 34145886 Zou D et al. (2021)
c.686C>A p.Pro229His stop_gained De novo - - 31178897 Gao C , et al. (2019)
c.502C>T p.Arg168Ter stop_gained De novo - - 34800434 Chen S et al. (2021)
c.844C>T p.Arg282Ter stop_gained De novo - - 34800434 Chen S et al. (2021)
c.916C>T p.Arg306Ter stop_gained De novo - - 34800434 Chen S et al. (2021)
c.427G>T p.Ala143Ser stop_gained De novo - - 35982159 Zhou X et al. (2022)
c.916C>T p.Arg306Ter stop_gained De novo - - 36881370 Yuan B et al. (2023)
- - copy_number_gain Familial Maternal - 28333917 Vissers LE , et al. (2017)
c.582C>T p.(=) synonymous_variant - - - 21600714 Campos M Jr , et al. (2011)
c.-187_-186del - 5_prime_UTR_variant Unknown - - 34773222 Du X et al. (2021)
c.799C>T p.Arg267Ter stop_gained De novo - - 27824329 Wang T , et al. (2016)
c.916C>T p.Arg306Ter stop_gained De novo - - 27824329 Wang T , et al. (2016)
c.763C>T p.Arg255Ter stop_gained De novo - - 31139143 Long S , et al. (2019)
c.799C>T p.Arg267Ter stop_gained Unknown - - 35571021 Chuan Z et al. (2022)
c.1081_*457del - stop_lost De novo - Simplex 41577710 Yang Sui et al. (2026)
- - inversion De novo - Simplex 38776926 Alistair T Pagnamenta et al. (2024)
c.844C>T p.Arg282Ter stop_gained De novo - - 31031587 Xiong J , et al. (2019)
c.916C>T p.Arg306Ter stop_gained De novo - - 31031587 Xiong J , et al. (2019)
c.538C>T p.Arg180Ter stop_gained De novo - - 41127290 Ruohao Wu et al. (2025)
c.410A>G p.Glu137Gly missense_variant - - - 11309367 Couvert P , et al. (2001)
c.850A>G p.Lys284Glu missense_variant - - - 11309367 Couvert P , et al. (2001)
c.897C>T p.Ala299= synonymous_variant - - - 11309367 Couvert P , et al. (2001)
c.467A>G p.Lys156Arg missense_variant Unknown - - 34773222 Du X et al. (2021)
c.473C>T p.Thr158Met missense_variant Unknown - - 34773222 Du X et al. (2021)
c.824T>C p.Val275Ala missense_variant Unknown - - 34773222 Du X et al. (2021)
c.509C>T p.Thr170Met missense_variant De novo - - 37007974 Hu C et al. (2023)
c.917G>A p.Arg306Gln missense_variant De novo - - 37007974 Hu C et al. (2023)
c.916C>T p.Arg306Ter stop_gained De novo - - 36980980 Spataro N et al. (2023)
c.223C>T p.Arg75Ter stop_gained Unknown - - 39342494 Hosneara Akter et al. ()
c.1196C>T p.Pro399Leu missense_variant - - - 11309367 Couvert P , et al. (2001)
c.1358G>A p.Arg453Gln missense_variant - - - 11309367 Couvert P , et al. (2001)
c.21C>G p.Ala7= intron_variant De novo - - 28554332 Bowling KM , et al. (2017)
c.403A>G p.Lys135Glu missense_variant Unknown - - 32477112 Lee J et al. (2020)
c.455C>G p.Pro152Arg missense_variant Unknown - - 32477112 Lee J et al. (2020)
c.602C>T p.Ala201Val missense_variant Unknown - - 32477112 Lee J et al. (2020)
c.910C>T p.Leu313Phe missense_variant Unknown - - 37645600 Ko YJ et al. (2023)
c.397C>T p.Arg133Cys missense_variant Unknown - - 39136901 Karen Lob et al. ()
c.215G>A p.Gly72Asp missense_variant De novo - - 35982159 Zhou X et al. (2022)
- - copy_number_gain Familial Maternal Simplex 15689435 Meins M , et al. (2005)
- - copy_number_gain Familial Maternal Unknown 33619735 Brunet T et al. (2021)
c.880C>T p.Arg294Ter stop_gained De novo - - 12770674 Carney RM , et al. (2003)
c.763C>T p.Arg255Ter stop_gained De novo - - 27864847 Parrini E , et al. (2016)
c.763C>T p.Arg255Ter stop_gained De novo - - 31134136 Balicza P , et al. (2019)
c.799C>T p.Arg267Ter stop_gained Unknown - - 38536866 Kirsten Furley et al. ()
c.502C>T p.Arg168Ter stop_gained De novo - - 39213953 Liene Thys et al. (2024)
c.763C>T p.Arg255Ter stop_gained De novo - - 39213953 Liene Thys et al. (2024)
c.808C>T p.Arg270Ter stop_gained De novo - - 39213953 Liene Thys et al. (2024)
c.880C>T p.Arg294Ter stop_gained De novo - - 39213953 Liene Thys et al. (2024)
c.529C>T p.Arg177Ter stop_gained Unknown - - 39342494 Hosneara Akter et al. ()
c.538C>T p.Arg180Ter stop_gained Unknown - - 40117183 Kriti Arora et al. (2025)
c.808C>T p.Arg270Ter stop_gained Unknown - - 40117183 Kriti Arora et al. (2025)
c.587C>G p.Thr196Ser missense_variant - - - 15211631 Shibayama A , et al. (2004)
c.479C>G p.Thr160Arg missense_variant - - - 21600714 Campos M Jr , et al. (2011)
c.26+2T>G - splice_site_variant Unknown - - 39039281 Axel Schmidt et al. (2024)
c.925C>T p.Gln309Ter missense_variant De novo - - 31178897 Gao C , et al. (2019)
c.673C>A p.Pro225Thr missense_variant De novo - - 32469098 Tang S et al. (2020)
c.473C>T p.Thr158Met missense_variant De novo - - 34800434 Chen S et al. (2021)
c.509C>T p.Thr170Met missense_variant De novo - - 34800434 Chen S et al. (2021)
c.674C>G p.Pro225Arg missense_variant Unknown - - 34800434 Chen S et al. (2021)
c.352C>T p.Arg118Trp missense_variant De novo - - 35982159 Zhou X et al. (2022)
c.437C>G p.Ser146Cys missense_variant De novo - - 35982159 Zhou X et al. (2022)
c.508A>G p.Thr170Ala missense_variant De novo - - 35982159 Zhou X et al. (2022)
c.686C>T p.Pro229Leu missense_variant De novo - - 35982159 Zhou X et al. (2022)
c.710C>G p.Pro237Arg missense_variant De novo - - 35982159 Zhou X et al. (2022)
c.851C>T p.Pro284Leu missense_variant De novo - - 35982159 Zhou X et al. (2022)
c.916C>T p.Arg306Ter missense_variant De novo - - 35982159 Zhou X et al. (2022)
c.925C>T p.Gln309Ter missense_variant De novo - - 35982159 Zhou X et al. (2022)
c.1160C>T p.Ser387Phe synonymous_variant - - - 11309367 Couvert P , et al. (2001)
c.502C>T p.Arg168Ter stop_gained De novo - - 28333917 Vissers LE , et al. (2017)
c.502C>T p.Arg168Ter stop_gained De novo - - 28554332 Bowling KM , et al. (2017)
c.1127C>G p.Pro376Arg missense_variant - - - 15211631 Shibayama A , et al. (2004)
c.1189G>A p.Glu397Lys missense_variant - - - 21600714 Campos M Jr , et al. (2011)
c.1233C>T p.Pro411= synonymous_variant - - - 21600714 Campos M Jr , et al. (2011)
c.844C>T p.Arg282Ter stop_gained De novo - Simplex 28831199 Li J , et al. (2017)
c.916C>T p.Arg306Ter stop_gained De novo - Simplex 37645600 Ko YJ et al. (2023)
c.674C>T p.Pro225Leu missense_variant De novo - - 12615169 Moog U , et al. (2003)
c.398G>A p.Arg133His missense_variant De novo - - 30945278 Jiao Q , et al. (2019)
c.473C>T p.Thr158Met missense_variant De novo - - 30945278 Jiao Q , et al. (2019)
c.397C>T p.Arg133Cys missense_variant De novo - - 31139143 Long S , et al. (2019)
c.509C>T p.Thr170Met missense_variant De novo - - 31139143 Long S , et al. (2019)
c.916C>T p.Arg306Ter missense_variant De novo - - 31139143 Long S , et al. (2019)
c.25C>G p.Pro9Ala missense_variant Unknown - - 39342494 Hosneara Akter et al. ()
c.880C>T p.Arg294Ter stop_gained Unknown - - 27159028 Fieremans N , et al. (2016)
c.502C>T p.Arg168Ter stop_gained De novo - - 39039281 Axel Schmidt et al. (2024)
c.502C>T p.Arg168Ter stop_gained Unknown - - 39039281 Axel Schmidt et al. (2024)
c.880C>T p.Arg294Ter stop_gained De novo - Simplex 28785396 Wen Z , et al. (2017)
c.538C>T p.Arg180Ter stop_gained De novo - Simplex 30564305 Guo H , et al. (2018)
c.799C>T p.Arg267Ter stop_gained De novo - Simplex 30564305 Guo H , et al. (2018)
c.763C>T p.Arg255Ter stop_gained De novo - Simplex 35266334 Wang Q et al. (2022)
c.799C>T p.Arg267Ter stop_gained De novo - Simplex 35982159 Zhou X et al. (2022)
c.916C>T p.Arg306Ter stop_gained De novo - Simplex 35982159 Zhou X et al. (2022)
c.844C>T p.Arg282Ter stop_gained De novo - Simplex 37393044 Wang J et al. (2023)
c.473C>T p.Thr158Met missense_variant De novo - - 31031587 Xiong J , et al. (2019)
c.509C>T p.Thr170Met missense_variant De novo - - 31031587 Xiong J , et al. (2019)
c.763C>T p.Arg255Ter stop_gained Unknown - Unknown 26666243 Lim EC , et al. (2015)
c.820C>T p.Gln274Ter stop_gained Unknown - Unknown 33753861 Chen JS et al. (2021)
c.538C>T p.Arg180Ter stop_gained De novo - Simplex 37543562 Sheth F et al. (2023)
c.316C>T p.Arg106Trp missense_variant De novo - - 25914188 Olson HE , et al. (2015)
c.961C>T p.Arg321Trp missense_variant De novo - - 35813072 Krgovic D et al. (2022)
c.140C>T p.Ala47Val missense_variant Unknown - - 39342494 Hosneara Akter et al. ()
c.194C>T p.Thr65Met missense_variant Unknown - - 39342494 Hosneara Akter et al. ()
c.502C>T p.Arg168Ter stop_gained Unknown - - 31209962 Aspromonte MC , et al. (2019)
c.880C>T p.Arg294Ter stop_gained De novo - - 31209962 Aspromonte MC , et al. (2019)
c.502C>T p.Arg168Ter stop_gained De novo - Simplex 25167861 Redin C , et al. (2014)
c.397C>T p.Arg133Cys missense_variant De novo - - 27864847 Parrini E , et al. (2016)
c.915G>T p.Lys305Asn missense_variant De novo - - 27864847 Parrini E , et al. (2016)
c.397C>T p.Arg133Cys missense_variant De novo - - 30091983 Gieldon L , et al. (2018)
c.491C>G p.Pro164Arg missense_variant Unknown - - 38536866 Kirsten Furley et al. ()
c.509C>T p.Thr170Met missense_variant Unknown - - 38536866 Kirsten Furley et al. ()
c.473C>T p.Thr158Met missense_variant De novo - - 39213953 Liene Thys et al. (2024)
c.517A>G p.Lys173Glu missense_variant Unknown - - 39342494 Hosneara Akter et al. ()
c.433C>T p.Arg145Cys missense_variant Unknown - - 40117183 Kriti Arora et al. (2025)
c.509C>T p.Thr170Met missense_variant De novo - - 40117183 Kriti Arora et al. (2025)
c.800G>A p.Arg267Gln stop_gained Unknown - Simplex 28263302 C Yuen RK et al. (2017)
c.538C>T p.Arg180Ter stop_gained Unknown - Unknown 31130284 Monies D , et al. (2019)
c.916C>T p.Arg306Ter stop_gained Unknown - Unknown 31130284 Monies D , et al. (2019)
c.502C>T p.Arg168Ter stop_gained Unknown - Unknown 32631363 Amadori E et al. (2020)
c.844C>T p.Arg282Ter stop_gained De novo - Simplex 38764027 Ruohao Wu et al. (2024)
c.1922A>T p.Asp641Val missense_variant Unknown - - 38536866 Kirsten Furley et al. ()
c.433C>T p.Arg145Cys missense_variant De novo - - 38256219 Luigi Vetri et al. (2024)
c.378-3C>G p.? splice_region_variant Unknown - - 38438125 Tamam Khalaf et al. (2024)
- - copy_number_gain Familial Paternal Multiplex 22883432 Hanchard NA , et al. (2012)
- - inversion Familial Maternal Simplex 38776926 Alistair T Pagnamenta et al. (2024)
c.439A>G p.Lys147Glu missense_variant Unknown - Unknown 32722525 Yin J et al. (2020)
c.423C>G p.Tyr141Ter stop_gained De novo - Simplex 10854091 De Bona C , et al. (2000)
c.502C>T p.Arg168Ter stop_gained De novo - Simplex 10854091 De Bona C , et al. (2000)
c.763C>T p.Arg255Ter stop_gained De novo - Simplex 10854091 De Bona C , et al. (2000)
c.808C>T p.Arg270Ter stop_gained De novo - Simplex 10854091 De Bona C , et al. (2000)
c.880C>T p.Arg294Ter stop_gained De novo - Simplex 10854091 De Bona C , et al. (2000)
c.916C>T p.Arg306Ter missense_variant Unknown - - 38438125 Tamam Khalaf et al. (2024)
c.952C>T p.Arg318Cys missense_variant Unknown - - 38438125 Tamam Khalaf et al. (2024)
c.316C>T p.Arg106Trp missense_variant De novo - - 39039281 Axel Schmidt et al. (2024)
c.419C>T p.Ala140Val missense_variant Unknown - - 39039281 Axel Schmidt et al. (2024)
- - copy_number_gain Familial Maternal Multi-generational 29141583 Li X , et al. (2017)
c.455C>T p.Ala152Val missense_variant De novo - Simplex 28785396 Wen Z , et al. (2017)
c.352C>T p.Arg118Trp missense_variant De novo - Simplex 35873028 Chen Y et al. (2021)
c.434G>A p.Arg145His missense_variant De novo - Simplex 35873028 Chen Y et al. (2021)
c.916C>T p.Arg306Ter missense_variant De novo - Simplex 35873028 Chen Y et al. (2021)
c.433C>T p.Arg145Cys missense_variant De novo - Simplex 35982159 Zhou X et al. (2022)
c.710C>G p.Pro237Arg missense_variant De novo - Simplex 35982159 Zhou X et al. (2022)
c.916C>T p.Arg306Ter missense_variant De novo - Simplex 35982159 Zhou X et al. (2022)
c.710C>G p.Pro237Arg missense_variant De novo - Simplex 37393044 Wang J et al. (2023)
c.952C>T p.Arg318Cys missense_variant De novo - Simplex 37393044 Wang J et al. (2023)
c.63-44T>C - intron_variant Unknown Unknown Unknown 23055267 Cukier HN , et al. (2012)
c.538C>T p.Arg180Ter stop_gained De novo - Simplex 39528574 Chengyan Li et al. (2024)
c.1164_1207del p.Pro389Ter stop_gained Unknown - - 39039281 Axel Schmidt et al. (2024)
c.1214C>T p.Pro405Leu missense_variant De novo - - 18678449 Campos M Jr , et al. (2008)
c.1164_1207del p.Lys389Ter frameshift_variant De novo - - 35982159 Zhou X et al. (2022)
c.1108G>A p.Ala370Thr missense_variant De novo - Simplex 30564305 Guo H , et al. (2018)
c.538C>T p.Arg180Ter stop_gained Unknown Not maternal - 27824329 Wang T , et al. (2016)
c.433C>T p.Arg145Cys missense_variant De novo - Simplex 37543562 Sheth F et al. (2023)
c.491C>G p.Pro164Arg missense_variant De novo - Simplex 37543562 Sheth F et al. (2023)
c.952C>T p.Arg318Cys missense_variant De novo - Simplex 37543562 Sheth F et al. (2023)
c.434G>C p.Arg145Pro missense_variant De novo - Simplex 40841582 Shruti Bajaj et al. ()
c.413+94C>T - intron_variant Unknown Unknown Unknown 23055267 Cukier HN , et al. (2012)
c.1357C>T p.Arg453Ter stop_gained De novo - Simplex 12707946 Zappella M , et al. (2003)
c.1638G>C - 3_prime_UTR_variant Familial Maternal - 15211631 Shibayama A , et al. (2004)
c.6809T>C - 3_prime_UTR_variant Familial Maternal - 15211631 Shibayama A , et al. (2004)
c.397C>A p.Arg133Cys missense_variant De novo - Simplex 10508514 Amir RE , et al. (1999)
c.464T>C p.Phe155Ser missense_variant De novo - Simplex 10508514 Amir RE , et al. (1999)
c.473C>T p.Thr158Met missense_variant De novo - Simplex 10508514 Amir RE , et al. (1999)
c.916C>T p.Arg306Ter missense_variant De novo - Simplex 25167861 Redin C , et al. (2014)
c.916C>T p.Arg306Ter missense_variant De novo - Simplex 36973392 Miyake N et al. (2023)
c.941C>G p.Pro314Arg missense_variant De novo - Simplex 36973392 Miyake N et al. (2023)
c.433C>T p.Arg145Cys missense_variant De novo - Simplex 41409310 Aslihan Sanri et al. ()
c.21del p.Ala8ArgfsTer36 frameshift_variant De novo - - 25914188 Olson HE , et al. (2015)
c.413+102A>G - intron_variant Unknown Unknown Unknown 23055267 Cukier HN , et al. (2012)
c.916C>T p.Arg306Ter stop_gained De novo - Simplex 27848944 Trujillano D , et al. (2016)
c.433C>T p.Arg145Cys missense_variant De novo - - 40592404 Sebastian Neuens et al. (2025)
c.509C>T p.Thr170Met missense_variant De novo - - 40592404 Sebastian Neuens et al. (2025)
c.1208C>G p.Pro403Arg missense_variant Familial Maternal - 34800434 Chen S et al. (2021)
c.59_60del p.Arg20ThrfsTer21 frameshift_variant De novo - - 34800434 Chen S et al. (2021)
c.806del p.Ala269ValfsTer32 frameshift_variant De novo - - 30945278 Jiao Q , et al. (2019)
c.791del p.Gly264AlafsTer37 frameshift_variant De novo - - 35571021 Chuan Z et al. (2022)
c.500G>C p.Arg167Pro missense_variant Unknown - Multiplex 34457282 Arvio M et al. (2021)
c.608C>T p.Pro203Leu missense_variant Unknown - Unknown 11007980 Orrico A , et al. (2000)
c.352C>T p.Arg118Trp missense_variant Unknown - Unknown 31130284 Monies D , et al. (2019)
c.433C>T p.Arg145Cys missense_variant De novo - Unknown 31130284 Monies D , et al. (2019)
c.952C>T p.Arg318Cys missense_variant Unknown - Unknown 31130284 Monies D , et al. (2019)
c.845A>G p.Glu282Gly missense_variant De novo - Simplex 32094338 Husson T , et al. (2020)
c.397C>T p.Arg133Cys missense_variant Unknown - Unknown 32631363 Amadori E et al. (2020)
c.952C>T p.Arg318Cys missense_variant De novo - Simplex 38764027 Ruohao Wu et al. (2024)
c.819G>T p.(=) synonymous_variant Familial Paternal - 14986829 Pescucci C , et al. (2004)
c.808C>T p.Arg270Ter stop_gained De novo - - 30417326 Schnewolf-Greulich B , et al. (2018)
c.47_57del p.Gly16GlufsTer22 frameshift_variant Unknown - - 31139143 Long S , et al. (2019)
c.1164_1207del p.Lys389Ter frameshift_variant De novo - - 36980980 Spataro N et al. (2023)
c.1104C>G p.Ser368Arg missense_variant Unknown - Unknown 31130284 Monies D , et al. (2019)
c.398G>T p.Arg133Leu missense_variant De novo - Simplex 10854091 De Bona C , et al. (2000)
c.674C>G p.Pro225Arg missense_variant De novo - Simplex 10854091 De Bona C , et al. (2000)
c.1366G>A p.Ala456Thr missense_variant Unknown - - 26845707 Alvarez-Mora MI , et al. (2016)
c.1158_1201del p.Glu386AspfsTer4 frameshift_variant Unknown - - 35741772 Hu C et al. (2022)
c.1208C>G p.Pro403Arg missense_variant Familial Maternal - 31031587 Xiong J , et al. (2019)
c.1216G>A p.Glu406Lys missense_variant Familial Maternal - 31031587 Xiong J , et al. (2019)
c.1200_1243del p.Pro401Ter frameshift_variant De novo - - 34626536 Gardner EJ et al. (2021)
c.91del p.Gln31ArgfsTer13 frameshift_variant Unknown - - 35253369 Verberne EA et al. (2022)
c.397C>T p.Arg133Cys missense_variant De novo - Simplex 12707946 Zappella M , et al. (2003)
c.307C>T p.Arg103Trp missense_variant De novo - Simplex 30675382 Leblond CS , et al. (2019)
c.504C>G p.Asp168Glu missense_variant De novo - Simplex 39528574 Chengyan Li et al. (2024)
c.710C>G p.Pro237Arg missense_variant De novo - Simplex 39528574 Chengyan Li et al. (2024)
c.908C>G p.Ser303Cys missense_variant Unknown - - 40869941 Gabriela Repiská et al. (2025)
- - copy_number_gain Familial Maternal Simplex 38776926 Alistair T Pagnamenta et al. (2024)
- - copy_number_loss Familial Maternal Simplex 38776926 Alistair T Pagnamenta et al. (2024)
c.964C>T p.Pro322Ser missense_variant Familial Maternal - 16966553 Ventura P , et al. (2006)
c.724C>A p.Pro242Thr missense_variant Familial Maternal - 38177409 M Cecilia Poli et al. ()
c.65T>C p.(=) synonymous_variant Unknown Unknown Unknown 23055267 Cukier HN , et al. (2012)
c.604C>T p.Arg202Cys missense_variant De novo - Simplex 24776741 McCarthy SE , et al. (2014)
c.844C>T p.Arg282Ter stop_gained De novo - Simplex 37799141 Amerh S Alqahtani et al. (2023)
c.538C>T p.Arg180Ter stop_gained Unknown Not maternal Simplex 30564305 Guo H , et al. (2018)
c.1447G>T p.Glu483Ter stop_gained Familial Maternal Multiplex 23352163 Yu TW , et al. (2013)
c.1200_1243del p.Pro401Ter frameshift_variant Unknown - - 38438125 Tamam Khalaf et al. (2024)
c.916C>T p.Arg306Ter stop_gained De novo - Simplex 41751633 Gülsüm Kayhan et al. (2026)
c.1416_1417del p.Ile473CysfsTer25 frameshift_variant De novo - - 34800434 Chen S et al. (2021)
c.1136_1152del p.His379LeufsTer20 frameshift_variant De novo - - 35982159 Zhou X et al. (2022)
c.1483G>T p.Glu495Ter stop_gained Familial Maternal Multiplex 23352160 Lim ET , et al. (2013)
c.1030C>T p.Arg344Trp missense_variant Unknown Not maternal - 37822516 Yue Chai et al. (2023)
c.455C>T p.Ala152Val missense_variant Unknown - Simplex 37541188 Sanchis-Juan A et al. (2023)
c.925C>T p.Arg309Trp missense_variant De novo - - 26936630 Schnewolf-Greulich B , et al. (2016)
c.925C>T p.Gln309Ter missense_variant De novo - - 26936630 Schnewolf-Greulich B , et al. (2016)
c.656C>T p.(=) synonymous_variant Familial Paternal Multiplex 10508514 Amir RE , et al. (1999)
c.771_814del p.Met258ProfsTer70 frameshift_variant De novo - - 25914188 Olson HE , et al. (2015)
c.1080_1194delins60 p.Pro362fs frameshift_variant De novo - - 39213953 Liene Thys et al. (2024)
c.1376C>T p.Ala459Val missense_variant Unknown - Simplex 37541188 Sanchis-Juan A et al. (2023)
c.952C>T p.Arg318Cys missense_variant De novo - Simplex 39632905 Ashlesha Gogate et al. (2024)
c.433C>T p.Arg145Cys missense_variant Unknown - - 37943464 Karthika Ajit Valaparambil et al. ()
c.1162C>T p.Pro388Ser missense_variant Familial Maternal Simplex 28785396 Wen Z , et al. (2017)
c.842dup p.Arg282ProfsTer61 frameshift_variant De novo - Simplex 37543562 Sheth F et al. (2023)
c.23_27del p.Ala8GlufsTer32 frameshift_variant De novo - Simplex 37543562 Sheth F et al. (2023)
c.1416_1417del p.Ile473CysfsTer25 frameshift_variant De novo - - 31031587 Xiong J , et al. (2019)
c.1160C>T p.Pro387Leu missense_variant Familial Maternal - 39654053 Paola Granata et al. (2024)
c.842del p.Gly281AlafsTer20 frameshift_variant De novo - - 38374498 Purvi Majethia et al. (2024)
c.952C>T p.Arg318Cys missense_variant De novo - Simplex 41596607 Giancarlo Mancuso et al. (2026)
c.596C>G p.Pro199Arg missense_variant Familial Maternal Multiplex 23352163 Yu TW , et al. (2013)
c.1307C>T p.(=) synonymous_variant Unknown Not maternal Simplex 10508514 Amir RE , et al. (1999)
c.1193_1233del p.Leu398HisfsTer5 frameshift_variant De novo - - 12770674 Carney RM , et al. (2003)
c.1164_1198del p.Lys389ThrfsTer4 frameshift_variant De novo - - 35390071 Leite AJDC et al. (2022)
c.312A>G p.Gly104= synonymous_variant Unknown Unknown Unknown 23055267 Cukier HN , et al. (2012)
c.786C>T p.Arg262= synonymous_variant Unknown Unknown Unknown 23055267 Cukier HN , et al. (2012)
c.870C>T p.Ala290= synonymous_variant Unknown Unknown Unknown 23055267 Cukier HN , et al. (2012)
c.978C>T p.Ile326= synonymous_variant Unknown Unknown Unknown 23055267 Cukier HN , et al. (2012)
c.509C>T p.Thr170Met missense_variant Unknown - Simplex 37799141 Amerh S Alqahtani et al. (2023)
c.473C>T p.Thr158Met missense_variant De novo - Multi-generational 30945278 Jiao Q , et al. (2019)
c.1164_1207del p.Lys389Ter stop_gained Familial Maternal Simplex 28394482 Zhang Q , et al. (2017)
c.1227_1229del p.Glu409del stop_gained Familial Maternal Simplex 28394482 Zhang Q , et al. (2017)
c.1409G>A p.Arg470His missense_variant Familial Maternal Simplex 28394482 Zhang Q , et al. (2017)
c.432del p.Arg145AlafsTer6 frameshift_variant De novo - Simplex 10854091 De Bona C , et al. (2000)
c.1071A>G p.Lys357= synonymous_variant Unknown Unknown Unknown 23055267 Cukier HN , et al. (2012)
c.1371G>A p.Thr457= synonymous_variant Unknown Unknown Unknown 23055267 Cukier HN , et al. (2012)
c.1157_1197del p.Glu386AlafsTer5 frameshift_variant De novo - - 28554332 Bowling KM , et al. (2017)
c.524G>A p.Gly175Glu missense_variant De novo - Simplex 41751633 Gülsüm Kayhan et al. (2026)
c.397C>T p.Arg133Cys missense_variant Familial Maternal Multiplex 28394482 Zhang Q , et al. (2017)
c.441C>G p.Asp147Glu missense_variant Familial Maternal Multiplex 28394482 Zhang Q , et al. (2017)
c.1271T>C p.Val424Ala missense_variant Familial Maternal Simplex 41420732 Metin Eser et al. (2025)
c.1265dup p.Ser422ArgfsTer26 frameshift_variant De novo - Simplex 38764027 Ruohao Wu et al. (2024)
c.722dup p.Pro242AlafsTer6 frameshift_variant De novo - Multiplex 28263302 C Yuen RK et al. (2017)
c.1164_1207del p.Pro389Ter frameshift_variant De novo - Multiplex 28263302 C Yuen RK et al. (2017)
c.641C>G p.Ala214Gly missense_variant Familial Maternal Simplex 21624971 Schaaf CP , et al. (2011)
c.719C>G p.Thr240Ser missense_variant Familial Maternal Simplex 23055267 Cukier HN , et al. (2012)
c.806del p.Ala269ValfsTer32 frameshift_variant De novo - Simplex 10854091 De Bona C , et al. (2000)
c.763C>T p.Arg255Ter stop_gained Unknown - Simplex 40019509 Maria Cristina Aspromonte et al. (2025)
c.808C>T p.Arg270Ter stop_gained De novo - Simplex 40019509 Maria Cristina Aspromonte et al. (2025)
c.808C>T p.Arg270Ter stop_gained Unknown - Simplex 40019509 Maria Cristina Aspromonte et al. (2025)
c.281_284dup p.Arg96ThrfsTer8 frameshift_variant De novo - Simplex 38764027 Ruohao Wu et al. (2024)
c.419C>T p.Ala140Val missense_variant Familial Maternal Multiplex 25473036 Soden SE , et al. (2014)
c.1108G>A p.Ala370Thr missense_variant Familial Maternal Simplex 23055267 Cukier HN , et al. (2012)
c.1157del p.Glu386GlyfsTer35 frameshift_variant De novo - Simplex 10854091 De Bona C , et al. (2000)
c.1159del p.Ser387ProfsTer34 frameshift_variant De novo - Simplex 10854091 De Bona C , et al. (2000)
c.1152_1155del p.His384GlnfsTer36 frameshift_variant Unknown - - 39039281 Axel Schmidt et al. (2024)
c.499C>T p.Arg167Trp missense_variant Familial Maternal Multiplex 11309367 Couvert P , et al. (2001)
c.719C>G p.Thr240Ser missense_variant Familial Maternal Multiplex 23055267 Cukier HN , et al. (2012)
c.1200_1222del p.Pro401ArgfsTer8 frameshift_variant De novo - Simplex 23020937 Rauch A , et al. (2012)
c.316C>T p.Arg106Trp missense_variant Unknown Not maternal Multiplex 10508514 Amir RE , et al. (1999)
c.455C>T p.Ala152Val missense_variant Familial Maternal - 35322241 Brea-Fernández AJ et al. (2022)
c.1167_1200del p.Pro390AlafsTer8 frameshift_variant Unknown - Simplex 28263302 C Yuen RK et al. (2017)
c.1157_1185del p.Glu386AlafsTer9 frameshift_variant Unknown - Unknown 32631363 Amadori E et al. (2020)
c.792_795del p.Arg265SerfsTer35 frameshift_variant De novo - - 38321498 Marketa Wayhelova et al. (2024)
c.925C>T p.Gln309Ter missense_variant Familial Maternal - 26936630 Schnewolf-Greulich B , et al. (2016)
c.1208dup p.Glu404Ter stop_gained Familial Maternal - 40558542 Lyudmila Belenska-Todorova et al. (2025)
c.746del p.Gly249ValfsTer11 frameshift_variant Familial Maternal Simplex 30564305 Guo H , et al. (2018)
c.44_45insCGAGG p.Gly16GlufsTer30 frameshift_variant De novo - Simplex 41810194 Yuan Zheng et al. (2026)
c.1158_1198del p.Glu386AspfsTer5 frameshift_variant De novo - Simplex 10854091 De Bona C , et al. (2000)
c.569G>A p.Arg190His missense_variant Familial - Multi-generational 28397838 Harripaul R , et al. (2017)
c.499C>T p.Arg167Trp missense_variant Familial Maternal Multiplex 26490184 Bianciardi L , et al. (2015)
c.554G>T p.Gly185Val missense_variant Familial Maternal Multiplex 26490184 Bianciardi L , et al. (2015)
c.1309dup p.Glu437GlyfsTer11 frameshift_variant De novo - - 30417326 Schnewolf-Greulich B , et al. (2018)
c.1233dup p.Thr412HisfsTer5 frameshift_variant Unknown - - 37943464 Karthika Ajit Valaparambil et al. ()
c.316C>T p.Arg106Trp missense_variant Unknown - Simplex 40019509 Maria Cristina Aspromonte et al. (2025)
c.473C>T p.Thr158Met missense_variant Unknown - Simplex 40019509 Maria Cristina Aspromonte et al. (2025)
c.1216G>A p.Glu406Lys stop_gained Familial Maternal Multi-generational 10986043 Meloni I , et al. (2000)
c.1161_1400del p.Pro388_Glu467del inframe_deletion Familial Maternal - 11807877 Yntema HG , et al. (2002)
c.1158_1164del p.Ser387ArgfsTer32 frameshift_variant Unknown - Unknown 33526774 Mojarad BA et al. (2021)
c.148_152del p.Glu50ArgfsTer5 frameshift_variant Unknown - Simplex 37541188 Sanchis-Juan A et al. (2023)
c.1409G>A p.Arg470His missense_variant Familial Maternal Simplex 39632905 Ashlesha Gogate et al. (2024)
c.1225_1226del p.Ser409GlnfsTer26 frameshift_variant De novo - Simplex 39528574 Chengyan Li et al. (2024)
c.1174_1192del p.Val392CysfsTer23 frameshift_variant Unknown - - 41751633 Gülsüm Kayhan et al. (2026)
c.397C>T p.Arg133Cys missense_variant Familial Maternal Multi-generational 28394482 Zhang Q , et al. (2017)
c.916C>T p.Arg306Ter missense_variant Familial Maternal Multi-generational 28394482 Zhang Q , et al. (2017)
c.1193_1199del p.Leu398HisfsTer21 frameshift_variant Familial Maternal - 31452935 Feliciano P et al. (2019)
c.419C>T p.Ala140Val missense_variant Familial Maternal Multi-generational 11007980 Orrico A , et al. (2000)
c.1198_1239delinsTGAGGACTTGAG p.Pro400_Ser413delinsTer stop_gained De novo - - 34626536 Gardner EJ et al. (2021)
c.433C>T p.Arg145Cys missense_variant De novo - Simplex 25533962 Deciphering Developmental Disorders Study (2014)
c.1122del p.Lys375ArgfsTer46 frameshift_variant Familial Maternal Multiplex 37506195 Cirnigliaro M et al. (2023)
c.1231A>G p.Ser411Gly missense_variant Familial Maternal Unknown 40019509 Maria Cristina Aspromonte et al. (2025)
c.1197_1222delinsAGC p.Pro400AlafsTer9 frameshift_variant Unknown - - 37943464 Karthika Ajit Valaparambil et al. ()
c.1447G>T;c.1483G>T p.Glu483Ter;p.Glu495Ter stop_gained Familial Maternal Multiplex 28263302 C Yuen RK et al. (2017)
c.1165_1233del69ins21 p.Pro389_Pro411del23ins7 frameshift_variant De novo - Simplex 10854091 De Bona C , et al. (2000)
c.1138_1144del p.His380ThrfsTer39 frameshift_variant Familial Maternal Multiplex 30842647 Boonsawat P , et al. (2019)
c.954A>T p.Glu318Asp complex_structural_alteration Familial Maternal Multi-generational 25167861 Redin C , et al. (2014)
c.694insT Stop after 27 out of frame AA's frameshift_variant Unknown Not maternal Simplex 10508514 Amir RE , et al. (1999)
c.491G>T p.Ser164Ile missense_variant De novo (germline mosaicism) - Multiplex (dizygotic twins) 28230711 Curie A , et al. (2017)
c.763C>T(c.799C>T) p.Arg255Ter (p.Arg267Ter) stop_gained De novo - Simplex 25533962 Deciphering Developmental Disorders Study (2014)
GGGGGGCTGGTGGGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGT>G p.Pro398fsTer frameshift_variant Familial Maternal - 27799067 Loviglio MN , et al. (2016)
c.473C>T(c.509C>T) p.Thr158Met (p.Thr170Met) missense_variant De novo - Simplex 25533962 Deciphering Developmental Disorders Study (2014)
NM_004992.3:c.1097_1235delins50bp p.Arg354_Val412delins41 complex_structural_alteration Familial Maternal Multi-generational 25167861 Redin C , et al. (2014)
Common Variants  

No common variants reported.

SFARI Gene score
1S

High Confidence, Syndromic

Score Delta: Score remained at 1S

1

High Confidence

See all Category 1 Genes

We considered a rigorous statistical comparison between cases and controls, yielding genome-wide statistical significance, with independent replication, to be the strongest possible evidence for a gene. These criteria were relaxed slightly for category 2.

The syndromic category includes mutations that are associated with a substantial degree of increased risk and consistently linked to additional characteristics not required for an ASD diagnosis. If there is independent evidence implicating a gene in idiopathic ASD, it will be listed as "#S" (e.g., 2S, 3S, etc.). If there is no such independent evidence, the gene will be listed simply as "S."

4/1/2021
1
icon
1

Score remained at 1

Description

Mutations in MECP2 cause Rett syndrome (Amir et al., 1999), which has been recognized as an autism spectrum disorder (DSM-IV). MECP2 mutations were identified in four females and one male with a clinical diagnosis of Angelman syndrome (Watson et al., 2001). Brain samples from several related neurodevelopmental disorders, including autism, pervasive developmental disorder, Prader-Willi and Angelman syndromes showed significant differences in MECP2 expression from age-matched controls by apparently different transcriptional and post-transcriptional mechanisms (Samaco et al., 2004). Significant defects in UBE3A/E6AP and GABRB3 expression has been observed in MECP2 deficient mice and human Rett, Angelman and autism brains compared with controls (Samaco et al., 2005). A significant reduction in frontal cortex MECP2 expression compared to age-matched controls was found in autism (79%), RTT (100%), Angelman syndrome (100%), Prader-Willi syndrome (75%), Down syndrome (60%), and attention deficit hyperactivity disorder (100%) samples. As well, significantly increased MECP2 promoter methylation was seen in autistic male frontal cortex compared to controls (Nagarajan et al., 2006). Rare mutations and genetic association with MECP2 has been identified in autistic individuals (Loat et al., 2008), with de novo loss-of-function variants observed in four ASD probands (Carney et al., 2003; Wang et al., 2016). In addition, autism and other neuropsychiatric symptoms are prevalent in individuals with MECP2 duplication syndrome (Ramocki et al., 2009). Wen et al., 2017 identified two female ASD probands with de novo variants in the MECP2 gene (one nonsense variant and one missense variant that was experimentally shown to have a possible loss-of-function effect), as well as a maternally-inherited missense variant that was experimentally shown to affect dendritic and axonal growth in a male ASD proband.

1/1/2021
1
icon
1

Score remained at 1

Description

Mutations in MECP2 cause Rett syndrome (Amir et al., 1999), which has been recognized as an autism spectrum disorder (DSM-IV). MECP2 mutations were identified in four females and one male with a clinical diagnosis of Angelman syndrome (Watson et al., 2001). Brain samples from several related neurodevelopmental disorders, including autism, pervasive developmental disorder, Prader-Willi and Angelman syndromes showed significant differences in MECP2 expression from age-matched controls by apparently different transcriptional and post-transcriptional mechanisms (Samaco et al., 2004). Significant defects in UBE3A/E6AP and GABRB3 expression has been observed in MECP2 deficient mice and human Rett, Angelman and autism brains compared with controls (Samaco et al., 2005). A significant reduction in frontal cortex MECP2 expression compared to age-matched controls was found in autism (79%), RTT (100%), Angelman syndrome (100%), Prader-Willi syndrome (75%), Down syndrome (60%), and attention deficit hyperactivity disorder (100%) samples. As well, significantly increased MECP2 promoter methylation was seen in autistic male frontal cortex compared to controls (Nagarajan et al., 2006). Rare mutations and genetic association with MECP2 has been identified in autistic individuals (Loat et al., 2008), with de novo loss-of-function variants observed in four ASD probands (Carney et al., 2003; Wang et al., 2016). In addition, autism and other neuropsychiatric symptoms are prevalent in individuals with MECP2 duplication syndrome (Ramocki et al., 2009). Wen et al., 2017 identified two female ASD probands with de novo variants in the MECP2 gene (one nonsense variant and one missense variant that was experimentally shown to have a possible loss-of-function effect), as well as a maternally-inherited missense variant that was experimentally shown to affect dendritic and axonal growth in a male ASD proband.

7/1/2020
1
icon
1

Score remained at 1

Description

Mutations in MECP2 cause Rett syndrome (Amir et al., 1999), which has been recognized as an autism spectrum disorder (DSM-IV). MECP2 mutations were identified in four females and one male with a clinical diagnosis of Angelman syndrome (Watson et al., 2001). Brain samples from several related neurodevelopmental disorders, including autism, pervasive developmental disorder, Prader-Willi and Angelman syndromes showed significant differences in MECP2 expression from age-matched controls by apparently different transcriptional and post-transcriptional mechanisms (Samaco et al., 2004). Significant defects in UBE3A/E6AP and GABRB3 expression has been observed in MECP2 deficient mice and human Rett, Angelman and autism brains compared with controls (Samaco et al., 2005). A significant reduction in frontal cortex MECP2 expression compared to age-matched controls was found in autism (79%), RTT (100%), Angelman syndrome (100%), Prader-Willi syndrome (75%), Down syndrome (60%), and attention deficit hyperactivity disorder (100%) samples. As well, significantly increased MECP2 promoter methylation was seen in autistic male frontal cortex compared to controls (Nagarajan et al., 2006). Rare mutations and genetic association with MECP2 has been identified in autistic individuals (Loat et al., 2008), with de novo loss-of-function variants observed in four ASD probands (Carney et al., 2003; Wang et al., 2016). In addition, autism and other neuropsychiatric symptoms are prevalent in individuals with MECP2 duplication syndrome (Ramocki et al., 2009). Wen et al., 2017 identified two female ASD probands with de novo variants in the MECP2 gene (one nonsense variant and one missense variant that was experimentally shown to have a possible loss-of-function effect), as well as a maternally-inherited missense variant that was experimentally shown to affect dendritic and axonal growth in a male ASD proband.

4/1/2020
1
icon
1

Score remained at 1

Description

Mutations in MECP2 cause Rett syndrome (Amir et al., 1999), which has been recognized as an autism spectrum disorder (DSM-IV). MECP2 mutations were identified in four females and one male with a clinical diagnosis of Angelman syndrome (Watson et al., 2001). Brain samples from several related neurodevelopmental disorders, including autism, pervasive developmental disorder, Prader-Willi and Angelman syndromes showed significant differences in MECP2 expression from age-matched controls by apparently different transcriptional and post-transcriptional mechanisms (Samaco et al., 2004). Significant defects in UBE3A/E6AP and GABRB3 expression has been observed in MECP2 deficient mice and human Rett, Angelman and autism brains compared with controls (Samaco et al., 2005). A significant reduction in frontal cortex MECP2 expression compared to age-matched controls was found in autism (79%), RTT (100%), Angelman syndrome (100%), Prader-Willi syndrome (75%), Down syndrome (60%), and attention deficit hyperactivity disorder (100%) samples. As well, significantly increased MECP2 promoter methylation was seen in autistic male frontal cortex compared to controls (Nagarajan et al., 2006). Rare mutations and genetic association with MECP2 has been identified in autistic individuals (Loat et al., 2008), with de novo loss-of-function variants observed in four ASD probands (Carney et al., 2003; Wang et al., 2016). In addition, autism and other neuropsychiatric symptoms are prevalent in individuals with MECP2 duplication syndrome (Ramocki et al., 2009). Wen et al., 2017 identified two female ASD probands with de novo variants in the MECP2 gene (one nonsense variant and one missense variant that was experimentally shown to have a possible loss-of-function effect), as well as a maternally-inherited missense variant that was experimentally shown to affect dendritic and axonal growth in a male ASD proband.

1/1/2020
1
icon
1

Score remained at 1

Description

Mutations in MECP2 cause Rett syndrome (Amir et al., 1999), which has been recognized as an autism spectrum disorder (DSM-IV). MECP2 mutations were identified in four females and one male with a clinical diagnosis of Angelman syndrome (Watson et al., 2001). Brain samples from several related neurodevelopmental disorders, including autism, pervasive developmental disorder, Prader-Willi and Angelman syndromes showed significant differences in MECP2 expression from age-matched controls by apparently different transcriptional and post-transcriptional mechanisms (Samaco et al., 2004). Significant defects in UBE3A/E6AP and GABRB3 expression has been observed in MECP2 deficient mice and human Rett, Angelman and autism brains compared with controls (Samaco et al., 2005). A significant reduction in frontal cortex MECP2 expression compared to age-matched controls was found in autism (79%), RTT (100%), Angelman syndrome (100%), Prader-Willi syndrome (75%), Down syndrome (60%), and attention deficit hyperactivity disorder (100%) samples. As well, significantly increased MECP2 promoter methylation was seen in autistic male frontal cortex compared to controls (Nagarajan et al., 2006). Rare mutations and genetic association with MECP2 has been identified in autistic individuals (Loat et al., 2008), with de novo loss-of-function variants observed in four ASD probands (Carney et al., 2003; Wang et al., 2016). In addition, autism and other neuropsychiatric symptoms are prevalent in individuals with MECP2 duplication syndrome (Ramocki et al., 2009). Wen et al., 2017 identified two female ASD probands with de novo variants in the MECP2 gene (one nonsense variant and one missense variant that was experimentally shown to have a possible loss-of-function effect), as well as a maternally-inherited missense variant that was experimentally shown to affect dendritic and axonal growth in a male ASD proband.

10/1/2019
2S
icon
1

Decreased from 2S to 1

New Scoring Scheme
Description

Mutations in MECP2 cause Rett syndrome (Amir et al., 1999), which has been recognized as an autism spectrum disorder (DSM-IV). MECP2 mutations were identified in four females and one male with a clinical diagnosis of Angelman syndrome (Watson et al., 2001). Brain samples from several related neurodevelopmental disorders, including autism, pervasive developmental disorder, Prader-Willi and Angelman syndromes showed significant differences in MECP2 expression from age-matched controls by apparently different transcriptional and post-transcriptional mechanisms (Samaco et al., 2004). Significant defects in UBE3A/E6AP and GABRB3 expression has been observed in MECP2 deficient mice and human Rett, Angelman and autism brains compared with controls (Samaco et al., 2005). A significant reduction in frontal cortex MECP2 expression compared to age-matched controls was found in autism (79%), RTT (100%), Angelman syndrome (100%), Prader-Willi syndrome (75%), Down syndrome (60%), and attention deficit hyperactivity disorder (100%) samples. As well, significantly increased MECP2 promoter methylation was seen in autistic male frontal cortex compared to controls (Nagarajan et al., 2006). Rare mutations and genetic association with MECP2 has been identified in autistic individuals (Loat et al., 2008), with de novo loss-of-function variants observed in four ASD probands (Carney et al., 2003; Wang et al., 2016). In addition, autism and other neuropsychiatric symptoms are prevalent in individuals with MECP2 duplication syndrome (Ramocki et al., 2009). Wen et al., 2017 identified two female ASD probands with de novo variants in the MECP2 gene (one nonsense variant and one missense variant that was experimentally shown to have a possible loss-of-function effect), as well as a maternally-inherited missense variant that was experimentally shown to affect dendritic and axonal growth in a male ASD proband.

7/1/2019
2S
icon
2S

Decreased from 2S to 2S

Description

Mutations in MECP2 cause Rett syndrome (Amir et al., 1999), which has been recognized as an autism spectrum disorder (DSM-IV). MECP2 mutations were identified in four females and one male with a clinical diagnosis of Angelman syndrome (Watson et al., 2001). Brain samples from several related neurodevelopmental disorders, including autism, pervasive developmental disorder, Prader-Willi and Angelman syndromes showed significant differences in MECP2 expression from age-matched controls by apparently different transcriptional and post-transcriptional mechanisms (Samaco et al., 2004). Significant defects in UBE3A/E6AP and GABRB3 expression has been observed in MECP2 deficient mice and human Rett, Angelman and autism brains compared with controls (Samaco et al., 2005). A significant reduction in frontal cortex MECP2 expression compared to age-matched controls was found in autism (79%), RTT (100%), Angelman syndrome (100%), Prader-Willi syndrome (75%), Down syndrome (60%), and attention deficit hyperactivity disorder (100%) samples. As well, significantly increased MECP2 promoter methylation was seen in autistic male frontal cortex compared to controls (Nagarajan et al., 2006). Rare mutations and genetic association with MECP2 has been identified in autistic individuals (Loat et al., 2008), with de novo loss-of-function variants observed in four ASD probands (Carney et al., 2003; Wang et al., 2016). In addition, autism and other neuropsychiatric symptoms are prevalent in individuals with MECP2 duplication syndrome (Ramocki et al., 2009). Wen et al., 2017 identified two female ASD probands with de novo variants in the MECP2 gene (one nonsense variant and one missense variant that was experimentally shown to have a possible loss-of-function effect), as well as a maternally-inherited missense variant that was experimentally shown to affect dendritic and axonal growth in a male ASD proband.

4/1/2019
2S
icon
2S

Decreased from 2S to 2S

Description

Mutations in MECP2 cause Rett syndrome (Amir et al., 1999), which has been recognized as an autism spectrum disorder (DSM-IV). MECP2 mutations were identified in four females and one male with a clinical diagnosis of Angelman syndrome (Watson et al., 2001). Brain samples from several related neurodevelopmental disorders, including autism, pervasive developmental disorder, Prader-Willi and Angelman syndromes showed significant differences in MECP2 expression from age-matched controls by apparently different transcriptional and post-transcriptional mechanisms (Samaco et al., 2004). Significant defects in UBE3A/E6AP and GABRB3 expression has been observed in MECP2 deficient mice and human Rett, Angelman and autism brains compared with controls (Samaco et al., 2005). A significant reduction in frontal cortex MECP2 expression compared to age-matched controls was found in autism (79%), RTT (100%), Angelman syndrome (100%), Prader-Willi syndrome (75%), Down syndrome (60%), and attention deficit hyperactivity disorder (100%) samples. As well, significantly increased MECP2 promoter methylation was seen in autistic male frontal cortex compared to controls (Nagarajan et al., 2006). Rare mutations and genetic association with MECP2 has been identified in autistic individuals (Loat et al., 2008), with de novo loss-of-function variants observed in four ASD probands (Carney et al., 2003; Wang et al., 2016). In addition, autism and other neuropsychiatric symptoms are prevalent in individuals with MECP2 duplication syndrome (Ramocki et al., 2009). Wen et al., 2017 identified two female ASD probands with de novo variants in the MECP2 gene (one nonsense variant and one missense variant that was experimentally shown to have a possible loss-of-function effect), as well as a maternally-inherited missense variant that was experimentally shown to affect dendritic and axonal growth in a male ASD proband.

1/1/2019
2S
icon
2S

Decreased from 2S to 2S

Description

Mutations in MECP2 cause Rett syndrome (Amir et al., 1999), which has been recognized as an autism spectrum disorder (DSM-IV). MECP2 mutations were identified in four females and one male with a clinical diagnosis of Angelman syndrome (Watson et al., 2001). Brain samples from several related neurodevelopmental disorders, including autism, pervasive developmental disorder, Prader-Willi and Angelman syndromes showed significant differences in MECP2 expression from age-matched controls by apparently different transcriptional and post-transcriptional mechanisms (Samaco et al., 2004). Significant defects in UBE3A/E6AP and GABRB3 expression has been observed in MECP2 deficient mice and human Rett, Angelman and autism brains compared with controls (Samaco et al., 2005). A significant reduction in frontal cortex MECP2 expression compared to age-matched controls was found in autism (79%), RTT (100%), Angelman syndrome (100%), Prader-Willi syndrome (75%), Down syndrome (60%), and attention deficit hyperactivity disorder (100%) samples. As well, significantly increased MECP2 promoter methylation was seen in autistic male frontal cortex compared to controls (Nagarajan et al., 2006). Rare mutations and genetic association with MECP2 has been identified in autistic individuals (Loat et al., 2008), with de novo loss-of-function variants observed in four ASD probands (Carney et al., 2003; Wang et al., 2016). In addition, autism and other neuropsychiatric symptoms are prevalent in individuals with MECP2 duplication syndrome (Ramocki et al., 2009). Wen et al., 2017 identified two female ASD probands with de novo variants in the MECP2 gene (one nonsense variant and one missense variant that was experimentally shown to have a possible loss-of-function effect), as well as a maternally-inherited missense variant that was experimentally shown to affect dendritic and axonal growth in a male ASD proband.

10/1/2018
2S
icon
2S

Decreased from 2S to 2S

Description

Mutations in MECP2 cause Rett syndrome (Amir et al., 1999), which has been recognized as an autism spectrum disorder (DSM-IV). MECP2 mutations were identified in four females and one male with a clinical diagnosis of Angelman syndrome (Watson et al., 2001). Brain samples from several related neurodevelopmental disorders, including autism, pervasive developmental disorder, Prader-Willi and Angelman syndromes showed significant differences in MECP2 expression from age-matched controls by apparently different transcriptional and post-transcriptional mechanisms (Samaco et al., 2004). Significant defects in UBE3A/E6AP and GABRB3 expression has been observed in MECP2 deficient mice and human Rett, Angelman and autism brains compared with controls (Samaco et al., 2005). A significant reduction in frontal cortex MECP2 expression compared to age-matched controls was found in autism (79%), RTT (100%), Angelman syndrome (100%), Prader-Willi syndrome (75%), Down syndrome (60%), and attention deficit hyperactivity disorder (100%) samples. As well, significantly increased MECP2 promoter methylation was seen in autistic male frontal cortex compared to controls (Nagarajan et al., 2006). Rare mutations and genetic association with MECP2 has been identified in autistic individuals (Loat et al., 2008), with de novo loss-of-function variants observed in four ASD probands (Carney et al., 2003; Wang et al., 2016). In addition, autism and other neuropsychiatric symptoms are prevalent in individuals with MECP2 duplication syndrome (Ramocki et al., 2009). Wen et al., 2017 identified two female ASD probands with de novo variants in the MECP2 gene (one nonsense variant and one missense variant that was experimentally shown to have a possible loss-of-function effect), as well as a maternally-inherited missense variant that was experimentally shown to affect dendritic and axonal growth in a male ASD proband.

7/1/2018
2S
icon
2S

Decreased from 2S to 2S

Description

Mutations in MECP2 cause Rett syndrome (Amir et al., 1999), which has been recognized as an autism spectrum disorder (DSM-IV). MECP2 mutations were identified in four females and one male with a clinical diagnosis of Angelman syndrome (Watson et al., 2001). Brain samples from several related neurodevelopmental disorders, including autism, pervasive developmental disorder, Prader-Willi and Angelman syndromes showed significant differences in MECP2 expression from age-matched controls by apparently different transcriptional and post-transcriptional mechanisms (Samaco et al., 2004). Significant defects in UBE3A/E6AP and GABRB3 expression has been observed in MECP2 deficient mice and human Rett, Angelman and autism brains compared with controls (Samaco et al., 2005). A significant reduction in frontal cortex MECP2 expression compared to age-matched controls was found in autism (79%), RTT (100%), Angelman syndrome (100%), Prader-Willi syndrome (75%), Down syndrome (60%), and attention deficit hyperactivity disorder (100%) samples. As well, significantly increased MECP2 promoter methylation was seen in autistic male frontal cortex compared to controls (Nagarajan et al., 2006). Rare mutations and genetic association with MECP2 has been identified in autistic individuals (Loat et al., 2008), with de novo loss-of-function variants observed in four ASD probands (Carney et al., 2003; Wang et al., 2016). In addition, autism and other neuropsychiatric symptoms are prevalent in individuals with MECP2 duplication syndrome (Ramocki et al., 2009). Wen et al., 2017 identified two female ASD probands with de novo variants in the MECP2 gene (one nonsense variant and one missense variant that was experimentally shown to have a possible loss-of-function effect), as well as a maternally-inherited missense variant that was experimentally shown to affect dendritic and axonal growth in a male ASD proband.

10/1/2017
2S
icon
2S

Decreased from 2S to 2S

Description

Mutations in MECP2 cause Rett syndrome (Amir et al., 1999), which has been recognized as an autism spectrum disorder (DSM-IV). MECP2 mutations were identified in four females and one male with a clinical diagnosis of Angelman syndrome (Watson et al., 2001). Brain samples from several related neurodevelopmental disorders, including autism, pervasive developmental disorder, Prader-Willi and Angelman syndromes showed significant differences in MECP2 expression from age-matched controls by apparently different transcriptional and post-transcriptional mechanisms (Samaco et al., 2004). Significant defects in UBE3A/E6AP and GABRB3 expression has been observed in MECP2 deficient mice and human Rett, Angelman and autism brains compared with controls (Samaco et al., 2005). A significant reduction in frontal cortex MECP2 expression compared to age-matched controls was found in autism (79%), RTT (100%), Angelman syndrome (100%), Prader-Willi syndrome (75%), Down syndrome (60%), and attention deficit hyperactivity disorder (100%) samples. As well, significantly increased MECP2 promoter methylation was seen in autistic male frontal cortex compared to controls (Nagarajan et al., 2006). Rare mutations and genetic association with MECP2 has been identified in autistic individuals (Loat et al., 2008), with de novo loss-of-function variants observed in four ASD probands (Carney et al., 2003; Wang et al., 2016). In addition, autism and other neuropsychiatric symptoms are prevalent in individuals with MECP2 duplication syndrome (Ramocki et al., 2009). Wen et al., 2017 identified two female ASD probands with de novo variants in the MECP2 gene (one nonsense variant and one missense variant that was experimentally shown to have a possible loss-of-function effect), as well as a maternally-inherited missense variant that was experimentally shown to affect dendritic and axonal growth in a male ASD proband.

7/1/2017
2S
icon
2S

Decreased from 2S to 2S

Description

Mutations in MECP2 cause Rett syndrome (Amir et al., 1999), which has been recognized as an autism spectrum disorder (DSM-IV). MECP2 mutations were identified in four females and one male with a clinical diagnosis of Angelman syndrome (Watson et al., 2001). Brain samples from several related neurodevelopmental disorders, including autism, pervasive developmental disorder, Prader-Willi and Angelman syndromes showed significant differences in MECP2 expression from age-matched controls by apparently different transcriptional and post-transcriptional mechanisms (Samaco et al., 2004). Significant defects in UBE3A/E6AP and GABRB3 expression has been observed in MECP2 deficient mice and human Rett, Angelman and autism brains compared with controls (Samaco et al., 2005). A significant reduction in frontal cortex MECP2 expression compared to age-matched controls was found in autism (79%), RTT (100%), Angelman syndrome (100%), Prader-Willi syndrome (75%), Down syndrome (60%), and attention deficit hyperactivity disorder (100%) samples. As well, significantly increased MECP2 promoter methylation was seen in autistic male frontal cortex compared to controls (Nagarajan et al., 2006). Rare mutations and genetic association with MECP2 has been identified in autistic individuals (Loat et al., 2008), with de novo loss-of-function variants observed in four ASD probands (Carney et al., 2003; Wang et al., 2016). In addition, autism and other neuropsychiatric symptoms are prevalent in individuals with MECP2 duplication syndrome (Ramocki et al., 2009). Wen et al., 2017 identified two female ASD probands with de novo variants in the MECP2 gene (one nonsense variant and one missense variant that was experimentally shown to have a possible loss-of-function effect), as well as a maternally-inherited missense variant that was experimentally shown to affect dendritic and axonal growth in a male ASD proband.

4/1/2017
2S
icon
2S

Decreased from 2S to 2S

Description

Mutations in MECP2 cause Rett syndrome (Amir et al., 1999), which has been recognized as an autism spectrum disorder (DSM-IV). MECP2 mutations were identified in four females and one male with a clinical diagnosis of Angelman syndrome (Watson et al., 2001). Brain samples from several related neurodevelopmental disorders, including autism, pervasive developmental disorder, Prader-Willi and Angelman syndromes showed significant differences in MECP2 expression from age-matched controls by apparently different transcriptional and post-transcriptional mechanisms (Samaco et al., 2004). Significant defects in UBE3A/E6AP and GABRB3 expression has been observed in MECP2 deficient mice and human Rett, Angelman and autism brains compared with controls (Samaco et al., 2005). A significant reduction in frontal cortex MECP2 expression compared to age-matched controls was found in autism (79%), RTT (100%), Angelman syndrome (100%), Prader-Willi syndrome (75%), Down syndrome (60%), and attention deficit hyperactivity disorder (100%) samples. As well, significantly increased MECP2 promoter methylation was seen in autistic male frontal cortex compared to controls (Nagarajan et al., 2006). Rare mutations and genetic association with MECP2 has been identified in autistic individuals (Loat et al., 2008), with de novo loss-of-function variants observed in four ASD probands (Carney et al., 2003; Wang et al., 2016). In addition, autism and other neuropsychiatric symptoms are prevalent in individuals with MECP2 duplication syndrome (Ramocki et al., 2009).

Reports Added
[Identification of MeCP2 mutations in a series of females with autistic disorder.2003] [Oligogenic heterozygosity in individuals with high-functioning autism spectrum disorders.2011] [A partial MECP2 duplication in a mildly affected adult male: a putative role for the 3' untranslated region in the MECP2 duplication phenotype.2012] [The expanding role of MBD genes in autism: identification of a MECP2 duplication and novel alterations in MBD5, MBD6, and SETDB1.2012] [Using whole-exome sequencing to identify inherited causes of autism.2013] [Rare complete knockouts in humans: population distribution and significant role in autism spectrum disorders.2013] [Reciprocal co-regulation of EGR2 and MECP2 is disrupted in Rett syndrome and autism.2008] [Chromosome 2 deletion encompassing the MAP2 gene in a patient with autism and Rett-like features.2004] [MECP2 structural and 3'-UTR variants in schizophrenia, autism and other psychiatric diseases: a possible association with autism.2004] [A MECP2 missense mutation within the MBD domain in a Brazilian male with autistic disorder.2011] [Large-scale discovery of novel genetic causes of developmental disorders.2014] [Range of genetic mutations associated with severe non-syndromic sporadic intellectual disability: an exome sequencing study.2012] [Efficient strategy for the molecular diagnosis of intellectual disability using targeted high-throughput sequencing.2014] [A mutation in the rett syndrome gene, MECP2, causes X-linked mental retardation and progressive spasticity in males.2000] [MECP2 mutation in male patients with non-specific X-linked mental retardation.2000] [MECP2 is highly mutated in X-linked mental retardation.2001] [In-frame deletion in MECP2 causes mild nonspecific mental retardation.2002] [Neurodevelopmental disorders in males related to the gene causing Rett syndrome in females (MECP2).2003] [Submicroscopic duplication in Xq28 causes increased expression of the MECP2 gene in a boy with severe mental retardation and features of Rett syndr...2005] [A novel familial MECP2 mutation in a young boy: clinical and molecular findings.2006] [A MECP2 mutation in a highly conserved aminoacid causing mental retardation in a male.2008] [Rett syndrome is caused by mutations in X-linked MECP2, encoding methyl-CpG-binding protein 2.1999] [Preserved speech variant is allelic of classic Rett syndrome.2000] [No mutations in the coding region of the Rett syndrome gene MECP2 in 59 autistic patients.2001] [Study of MECP2 gene in Rett syndrome variants and autistic girls.2003] [De novo mutations in schizophrenia implicate chromatin remodeling and support a genetic overlap with autism and intellectual disability.2014] [MeCP2 is a transcriptional repressor with abundant binding sites in genomic chromatin.1997] [Transcriptional repression by the methyl-CpG-binding protein MeCP2 involves a histone deacetylase complex.1998] [Genetic modifiers of MeCP2 function in Drosophila.2008] [Deletion of Mecp2 in Sim1-expressing neurons reveals a critical role for MeCP2 in feeding behavior, aggression, and the response to stress.2008] [MECP2 genomic structure and function: insights from ENCODE.2008] [MeCP2 deficiency disrupts axonal guidance, fasciculation, and targeting by altering Semaphorin 3F function.2009] [Neuronal MeCP2 is expressed at near histone-octamer levels and globally alters the chromatin state.2010] [Dysfunction in GABA signalling mediates autism-like stereotypies and Rett syndrome phenotypes.2010] [L1 retrotransposition in neurons is modulated by MeCP2.2010] [Genome-wide activity-dependent MeCP2 phosphorylation regulates nervous system development and function.2011] [Overexpression of methyl-CpG binding protein 2 impairs T(H)1 responses.2012] [MeCP2 binds to 5hmC enriched within active genes and accessible chromatin in the nervous system.2012] [Bisphenol A delays the perinatal chloride shift in cortical neurons by epigenetic effects on the Kcc2 promoter.2013] [An AT-hook domain in MeCP2 determines the clinical course of Rett syndrome and related disorders.2013] [Rett syndrome mutations abolish the interaction of MeCP2 with the NCoR/SMRT co-repressor.2013] [Activity-dependent phosphorylation of MeCP2 threonine 308 regulates interaction with NCoR.2013] [Transcriptional regulation of the MET receptor tyrosine kinase gene by MeCP2 and sex-specific expression in autism and Rett syndrome.2013] [Oligodendrocyte lineage cells contribute unique features to Rett syndrome neuropathology.2013] [Increased binding of MeCP2 to the GAD1 and RELN promoters may be mediated by an enrichment of 5-hmC in autism spectrum disorder (ASD) cerebellum.2014] [GluD1 is a common altered player in neuronal differentiation from both MECP2-mutated and CDKL5-mutated iPS cells.2014] [Next-generation sequencing using a pre-designed gene panel for the molecular diagnosis of congenital disorders in pediatric patients.2015] [Comprehensive molecular testing in patients with high functioning autism spectrum disorder.2016] [Mutations in epilepsy and intellectual disability genes in patients with features of Rett syndrome.2015] [MECP2 missense mutations outside the canonical MBD and TRD domains in males with intellectual disability.2015] [The MECP2 variant c.925C>T (p.Arg309Trp) causes intellectual disability in both males and females without classic features of Rett syndrome.2016] [Effectiveness of exome and genome sequencing guided by acuity of illness for diagnosis of neurodevelopmental disorders.2014] [Identification of Intellectual Disability Genes in Female Patients with A Skewed X Inactivation Pattern.2016] [Identification of a RAI1-associated disease network through integration of exome sequencing, transcriptomics, and 3D genomics.2016] [De novo genic mutations among a Chinese autism spectrum disorder cohort.2016] [Clinical exome sequencing: results from 2819 samples reflecting 1000 families.2016] [Diagnostic Targeted Resequencing in 349 Patients with Drug-Resistant Pediatric Epilepsies Identifies Causative Mutations in 30 Different Genes.2016] [Asperger syndrome and early-onset schizophrenia associated with a novel MECP2 deleterious missense variant.2017] [Whole genome sequencing resource identifies 18 new candidate genes for autism spectrum disorder2017] [A clinical utility study of exome sequencing versus conventional genetic testing in pediatric neurology.2017] [Mapping autosomal recessive intellectual disability: combined microarray and exome sequencing identifies 26 novel candidate genes in 192 consanguin...2017] [Familial cases and male cases with MECP2 mutations.2017] [Genomic diagnosis for children with intellectual disability and/or developmental delay.2017]
1/1/2017
2S
icon
2S

Decreased from 2S to 2S

Description

Mutations in MECP2 cause Rett syndrome (Amir et al., 1999), which has been recognized as an autism spectrum disorder (DSM-IV). MECP2 mutations were identified in four females and one male with a clinical diagnosis of Angelman syndrome (Watson et al., 2001). Brain samples from several related neurodevelopmental disorders, including autism, pervasive developmental disorder, Prader-Willi and Angelman syndromes showed significant differences in MECP2 expression from age-matched controls by apparently different transcriptional and post-transcriptional mechanisms (Samaco et al., 2004). Significant defects in UBE3A/E6AP and GABRB3 expression has been observed in MECP2 deficient mice and human Rett, Angelman and autism brains compared with controls (Samaco et al., 2005). A significant reduction in frontal cortex MECP2 expression compared to age-matched controls was found in autism (79%), RTT (100%), Angelman syndrome (100%), Prader-Willi syndrome (75%), Down syndrome (60%), and attention deficit hyperactivity disorder (100%) samples. As well, significantly increased MECP2 promoter methylation was seen in autistic male frontal cortex compared to controls (Nagarajan et al., 2006). Rare mutations and genetic association with MECP2 has been identified in autistic individuals (Loat et al., 2008), with de novo loss-of-function variants observed in four ASD probands (Carney et al., 2003; Wang et al., 2016). In addition, autism and other neuropsychiatric symptoms are prevalent in individuals with MECP2 duplication syndrome (Ramocki et al., 2009).

10/1/2016
S
icon
2S

Increased from S to 2S

Description

Mutations in MECP2 cause Rett syndrome (Amir et al., 1999), which has been recognized as an autism spectrum disorder (DSM-IV). MECP2 mutations were identified in four females and one male with a clinical diagnosis of Angelman syndrome (Watson et al., 2001). Brain samples from several related neurodevelopmental disorders, including autism, pervasive developmental disorder, Prader-Willi and Angelman syndromes showed significant differences in MECP2 expression from age-matched controls by apparently different transcriptional and post-transcriptional mechanisms (Samaco et al., 2004). Significant defects in UBE3A/E6AP and GABRB3 expression has been observed in MECP2 deficient mice and human Rett, Angelman and autism brains compared with controls (Samaco et al., 2005). A significant reduction in frontal cortex MECP2 expression compared to age-matched controls was found in autism (79%), RTT (100%), Angelman syndrome (100%), Prader-Willi syndrome (75%), Down syndrome (60%), and attention deficit hyperactivity disorder (100%) samples. As well, significantly increased MECP2 promoter methylation was seen in autistic male frontal cortex compared to controls (Nagarajan et al., 2006). Rare mutations and genetic association with MECP2 has been identified in autistic individuals (Loat et al., 2008), with de novo loss-of-function variants observed in four ASD probands (Carney et al., 2003; Wang et al., 2016). In addition, autism and other neuropsychiatric symptoms are prevalent in individuals with MECP2 duplication syndrome (Ramocki et al., 2009).

4/1/2016
S
icon
S

Increased from S to S

Description

Mutations in MECP2 cause Rett syndrome (Amir et al., 1999), which has been recognized as an autism spectrum disorder (DSM-IV). MECP2 mutations were identified in four females and one male with a clinical diagnosis of Angelman syndrome (Watson et al., 2001). Brain samples from several related neurodevelopmental disorders, including autism, pervasive developmental disorder, Prader-Willi and Angelman syndromes showed significant differences in MECP2 expression from age-matched controls by apparently different transcriptional and post-transcriptional mechanisms (Samaco et al., 2004). Significant defects in UBE3A/E6AP and GABRB3 expression has been observed in MECP2 deficient mice and human Rett, Angelman and autism brains compared with controls (Samaco et al., 2005). A significant reduction in frontal cortex MECP2 expression compared to age-matched controls was found in autism (79%), RTT (100%), Angelman syndrome (100%), Prader-Willi syndrome (75%), Down syndrome (60%), and attention deficit hyperactivity disorder (100%) samples. As well, significantly increased MECP2 promoter methylation was seen in autistic male frontal cortex compared to controls (Nagarajan et al., 2006). Rare mutations and genetic association with MECP2 has been identified in autistic individuals (Loat et al., 2008). In addition, autism and other neuropsychiatric symptoms are prevalent in individuals with MECP2 duplication syndrome (Ramocki et al., 2009).

Reports Added
[Identification of MeCP2 mutations in a series of females with autistic disorder.2003] [Oligogenic heterozygosity in individuals with high-functioning autism spectrum disorders.2011] [A partial MECP2 duplication in a mildly affected adult male: a putative role for the 3' untranslated region in the MECP2 duplication phenotype.2012] [The expanding role of MBD genes in autism: identification of a MECP2 duplication and novel alterations in MBD5, MBD6, and SETDB1.2012] [Using whole-exome sequencing to identify inherited causes of autism.2013] [Rare complete knockouts in humans: population distribution and significant role in autism spectrum disorders.2013] [Reciprocal co-regulation of EGR2 and MECP2 is disrupted in Rett syndrome and autism.2008] [Chromosome 2 deletion encompassing the MAP2 gene in a patient with autism and Rett-like features.2004] [MECP2 structural and 3'-UTR variants in schizophrenia, autism and other psychiatric diseases: a possible association with autism.2004] [A MECP2 missense mutation within the MBD domain in a Brazilian male with autistic disorder.2011] [Large-scale discovery of novel genetic causes of developmental disorders.2014] [Range of genetic mutations associated with severe non-syndromic sporadic intellectual disability: an exome sequencing study.2012] [Efficient strategy for the molecular diagnosis of intellectual disability using targeted high-throughput sequencing.2014] [A mutation in the rett syndrome gene, MECP2, causes X-linked mental retardation and progressive spasticity in males.2000] [MECP2 mutation in male patients with non-specific X-linked mental retardation.2000] [MECP2 is highly mutated in X-linked mental retardation.2001] [In-frame deletion in MECP2 causes mild nonspecific mental retardation.2002] [Neurodevelopmental disorders in males related to the gene causing Rett syndrome in females (MECP2).2003] [Submicroscopic duplication in Xq28 causes increased expression of the MECP2 gene in a boy with severe mental retardation and features of Rett syndr...2005] [A novel familial MECP2 mutation in a young boy: clinical and molecular findings.2006] [A MECP2 mutation in a highly conserved aminoacid causing mental retardation in a male.2008] [Rett syndrome is caused by mutations in X-linked MECP2, encoding methyl-CpG-binding protein 2.1999] [Preserved speech variant is allelic of classic Rett syndrome.2000] [No mutations in the coding region of the Rett syndrome gene MECP2 in 59 autistic patients.2001] [Study of MECP2 gene in Rett syndrome variants and autistic girls.2003] [De novo mutations in schizophrenia implicate chromatin remodeling and support a genetic overlap with autism and intellectual disability.2014] [MeCP2 is a transcriptional repressor with abundant binding sites in genomic chromatin.1997] [Transcriptional repression by the methyl-CpG-binding protein MeCP2 involves a histone deacetylase complex.1998] [Genetic modifiers of MeCP2 function in Drosophila.2008] [Deletion of Mecp2 in Sim1-expressing neurons reveals a critical role for MeCP2 in feeding behavior, aggression, and the response to stress.2008] [MECP2 genomic structure and function: insights from ENCODE.2008] [MeCP2 deficiency disrupts axonal guidance, fasciculation, and targeting by altering Semaphorin 3F function.2009] [Neuronal MeCP2 is expressed at near histone-octamer levels and globally alters the chromatin state.2010] [Dysfunction in GABA signalling mediates autism-like stereotypies and Rett syndrome phenotypes.2010] [L1 retrotransposition in neurons is modulated by MeCP2.2010] [Genome-wide activity-dependent MeCP2 phosphorylation regulates nervous system development and function.2011] [Overexpression of methyl-CpG binding protein 2 impairs T(H)1 responses.2012] [MeCP2 binds to 5hmC enriched within active genes and accessible chromatin in the nervous system.2012] [Bisphenol A delays the perinatal chloride shift in cortical neurons by epigenetic effects on the Kcc2 promoter.2013] [An AT-hook domain in MeCP2 determines the clinical course of Rett syndrome and related disorders.2013] [Rett syndrome mutations abolish the interaction of MeCP2 with the NCoR/SMRT co-repressor.2013] [Activity-dependent phosphorylation of MeCP2 threonine 308 regulates interaction with NCoR.2013] [Transcriptional regulation of the MET receptor tyrosine kinase gene by MeCP2 and sex-specific expression in autism and Rett syndrome.2013] [Oligodendrocyte lineage cells contribute unique features to Rett syndrome neuropathology.2013] [Increased binding of MeCP2 to the GAD1 and RELN promoters may be mediated by an enrichment of 5-hmC in autism spectrum disorder (ASD) cerebellum.2014] [GluD1 is a common altered player in neuronal differentiation from both MECP2-mutated and CDKL5-mutated iPS cells.2014] [Next-generation sequencing using a pre-designed gene panel for the molecular diagnosis of congenital disorders in pediatric patients.2015] [Comprehensive molecular testing in patients with high functioning autism spectrum disorder.2016] [Mutations in epilepsy and intellectual disability genes in patients with features of Rett syndrome.2015] [MECP2 missense mutations outside the canonical MBD and TRD domains in males with intellectual disability.2015] [The MECP2 variant c.925C>T (p.Arg309Trp) causes intellectual disability in both males and females without classic features of Rett syndrome.2016] [Effectiveness of exome and genome sequencing guided by acuity of illness for diagnosis of neurodevelopmental disorders.2014] [Identification of Intellectual Disability Genes in Female Patients with A Skewed X Inactivation Pattern.2016]
1/1/2016
S
icon
S

Increased from S to S

Description

Mutations in MECP2 cause Rett syndrome (Amir et al., 1999), which has been recognized as an autism spectrum disorder (DSM-IV). MECP2 mutations were identified in four females and one male with a clinical diagnosis of Angelman syndrome (Watson et al., 2001). Brain samples from several related neurodevelopmental disorders, including autism, pervasive developmental disorder, Prader-Willi and Angelman syndromes showed significant differences in MECP2 expression from age-matched controls by apparently different transcriptional and post-transcriptional mechanisms (Samaco et al., 2004). Significant defects in UBE3A/E6AP and GABRB3 expression has been observed in MECP2 deficient mice and human Rett, Angelman and autism brains compared with controls (Samaco et al., 2005). A significant reduction in frontal cortex MECP2 expression compared to age-matched controls was found in autism (79%), RTT (100%), Angelman syndrome (100%), Prader-Willi syndrome (75%), Down syndrome (60%), and attention deficit hyperactivity disorder (100%) samples. As well, significantly increased MECP2 promoter methylation was seen in autistic male frontal cortex compared to controls (Nagarajan et al., 2006). Rare mutations and genetic association with MECP2 has been identified in autistic individuals (Loat et al., 2008). In addition, autism and other neuropsychiatric symptoms are prevalent in individuals with MECP2 duplication syndrome (Ramocki et al., 2009).

Reports Added
[Identification of MeCP2 mutations in a series of females with autistic disorder.2003] [Oligogenic heterozygosity in individuals with high-functioning autism spectrum disorders.2011] [A partial MECP2 duplication in a mildly affected adult male: a putative role for the 3' untranslated region in the MECP2 duplication phenotype.2012] [The expanding role of MBD genes in autism: identification of a MECP2 duplication and novel alterations in MBD5, MBD6, and SETDB1.2012] [Using whole-exome sequencing to identify inherited causes of autism.2013] [Rare complete knockouts in humans: population distribution and significant role in autism spectrum disorders.2013] [Reciprocal co-regulation of EGR2 and MECP2 is disrupted in Rett syndrome and autism.2008] [Chromosome 2 deletion encompassing the MAP2 gene in a patient with autism and Rett-like features.2004] [MECP2 structural and 3'-UTR variants in schizophrenia, autism and other psychiatric diseases: a possible association with autism.2004] [A MECP2 missense mutation within the MBD domain in a Brazilian male with autistic disorder.2011] [Large-scale discovery of novel genetic causes of developmental disorders.2014] [Range of genetic mutations associated with severe non-syndromic sporadic intellectual disability: an exome sequencing study.2012] [Efficient strategy for the molecular diagnosis of intellectual disability using targeted high-throughput sequencing.2014] [A mutation in the rett syndrome gene, MECP2, causes X-linked mental retardation and progressive spasticity in males.2000] [MECP2 mutation in male patients with non-specific X-linked mental retardation.2000] [MECP2 is highly mutated in X-linked mental retardation.2001] [In-frame deletion in MECP2 causes mild nonspecific mental retardation.2002] [Neurodevelopmental disorders in males related to the gene causing Rett syndrome in females (MECP2).2003] [Submicroscopic duplication in Xq28 causes increased expression of the MECP2 gene in a boy with severe mental retardation and features of Rett syndr...2005] [A novel familial MECP2 mutation in a young boy: clinical and molecular findings.2006] [A MECP2 mutation in a highly conserved aminoacid causing mental retardation in a male.2008] [Rett syndrome is caused by mutations in X-linked MECP2, encoding methyl-CpG-binding protein 2.1999] [Preserved speech variant is allelic of classic Rett syndrome.2000] [No mutations in the coding region of the Rett syndrome gene MECP2 in 59 autistic patients.2001] [Study of MECP2 gene in Rett syndrome variants and autistic girls.2003] [De novo mutations in schizophrenia implicate chromatin remodeling and support a genetic overlap with autism and intellectual disability.2014] [MeCP2 is a transcriptional repressor with abundant binding sites in genomic chromatin.1997] [Transcriptional repression by the methyl-CpG-binding protein MeCP2 involves a histone deacetylase complex.1998] [Genetic modifiers of MeCP2 function in Drosophila.2008] [Deletion of Mecp2 in Sim1-expressing neurons reveals a critical role for MeCP2 in feeding behavior, aggression, and the response to stress.2008] [MECP2 genomic structure and function: insights from ENCODE.2008] [MeCP2 deficiency disrupts axonal guidance, fasciculation, and targeting by altering Semaphorin 3F function.2009] [Neuronal MeCP2 is expressed at near histone-octamer levels and globally alters the chromatin state.2010] [Dysfunction in GABA signalling mediates autism-like stereotypies and Rett syndrome phenotypes.2010] [L1 retrotransposition in neurons is modulated by MeCP2.2010] [Genome-wide activity-dependent MeCP2 phosphorylation regulates nervous system development and function.2011] [Overexpression of methyl-CpG binding protein 2 impairs T(H)1 responses.2012] [MeCP2 binds to 5hmC enriched within active genes and accessible chromatin in the nervous system.2012] [Bisphenol A delays the perinatal chloride shift in cortical neurons by epigenetic effects on the Kcc2 promoter.2013] [An AT-hook domain in MeCP2 determines the clinical course of Rett syndrome and related disorders.2013] [Rett syndrome mutations abolish the interaction of MeCP2 with the NCoR/SMRT co-repressor.2013] [Activity-dependent phosphorylation of MeCP2 threonine 308 regulates interaction with NCoR.2013] [Transcriptional regulation of the MET receptor tyrosine kinase gene by MeCP2 and sex-specific expression in autism and Rett syndrome.2013] [Oligodendrocyte lineage cells contribute unique features to Rett syndrome neuropathology.2013] [Increased binding of MeCP2 to the GAD1 and RELN promoters may be mediated by an enrichment of 5-hmC in autism spectrum disorder (ASD) cerebellum.2014] [GluD1 is a common altered player in neuronal differentiation from both MECP2-mutated and CDKL5-mutated iPS cells.2014] [Next-generation sequencing using a pre-designed gene panel for the molecular diagnosis of congenital disorders in pediatric patients.2015] [Comprehensive molecular testing in patients with high functioning autism spectrum disorder.2016] [Mutations in epilepsy and intellectual disability genes in patients with features of Rett syndrome.2015] [MECP2 missense mutations outside the canonical MBD and TRD domains in males with intellectual disability.2015]
1/1/2015
S
icon
S

Increased from S to S

Description

Mutations in MECP2 cause Rett syndrome (Amir et al., 1999), which has been recognized as an autism spectrum disorder (DSM-IV). MECP2 mutations were identified in four females and one male with a clinical diagnosis of Angelman syndrome (Watson et al., 2001). Brain samples from several related neurodevelopmental disorders, including autism, pervasive developmental disorder, Prader-Willi and Angelman syndromes showed significant differences in MECP2 expression from age-matched controls by apparently different transcriptional and post-transcriptional mechanisms (Samaco et al., 2004). Significant defects in UBE3A/E6AP and GABRB3 expression has been observed in MECP2 deficient mice and human Rett, Angelman and autism brains compared with controls (Samaco et al., 2005). A significant reduction in frontal cortex MECP2 expression compared to age-matched controls was found in autism (79%), RTT (100%), Angelman syndrome (100%), Prader-Willi syndrome (75%), Down syndrome (60%), and attention deficit hyperactivity disorder (100%) samples. As well, significantly increased MECP2 promoter methylation was seen in autistic male frontal cortex compared to controls (Nagarajan et al., 2006). Rare mutations and genetic association with MECP2 has been identified in autistic individuals (Loat et al., 2008). In addition, autism and other neuropsychiatric symptoms are prevalent in individuals with MECP2 duplication syndrome (Ramocki et al., 2009).

7/1/2014
No data
icon
S

Increased from No data to S

Description

Mutations in MECP2 cause Rett syndrome (Amir et al., 1999), which has been recognized as an autism spectrum disorder (DSM-IV). MECP2 mutations were identified in four females and one male with a clinical diagnosis of Angelman syndrome (Watson et al., 2001). Brain samples from several related neurodevelopmental disorders, including autism, pervasive developmental disorder, Prader-Willi and Angelman syndromes showed significant differences in MECP2 expression from age-matched controls by apparently different transcriptional and post-transcriptional mechanisms (Samaco et al., 2004). Significant defects in UBE3A/E6AP and GABRB3 expression has been observed in MECP2 deficient mice and human Rett, Angelman and autism brains compared with controls (Samaco et al., 2005). A significant reduction in frontal cortex MECP2 expression compared to age-matched controls was found in autism (79%), RTT (100%), Angelman syndrome (100%), Prader-Willi syndrome (75%), Down syndrome (60%), and attention deficit hyperactivity disorder (100%) samples. As well, significantly increased MECP2 promoter methylation was seen in autistic male frontal cortex compared to controls (Nagarajan et al., 2006). Rare mutations and genetic association with MECP2 has been identified in autistic individuals (Loat et al., 2008). In addition, autism and other neuropsychiatric symptoms are prevalent in individuals with MECP2 duplication syndrome (Ramocki et al., 2009).

Reports Added
[MeCP2 is a transcriptional repressor with abundant binding sites in genomic chromatin.1997] [Transcriptional repression by the methyl-CpG-binding protein MeCP2 involves a histone deacetylase complex.1998] [Rett syndrome is caused by mutations in X-linked MECP2, encoding methyl-CpG-binding protein 2.1999] [A mutation in the rett syndrome gene, MECP2, causes X-linked mental retardation and progressive spasticity in males.2000] [MECP2 mutation in male patients with non-specific X-linked mental retardation.2000] [MECP2 is highly mutated in X-linked mental retardation.2001] [No mutations in the coding region of the Rett syndrome gene MECP2 in 59 autistic patients.2001] [In-frame deletion in MECP2 causes mild nonspecific mental retardation.2002] [Neurodevelopmental disorders in males related to the gene causing Rett syndrome in females (MECP2).2003] [Identification of MeCP2 mutations in a series of females with autistic disorder.2003] [Chromosome 2 deletion encompassing the MAP2 gene in a patient with autism and Rett-like features.2004] [MECP2 structural and 3'-UTR variants in schizophrenia, autism and other psychiatric diseases: a possible association with autism.2004] [Submicroscopic duplication in Xq28 causes increased expression of the MECP2 gene in a boy with severe mental retardation and features of Rett syndr...2005] [A novel familial MECP2 mutation in a young boy: clinical and molecular findings.2006] [A MECP2 mutation in a highly conserved aminoacid causing mental retardation in a male.2008] [Genetic modifiers of MeCP2 function in Drosophila.2008] [Deletion of Mecp2 in Sim1-expressing neurons reveals a critical role for MeCP2 in feeding behavior, aggression, and the response to stress.2008] [MECP2 genomic structure and function: insights from ENCODE.2008] [Reciprocal co-regulation of EGR2 and MECP2 is disrupted in Rett syndrome and autism.2008] [MeCP2 deficiency disrupts axonal guidance, fasciculation, and targeting by altering Semaphorin 3F function.2009] [Neuronal MeCP2 is expressed at near histone-octamer levels and globally alters the chromatin state.2010] [Dysfunction in GABA signalling mediates autism-like stereotypies and Rett syndrome phenotypes.2010] [L1 retrotransposition in neurons is modulated by MeCP2.2010] [A MECP2 missense mutation within the MBD domain in a Brazilian male with autistic disorder.2011] [Oligogenic heterozygosity in individuals with high-functioning autism spectrum disorders.2011] [Genome-wide activity-dependent MeCP2 phosphorylation regulates nervous system development and function.2011] [A partial MECP2 duplication in a mildly affected adult male: a putative role for the 3' untranslated region in the MECP2 duplication phenotype.2012] [Range of genetic mutations associated with severe non-syndromic sporadic intellectual disability: an exome sequencing study.2012] [The expanding role of MBD genes in autism: identification of a MECP2 duplication and novel alterations in MBD5, MBD6, and SETDB1.2012] [Overexpression of methyl-CpG binding protein 2 impairs T(H)1 responses.2012] [MeCP2 binds to 5hmC enriched within active genes and accessible chromatin in the nervous system.2012] [Using whole-exome sequencing to identify inherited causes of autism.2013] [Bisphenol A delays the perinatal chloride shift in cortical neurons by epigenetic effects on the Kcc2 promoter.2013] [An AT-hook domain in MeCP2 determines the clinical course of Rett syndrome and related disorders.2013] [Rett syndrome mutations abolish the interaction of MeCP2 with the NCoR/SMRT co-repressor.2013] [Activity-dependent phosphorylation of MeCP2 threonine 308 regulates interaction with NCoR.2013] [Transcriptional regulation of the MET receptor tyrosine kinase gene by MeCP2 and sex-specific expression in autism and Rett syndrome.2013] [Oligodendrocyte lineage cells contribute unique features to Rett syndrome neuropathology.2013] [Increased binding of MeCP2 to the GAD1 and RELN promoters may be mediated by an enrichment of 5-hmC in autism spectrum disorder (ASD) cerebellum.2014] [De novo mutations in schizophrenia implicate chromatin remodeling and support a genetic overlap with autism and intellectual disability.2014] [GluD1 is a common altered player in neuronal differentiation from both MECP2-mutated and CDKL5-mutated iPS cells.2014] [Preserved speech variant is allelic of classic Rett syndrome.2000] [Study of MECP2 gene in Rett syndrome variants and autistic girls.2003]
4/1/2014
No data
icon
S

Increased from No data to S

Description

Mutations in MECP2 cause Rett syndrome (Amir et al., 1999), which has been recognized as an autism spectrum disorder (DSM-IV). MECP2 mutations were identified in four females and one male with a clinical diagnosis of Angelman syndrome (Watson et al., 2001). Brain samples from several related neurodevelopmental disorders, including autism, pervasive developmental disorder, Prader-Willi and Angelman syndromes showed significant differences in MECP2 expression from age-matched controls by apparently different transcriptional and post-transcriptional mechanisms (Samaco et al., 2004). Significant defects in UBE3A/E6AP and GABRB3 expression has been observed in MECP2 deficient mice and human Rett, Angelman and autism brains compared with controls (Samaco et al., 2005). A significant reduction in frontal cortex MECP2 expression compared to age-matched controls was found in autism (79%), RTT (100%), Angelman syndrome (100%), Prader-Willi syndrome (75%), Down syndrome (60%), and attention deficit hyperactivity disorder (100%) samples. As well, significantly increased MECP2 promoter methylation was seen in autistic male frontal cortex compared to controls (Nagarajan et al., 2006). Rare mutations and genetic association with MECP2 has been identified in autistic individuals (Loat et al., 2008). In addition, autism and other neuropsychiatric symptoms are prevalent in individuals with MECP2 duplication syndrome (Ramocki et al., 2009).

Krishnan Probability Score

Score 0.6106260748291

Ranking 217/25841 scored genes


[Show Scoring Methodology]
Krishnan and colleagues generated probability scores genome-wide by using a machine learning approach on a human brain-specific gene network. The method was first presented in Nat Neurosci 19, 1454-1462 (2016), and scores for more than 25,000 RefSeq genes can be accessed in column G of supplementary table 3 (see: http://www.nature.com/neuro/journal/v19/n11/extref/nn.4353-S5.xlsx). A searchable browser, with the ability to view networks of associated ASD risk genes, can be found at asd.princeton.edu.
ExAC Score

Score 0.69808904772491

Ranking 4487/18225 scored genes


[Show Scoring Methodology]
The Exome Aggregation Consortium (ExAC) is a summary database of 60,706 exomes that has been widely used to estimate 'constraint' on mutation for individual genes. It was introduced by Lek et al. Nature 536, 285-291 (2016), and the ExAC browser can be found at exac.broadinstitute.org. The pLI score was developed as measure of intolerance to loss-of- function mutation. A pLI > 0.9 is generally viewed as highly constrained, and thus any loss-of- function mutations in autism in such a gene would be more likely to confer risk. For a full list of pLI scores see: ftp://ftp.broadinstitute.org/pub/ExAC_release/release0.3.1/functional_gene_constraint/fordist_cle aned_exac_nonTCGA_z_pli_rec_null_data.txt
Sanders TADA Score

Score 0.93461063590805

Ranking 12621/18665 scored genes


[Show Scoring Methodology]
The TADA score ('Transmission and De novo Association') was introduced by He et al. PLoS Genet 9(8):e1003671 (2013), and is a statistic that integrates evidence from both de novo and transmitted mutations. It forms the basis for the claim of 65 individual genes being strongly associated with autism risk at a false discovery rate of 0.1 (Sanders et al. Neuron 87, 1215-1233 (2015)). The calculated TADA score for 18,665 RefSeq genes can be found in column P of Supplementary Table 6 in the Sanders et al. paper (the column headed 'tadaFdrAscSscExomeSscAgpSmallDel'), which represents a combined analysis of exome data and small de novo deletions (see www.cell.com/cms/attachment/2038545319/2052606711/mmc7.xlsx).
Zhang D Score

Score 0.67938632481065

Ranking 7/20870 scored genes


[Show Scoring Methodology]
The DAMAGES score (disease-associated mutation analysis using gene expression signatures), or D score, was developed to combine evidence from de novo loss-of- function mutation with evidence from cell-type- specific gene expression in the mouse brain (specifically translational profiles of 24 specific mouse CNS cell types isolated from 6 different brain regions). Genes with positive D scores are more likely to be associated with autism risk, with higher-confidence genes having higher D scores. This statistic was first presented by Zhang & Shen (Hum Mutat 38, 204- 215 (2017), and D scores for more than 20,000 RefSeq genes can be found in column M in supplementary table 2 from that paper.
Interaction Table
Interactor Symbol Interactor Name Interactor Organism Interactor Type Entrez ID Uniprot ID
7-Sep septin 7 Human DNA Binding 989 A8K3D0
ABCB1 ATP-binding cassette, sub-family B (MDR/TAP), member 1 Human DNA Binding 5243 A4D1D2
ABCG2 ATP-binding cassette, sub-family G (WHITE), member 2 Human DNA Binding 9429 Q9UNQ0
ANKRD2 ankyrin repeat domain 2 (stretch responsive muscle) Human DNA Binding 26287 Q9GZV1
C18ORF21 UPF0711 protein C18orf21 Human Protein Binding 83608 Q32NC0
CamKIV Calcium/calmodulin-dependent protein kinase type IV Mouse Direct Regulation P08414
Cdk10 cyclin-dependent kinase 10 Mouse RNA Binding 234854 Q0VH02
CHRFAM7A CHRNA7 (cholinergic receptor, nicotinic, alpha 7, exons 5-10) and FAM7A (family with sequence similarity 7A, exons A-E) fusion Human DNA Binding 89832 Q494W8
DDX25 DEAD (Asp-Glu-Ala-Asp) box helicase 25 Human Protein Binding 29118 Q9UHL0
Dlx4 distal-less homeobox 4 Mouse DNA Binding 1748 Q92988
DLX6 distal-less homeobox 6 Human DNA Binding 1750 J3KR92
EGR2 early growth response 2 Human DNA Binding 1959 P11161
Fam19a1 family with sequence similarity 19, member A1 Mouse DNA Binding 320265 Q7TPG8
Fam203a family with sequence similarity 203, member A Mouse DNA Binding 59053 Q8C3I8
Gadd45b Growth arrest and DNA-damage-inducible 45 beta Rat Direct Regulation 299626 Q5U3Z2
Gpaa1 GPI anchor attachment protein 1 Mouse DNA Binding 14731 Q9WTK3
gs17 gastrula-specific protein 17 African clawed frog Direct Regulation 397898 P07733
GTF2F2 general transcription factor IIF, polypeptide 2, 30kDa Human DNA Binding 2963 P13984
hes4-a hairy and enhancer of split 4 African clawed frog Direct Regulation 398579 Q90Z12
Ifng interferon gamma Mouse DNA Binding 15978 P01580
IGF2 insulin-like growth factor 2 (somatomedin A) Human DNA Binding 3481 P01344
IGFBP2 insulin-like growth factor binding protein 2, 36kDa Human DNA Binding 3485 P18065
KIF25-AS1 KIF25 antisense RNA 1 Human DNA Binding 100505879 Q9Y6Z4
Kirrel2 kin of IRRE like 2 (Drosophila) Mouse DNA Binding 243911 Q7TSU7
LOC407840 oviduct protein p20 African clawed frog Protein Binding 407840 Q6Q2J3
MAGEA2 melanoma antigen family A, 2 Human DNA Binding 4101 P43356
MAGEA3 melanoma antigen family A, 3 Human DNA Binding 4102 P43357
miR-132 microRNA 132 Mouse Direct Regulation 387150 N/A
miR-212 microRNA 212 Mouse Direct Regulation 387208 N/A
miR-432 microRNA 432 Human RNA Binding 574451 N/A
Mir106a microRNA 106a Mouse DNA Binding 723829 N/A
Mir124b microRNA 124b Mouse DNA Binding 387234 N/A
Mir128-2 microRNA 128-2 Mouse DNA Binding 723815 N/A
MIR132 microRNA 132 Human DNA Binding 406921 N/A
Mir134 microRNA 134 Mouse DNA Binding 387152 N/A
Mir135a1 microRNA 135a-1 Mouse DNA Binding 387153 N/A
Mir137 microRNA 137 Mouse DNA Binding 387155 N/A
Mir139 microRNA 139 Mouse DNA Binding 387157 N/A
Mir143 microRNA 143 Mouse DNA Binding 387161 N/A
Mir145 microRNA 145 Mouse DNA Binding 387163 N/A
Mir148b microRNA 148b Mouse DNA Binding 724064 N/A
Mir150 microRNA 150 Mouse DNA Binding 387168 N/A
Mir151 microRNA 151 Mouse DNA Binding 387169 N/A
MIR152 microRNA 152 Human DNA Binding 406943 N/A
Mir154 microRNA 154 Mouse DNA Binding 387172 N/A
Mir18 microRNA 18 Mouse DNA Binding 387135 N/A
Mir181c microRNA 181c Mouse DNA Binding 723819 N/A
Mir193b microRNA 193b Mouse DNA Binding 100124432 N/A
Mir195 microRNA 195 Mouse DNA Binding 387190 N/A
Mir19a microRNA 19a Mouse DNA Binding 723891 N/A
Mir204 microRNA 204 Mouse DNA Binding 387200 N/A
Mir205 microRNA 205 Mouse DNA Binding 387201 N/A
Mir207 microRNA 207 Mouse DNA Binding 387203 N/A
Mir20a microRNA 20a Mouse DNA Binding 387139 N/A
Mir211 microRNA 211 Mouse DNA Binding 387207 N/A
Mir25 microRNA 25 Mouse DNA Binding 723926 N/A
Mir28 microRNA 28 Mouse DNA Binding 723830 N/A
Mir299 microRNA 299 Mouse DNA Binding 723927 N/A
Mir300 microRNA 300 Mouse DNA Binding 723833 N/A
Mir302a microRNA 302a Mouse DNA Binding 723920 N/A
Mir302b microRNA 302b Mouse DNA Binding 723948 N/A
Mir302c microRNA 302c Mouse DNA Binding 723835 N/A
Mir302d microRNA 302d Mouse DNA Binding 723928 N/A
Mir30c-1 microRNA 30c-1 Mouse DNA Binding 387227 N/A
Mir30e microRNA 30e Mouse DNA Binding 723836 N/A
Mir323 microRNA 323 Mouse DNA Binding 723839 N/A
Mir326 microRNA 326 Mouse DNA Binding 723840 N/A
Mir329 microRNA 329 Mouse DNA Binding 723842 N/A
Mir33 microRNA 33 Mouse DNA Binding 723897 N/A
Mir330 microRNA 330 Mouse DNA Binding 724063 N/A
Mir338 microRNA 338 Mouse DNA Binding 723844 N/A
Mir339 microRNA 339 Mouse DNA Binding 723898 N/A
Mir341 microRNA 341 Mouse DNA Binding 723846 N/A
Mir345 microRNA 345 Mouse DNA Binding 723946 N/A
Mir34b microRNA 34b Mouse DNA Binding 723849 N/A
Mir34c microRNA 34c Mouse DNA Binding 723932 N/A
Mir365-1 microRNA 365-1 Mouse DNA Binding 723899 N/A
Mir367 microRNA 367 Mouse DNA Binding 723911 N/A
Mir369 microRNA 369 Mouse DNA Binding 723933 N/A
Mir370 microRNA 370 Mouse DNA Binding 723854 N/A
Mir376a microRNA 376a Mouse DNA Binding 723855 N/A
Mir376b microRNA 376b Mouse DNA Binding 723934 N/A
Mir376c microRNA 376c Mouse DNA Binding 723856 N/A
Mir377 microRNA 377 Mouse DNA Binding 723857 N/A
Mir378 microRNA 378 Mouse DNA Binding 723889 N/A
Mir379 microRNA 379 Mouse DNA Binding 723858 N/A
Mir380 microRNA 380 Mouse DNA Binding 723859 N/A
Mir381 microRNA 381 Mouse DNA Binding 723935 N/A
Mir382 microRNA 382 Mouse DNA Binding 723912 N/A
Mir409 microRNA 409 Mouse DNA Binding 723862 N/A
Mir410 microRNA 410 Mouse DNA Binding 723863 N/A
Mir411 microRNA 411 Mouse DNA Binding 723936 N/A
Mir412 microRNA 412 Mouse DNA Binding 723913 N/A
Mir449a microRNA 449a Mouse DNA Binding 723868 N/A
Mir449b microRNA 449b Mouse DNA Binding 100190765 N/A
Mir453 microRNA 453 Mouse DNA Binding 100124484 N/A
Mir485 microRNA 485 Mouse DNA Binding 723875 N/A
Mir487b microRNA 487b Mouse DNA Binding 723940 N/A
Mir488 microRNA 488 Mouse DNA Binding 735253 N/A
Mir494 microRNA 494 Mouse DNA Binding 723878 N/A
Mir495 microRNA 495 Mouse DNA Binding 751522 N/A
Mir496 microRNA 496 Mouse DNA Binding 751524 N/A
Mir497 microRNA 497 Mouse DNA Binding 751537 N/A
Mir539 microRNA 539 Mouse DNA Binding 723917 N/A
Mir541 microRNA 541 Mouse DNA Binding 723941 N/A
Mir543 microRNA 543 Mouse DNA Binding 723881 N/A
Mir544 microRNA 544 Mouse DNA Binding 100124450 N/A
Mir654 microRNA 654 Mouse DNA Binding 100124453 N/A
Mir666 microRNA 666 Mouse DNA Binding 751521 N/A
Mir671 microRNA 671 Mouse DNA Binding 735264 N/A
Mir7-1 microRNA 7-1 Mouse DNA Binding 723902 N/A
Mir708 microRNA 708 Mouse DNA Binding 735284 N/A
Mir758 microRNA 758 Mouse DNA Binding 791071 N/A
Mir802 microRNA 802 Mouse DNA Binding 791074 N/A
Mir882 microRNA 882 Mouse DNA Binding 100124461 N/A
Mir93 microRNA 93 Mouse DNA Binding 723885 N/A
MT1A metallothionein 1A Human DNA Binding 4489 P04731
Mug1 murinoglobulin 1 Mouse DNA Binding 17836 P28665
Mug2 murinoglobulin 2 Mouse DNA Binding 17837 P28666
Myo3a myosin IIIA Mouse DNA Binding 667663 F6QNG5
Mypop Myb-related transcription factor, partner of profilin Mouse DNA Binding 232934 Q8R4U1
Nfkbiz nuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor, zeta Mouse DNA Binding 80859 Q9EST8
Nnmt nicotinamide N-methyltransferase Mouse DNA Binding 18113 O55239
Oplah 5-oxoprolinase (ATP-hydrolysing) Mouse DNA Binding 75475 Q8K010
OR4K1 olfactory receptor, family 4, subfamily K, member 1 Human DNA Binding 79544 Q8NGD4
OR4Q3 olfactory receptor, family 4, subfamily Q, member 3 Human DNA Binding 441669 Q8NH05
PCDHB1 protocadherin beta 1 Human DNA Binding 29930 Q9Y5F3
PCDHB7 protocadherin beta 7 Human DNA Binding 56129 Q9Y5E2
Pdyn prodynorphin Rat DNA Binding 29190 F1M7S3
PLA2G16 phospholipase A2, group XVI Human DNA Binding 11145 P53816
RASSF1 Ras association (RalGDS/AF-6) domain family member 1 Human DNA Binding 11186 Q9NS23
Rsph6a radial spoke head 6 homolog A (Chlamydomonas) Mouse DNA Binding 83434 Q8CDR2
SDHD succinate dehydrogenase complex, subunit D, integral membrane protein Human DNA Binding 6392 O14521
Six5 sine oculis-related homeobox 5 Mouse DNA Binding 20475 P70178
SNAT1 solute carrier family 38, member 1 Mouse DNA Binding 105727 Q8K2P7
SNURF SNRPN upstream reading frame Human DNA Binding 8926 Q9Y675
Spi1 spleen focus forming virus (SFFV) proviral integration oncogene spi1 Mouse Protein Binding 20375 P17433
Syt13 synaptotagmin XIII Mouse DNA Binding 80976 Q9EQT6
SYT3 synaptotagmin III Human DNA Binding 20981 G3X9Y1
t-a T, brachyury homolog African clawed frog Direct Regulation 399275 P24781
Tac4 tachykinin 4 Mouse DNA Binding 93670 Q99N14
TAF1C TATA box-binding protein-associated factor RNA polymerase I subunit C Human Protein Binding 9013 Q15572-6
Tsix X (inactive)-specific transcript, antisense Mouse DNA Binding 22097 N/A
TSSC1 tumor suppressing subtransferable candidate 1 Human DNA Binding 7260 Q53HC9
Uba1y ubiquitin-activating enzyme, Chr Y Mouse DNA Binding 22202 P31254
WDR83OS WD repeat domain 83 opposite strand Human DNA Binding 51398 Q9Y284
ZNF593 Zinc finger protein 593 Human Protein Binding 51042 O00488
Submit New Gene

Report an Error