MUC4mucin 4, cell surface associated
Autism Reports / Total Reports
12 / 12Rare Variants / Common Variants
91 / 0Aliases
MUC4, ASGP, HSA276359, MUC-4Associated Syndromes
-Chromosome Band
3q29Associated Disorders
-Relevance to Autism
De novo missense variants and rare inherited loss-of-function (LoF) variants in the MUC4 gene were identified in ASD probands from the Simons Simplex Collection and the Autism Sequencing Consortium (Iossifov et al., 2012; De Rubeis et al., 2014; Iossifov et al., 2014; Krumm et al., 2015). Targeted sequencing of 536 Chinese ASD probands and 1457 Chinese controls in Guo et al., 2017 identified additional rare inherited LoF and damaging missense variants in this gene in ASD probands. Transmission and De Novo Association (TADA) analysis of a combined cohort consisting of Chinese ASD probands and controls, as well as ASD probands and controls from the Simons Simplex Collection and the Autism Sequencing Consortium, identified MUC4 as an ASD candidate gene with a PTADA of 0.000105.
Molecular Function
The major constituents of mucus, the viscous secretion that covers epithelial surfaces such as those in the trachea, colon, and cervix, are highly glycosylated proteins called mucins. These glycoproteins play important roles in the protection of the epithelial cells and have been implicated in epithelial renewal and differentiation. This gene encodes an integral membrane glycoprotein found on the cell surface, although secreted isoforms may exist.
External Links
SFARI Genomic Platforms
Reports related to MUC4 (12 Reports)
| # | Type | Title | Author, Year | Autism Report | Associated Disorders |
|---|---|---|---|---|---|
| 1 | Primary | De novo gene disruptions in children on the autistic spectrum | Iossifov I , et al. (2012) | Yes | - |
| 2 | Support | Synaptic, transcriptional and chromatin genes disrupted in autism | De Rubeis S , et al. (2014) | Yes | - |
| 3 | Support | The contribution of de novo coding mutations to autism spectrum disorder | Iossifov I et al. (2014) | Yes | - |
| 4 | Support | Excess of rare, inherited truncating mutations in autism | Krumm N , et al. (2015) | Yes | - |
| 5 | Recent Recommendation | Targeted sequencing and functional analysis reveal brain-size-related genes and their networks in autism spectrum disorders | Li J , et al. (2017) | Yes | - |
| 6 | Support | Inherited and De Novo Genetic Risk for Autism Impacts Shared Networks | Ruzzo EK , et al. (2019) | Yes | - |
| 7 | Support | Exome sequencing of 457 autism families recruited online provides evidence for autism risk genes | Feliciano P et al. (2019) | Yes | - |
| 8 | Support | - | Woodbury-Smith M et al. (2022) | Yes | - |
| 9 | Support | - | Cirnigliaro M et al. (2023) | Yes | - |
| 10 | Support | - | Ashlesha Gogate et al. (2024) | Yes | - |
| 11 | Support | - | Gabriela Repiská et al. (2025) | Yes | - |
| 12 | Support | - | Natividad Avila, Marina et al. (2026) | Yes | - |
Rare Variants (91)
| Status | Allele Change | Residue Change | Variant Type | Inheritance Pattern | Parental Transmission | Family Type | PubMed ID | Author, Year |
|---|---|---|---|---|---|---|---|---|
| c.1678G>A | p.Gly560Arg | missense_variant | Familial | - | - | 28831199 | Li J , et al. (2017) | |
| c.83-3070C>G | - | stop_gained | Familial | Maternal | Simplex | 25961944 | Krumm N , et al. (2015) | |
| c.83-5854C>A | - | stop_gained | Familial | Maternal | Simplex | 25961944 | Krumm N , et al. (2015) | |
| c.83-5854C>A | - | stop_gained | Familial | Paternal | Simplex | 25961944 | Krumm N , et al. (2015) | |
| c.83-6910C>A | - | stop_gained | Familial | Maternal | Simplex | 25961944 | Krumm N , et al. (2015) | |
| c.2151G>A | p.Pro717= | synonymous_variant | De novo | - | - | 31452935 | Feliciano P et al. (2019) | |
| c.83-10030C>G | - | stop_gained | Familial | Paternal | Simplex | 25961944 | Krumm N , et al. (2015) | |
| c.83-10246C>G | - | stop_gained | Familial | Maternal | Simplex | 25961944 | Krumm N , et al. (2015) | |
| c.83-10246C>G | - | stop_gained | Familial | Paternal | Simplex | 25961944 | Krumm N , et al. (2015) | |
| c.2454C>A | p.Ser818Arg | missense_variant | De novo | - | - | 25363760 | De Rubeis S , et al. (2014) | |
| C>A | p.Glu859Ter | stop_gained | Familial | Maternal | Simplex | 25961944 | Krumm N , et al. (2015) | |
| CA>C | -11 | frameshift_variant | Familial | Maternal | Simplex | 25961944 | Krumm N , et al. (2015) | |
| CA>C | -11 | frameshift_variant | Familial | Paternal | Simplex | 25961944 | Krumm N , et al. (2015) | |
| TC>T | -97 | frameshift_variant | Familial | Maternal | Simplex | 25961944 | Krumm N , et al. (2015) | |
| T>TG | -913? | frameshift_variant | Familial | Maternal | Simplex | 25961944 | Krumm N , et al. (2015) | |
| A>AC | -2064? | frameshift_variant | Familial | Maternal | Simplex | 25961944 | Krumm N , et al. (2015) | |
| C>CA | -3906? | frameshift_variant | Familial | Maternal | Simplex | 25961944 | Krumm N , et al. (2015) | |
| G>GA | -1743? | frameshift_variant | Familial | Maternal | Simplex | 25961944 | Krumm N , et al. (2015) | |
| G>GA | -4263? | frameshift_variant | Familial | Maternal | Simplex | 25961944 | Krumm N , et al. (2015) | |
| G>GC | -1749? | frameshift_variant | Familial | Maternal | Simplex | 25961944 | Krumm N , et al. (2015) | |
| G>GT | -1669? | frameshift_variant | Familial | Maternal | Simplex | 25961944 | Krumm N , et al. (2015) | |
| G>GT | -1669? | frameshift_variant | Familial | Paternal | Simplex | 25961944 | Krumm N , et al. (2015) | |
| GCA>G | -2829 | frameshift_variant | Familial | Maternal | Simplex | 25961944 | Krumm N , et al. (2015) | |
| GCC>G | -3133 | frameshift_variant | Familial | Paternal | Simplex | 25961944 | Krumm N , et al. (2015) | |
| GTC>G | -3621 | frameshift_variant | Familial | Paternal | Simplex | 25961944 | Krumm N , et al. (2015) | |
| c.1403G>T | p.Arg468Met | missense_variant | Unknown | - | - | 35205252 | Woodbury-Smith M et al. (2022) | |
| A>AAG | -2310? | frameshift_variant | Familial | Maternal | Simplex | 25961944 | Krumm N , et al. (2015) | |
| A>ATT | -1670? | frameshift_variant | Familial | Maternal | Simplex | 25961944 | Krumm N , et al. (2015) | |
| A>ATT | -1670? | frameshift_variant | Familial | Paternal | Simplex | 25961944 | Krumm N , et al. (2015) | |
| G>GCA | -2750? | frameshift_variant | Familial | Maternal | Simplex | 25961944 | Krumm N , et al. (2015) | |
| G>GCA | -2750? | frameshift_variant | Familial | Paternal | Simplex | 25961944 | Krumm N , et al. (2015) | |
| G>GCA | -4190? | frameshift_variant | Familial | Maternal | Simplex | 25961944 | Krumm N , et al. (2015) | |
| G>GTC | -1372? | frameshift_variant | Familial | Maternal | Simplex | 25961944 | Krumm N , et al. (2015) | |
| c.236-2A>G | - | splice_site_variant | Familial | Paternal | Simplex | 25961944 | Krumm N , et al. (2015) | |
| GCGTC>G | -3589 | frameshift_variant | Familial | Maternal | Simplex | 25961944 | Krumm N , et al. (2015) | |
| c.3253G>C | p.Asp1085His | missense_variant | De novo | - | Simplex | 25363768 | Iossifov I et al. (2014) | |
| c.5683A>T | p.Asn1895Tyr | missense_variant | De novo | - | Simplex | 25363768 | Iossifov I et al. (2014) | |
| c.6533C>A | p.Pro2178His | missense_variant | De novo | - | Simplex | 25363768 | Iossifov I et al. (2014) | |
| c.2575G>T | p.Glu859Ter | stop_gained | Familial | Maternal | Simplex | 25961944 | Krumm N , et al. (2015) | |
| c.2575G>T | p.Glu859Ter | stop_gained | Familial | Paternal | Simplex | 25961944 | Krumm N , et al. (2015) | |
| c.2935C>T | p.Arg979Ter | stop_gained | Familial | Maternal | Simplex | 25961944 | Krumm N , et al. (2015) | |
| GTGTCA>G | -2700 | frameshift_variant | Familial | Maternal | Simplex | 25961944 | Krumm N , et al. (2015) | |
| GTGTCA>G | -2700 | frameshift_variant | Familial | Paternal | Simplex | 25961944 | Krumm N , et al. (2015) | |
| GTGTGA>G | -1612 | frameshift_variant | Familial | Maternal | Simplex | 25961944 | Krumm N , et al. (2015) | |
| c.9023C>T | p.Ser3008Phe | missense_variant | De novo | - | Simplex | 22542183 | Iossifov I , et al. (2012) | |
| A>ATAC | p.Ala3753AlaTer | stop_gained | Familial | Maternal | Simplex | 25961944 | Krumm N , et al. (2015) | |
| c.3235C>T | p.Gln1079Ter | stop_gained | Familial | Paternal | Simplex | 25961944 | Krumm N , et al. (2015) | |
| G>GCGTC | -3862D? | frameshift_variant | Familial | Maternal | Simplex | 25961944 | Krumm N , et al. (2015) | |
| G>GCGTC | -3862D? | frameshift_variant | Familial | Paternal | Simplex | 25961944 | Krumm N , et al. (2015) | |
| T>TGCTG | -3993Q? | frameshift_variant | Familial | Maternal | Simplex | 25961944 | Krumm N , et al. (2015) | |
| c.5068_5069insT | p.Thr1690IlefsTer4 | frameshift_variant | Familial | - | - | 28831199 | Li J , et al. (2017) | |
| c.5161_5162insC | p.Val1721AlafsTer5 | frameshift_variant | Familial | - | - | 28831199 | Li J , et al. (2017) | |
| A>AAGGCT | -2742S? | frameshift_variant | Familial | Paternal | Simplex | 25961944 | Krumm N , et al. (2015) | |
| G>GGTGTC | -4174D? | frameshift_variant | Familial | Paternal | Simplex | 25961944 | Krumm N , et al. (2015) | |
| GCCTGACC>G | -3132 | frameshift_variant | Familial | Paternal | Simplex | 25961944 | Krumm N , et al. (2015) | |
| c.1038G>A | p.Pro346= | synonymous_variant | De novo | - | - | 41912808 | Natividad Avila, Marina et al. (2026) | |
| c.3194C>T | p.Ala1065Val | missense_variant | De novo | - | - | 41912808 | Natividad Avila, Marina et al. (2026) | |
| c.7929C>T | p.Val2643= | synonymous_variant | De novo | - | - | 41912808 | Natividad Avila, Marina et al. (2026) | |
| G>GGGGTGGC | -3008AT? | frameshift_variant | Familial | Maternal | Simplex | 25961944 | Krumm N , et al. (2015) | |
| GCA>G,GCG,GCC | -3933 | frameshift_variant | Familial | Paternal | Simplex | 25961944 | Krumm N , et al. (2015) | |
| c.11079G>T | p.Gln3693His | missense_variant | Unknown | - | Simplex | 39632905 | Ashlesha Gogate et al. (2024) | |
| c.12193C>G | p.Leu4065Val | missense_variant | Unknown | - | Simplex | 39632905 | Ashlesha Gogate et al. (2024) | |
| c.11347T>A | p.Ser3783Thr | missense_variant | De novo | - | - | 41912808 | Natividad Avila, Marina et al. (2026) | |
| TCACCCA>CCCCCCC | p.? | splice_site_variant | Familial | Maternal | Simplex | 25961944 | Krumm N , et al. (2015) | |
| T>TGACCTGTGGA | -973STG? | frameshift_variant | Familial | Maternal | Simplex | 25961944 | Krumm N , et al. (2015) | |
| T>TGACCTGTGGA | -973STG? | frameshift_variant | Familial | Paternal | Simplex | 25961944 | Krumm N , et al. (2015) | |
| A>AGGGGTGGCGT | -3008TPP? | frameshift_variant | Familial | Paternal | Simplex | 25961944 | Krumm N , et al. (2015) | |
| c.943A>T | p.Thr315Ser | missense_variant | De novo | - | Simplex | 41912808 | Natividad Avila, Marina et al. (2026) | |
| c.3112G>A | p.Val1038Ile | missense_variant | De novo | - | Simplex | 41912808 | Natividad Avila, Marina et al. (2026) | |
| c.3160A>G | p.Ser1054Gly | missense_variant | De novo | - | Simplex | 41912808 | Natividad Avila, Marina et al. (2026) | |
| c.4469C>T | p.Pro1490Leu | missense_variant | De novo | - | Simplex | 41912808 | Natividad Avila, Marina et al. (2026) | |
| c.4649C>A | p.Thr1550Asn | missense_variant | De novo | - | Simplex | 41912808 | Natividad Avila, Marina et al. (2026) | |
| c.6410C>T | p.Thr2137Ile | missense_variant | De novo | - | Simplex | 41912808 | Natividad Avila, Marina et al. (2026) | |
| c.8244T>A | p.Gly2748= | synonymous_variant | De novo | - | Simplex | 41912808 | Natividad Avila, Marina et al. (2026) | |
| c.8280A>G | p.Ser2760= | synonymous_variant | De novo | - | Simplex | 41912808 | Natividad Avila, Marina et al. (2026) | |
| c.11608G>A | p.Ala3870Thr | missense_variant | De novo | - | Simplex | 41912808 | Natividad Avila, Marina et al. (2026) | |
| c.12016A>T | p.Thr4006Ser | missense_variant | De novo | - | Simplex | 41912808 | Natividad Avila, Marina et al. (2026) | |
| c.12494A>G | p.Asp4165Gly | missense_variant | De novo | - | Simplex | 41912808 | Natividad Avila, Marina et al. (2026) | |
| c.10268C>T | p.Thr3423Ile | missense_variant | De novo | - | Unknown | 41912808 | Natividad Avila, Marina et al. (2026) | |
| c.10421C>A | p.Pro3474His | missense_variant | De novo | - | Multiplex | 41912808 | Natividad Avila, Marina et al. (2026) | |
| c.292del | p.Thr98ProfsTer93 | frameshift_variant | Familial | Paternal | Multiplex | 31398340 | Ruzzo EK , et al. (2019) | |
| c.14678_14679del | p.Pro4893ArgfsTer14 | frameshift_variant | Unknown | - | - | 40869941 | Gabriela Repiská et al. (2025) | |
| c.31del | p.Trp11GlyfsTer4 | frameshift_variant | Familial | Paternal | Multiplex | 37506195 | Cirnigliaro M et al. (2023) | |
| c.11079G>T | p.Gln3693His | missense_variant | Familial | Both parents | Simplex | 39632905 | Ashlesha Gogate et al. (2024) | |
| c.6710_6711del | p.Gln2237ArgfsTer16 | frameshift_variant | De novo | - | - | 41912808 | Natividad Avila, Marina et al. (2026) | |
| c.11079G>T | p.Gln3693His | missense_variant | Familial | Both parents | Multiplex | 39632905 | Ashlesha Gogate et al. (2024) | |
| c.2356_2357del | p.Gln786AspfsTer92 | frameshift_variant | Familial | Paternal | Multiplex | 37506195 | Cirnigliaro M et al. (2023) | |
| ATCTGAAGTAAGCCTTCAGCGTGCTCACGTTCACTG>A | p.? | splice_site_variant | Familial | Paternal | Simplex | 25961944 | Krumm N , et al. (2015) | |
| ACCTGTGGATGCTGAGGAAGTGTCCGTGACAGGAAGACG>A | -3680 | frameshift_variant | Familial | Paternal | Simplex | 25961944 | Krumm N , et al. (2015) | |
| GTGTATGCTGAGGAAGTGTCGGTGACAGGAAGAGAGGTGGTGTC>G | -2701 | frameshift_variant | Familial | Paternal | Simplex | 25961944 | Krumm N , et al. (2015) | |
| c.3038_3039insGTCACGCCACCCCTCTTCCTGTCACCAC | p.Ser1013ArgfsTer50 | frameshift_variant | De novo | - | Unknown | 41912808 | Natividad Avila, Marina et al. (2026) |
Common Variants
No common variants reported.
SFARI Gene score
Strong Candidate

De novo missense variants and rare inherited loss-of-function (LoF) variants in the MUC4 gene were identified in ASD probands from the Simons Simplex Collection and the Autism Sequencing Consortium (Iossifov et al., 2012; De Rubeis et al., 2014; Iossifov et al., 2014; Krumm et al., 2015). targeted sequencing of 536 Chinese ASD probands and 1457 Chinese controls in Guo et al., 2017 identified additional rare inherited LoF and damaging missense variants in this gene in ASD probands. Transmission and De Novo Association (TADA) analysis of a combined cohort consisting of Chinese ASD probands and controls, as well as ASD probands and controls from the Simons Simplex Collection and the Autism Sequencing Consortium, identified MUC4 as an ASD candidate gene with a PTADA of 0.000105.
Score Delta: Score remained at 2
criteria met
See SFARI Gene'scoring criteriaWe considered a rigorous statistical comparison between cases and controls, yielding genome-wide statistical significance, with independent replication, to be the strongest possible evidence for a gene. These criteria were relaxed slightly for category 2.
4/1/2022

Decreased from 3 to 2
Description
De novo missense variants and rare inherited loss-of-function (LoF) variants in the MUC4 gene were identified in ASD probands from the Simons Simplex Collection and the Autism Sequencing Consortium (Iossifov et al., 2012; De Rubeis et al., 2014; Iossifov et al., 2014; Krumm et al., 2015). targeted sequencing of 536 Chinese ASD probands and 1457 Chinese controls in Guo et al., 2017 identified additional rare inherited LoF and damaging missense variants in this gene in ASD probands. Transmission and De Novo Association (TADA) analysis of a combined cohort consisting of Chinese ASD probands and controls, as well as ASD probands and controls from the Simons Simplex Collection and the Autism Sequencing Consortium, identified MUC4 as an ASD candidate gene with a PTADA of 0.000105.
10/1/2019

Decreased from 4 to 3
New Scoring Scheme
Description
De novo missense variants and rare inherited loss-of-function (LoF) variants in the MUC4 gene were identified in ASD probands from the Simons Simplex Collection and the Autism Sequencing Consortium (Iossifov et al., 2012; De Rubeis et al., 2014; Iossifov et al., 2014; Krumm et al., 2015). targeted sequencing of 536 Chinese ASD probands and 1457 Chinese controls in Guo et al., 2017 identified additional rare inherited LoF and damaging missense variants in this gene in ASD probands. Transmission and De Novo Association (TADA) analysis of a combined cohort consisting of Chinese ASD probands and controls, as well as ASD probands and controls from the Simons Simplex Collection and the Autism Sequencing Consortium, identified MUC4 as an ASD candidate gene with a PTADA of 0.000105.
7/1/2019

Decreased from 4 to 4
Description
De novo missense variants and rare inherited loss-of-function (LoF) variants in the MUC4 gene were identified in ASD probands from the Simons Simplex Collection and the Autism Sequencing Consortium (Iossifov et al., 2012; De Rubeis et al., 2014; Iossifov et al., 2014; Krumm et al., 2015). targeted sequencing of 536 Chinese ASD probands and 1457 Chinese controls in Guo et al., 2017 identified additional rare inherited LoF and damaging missense variants in this gene in ASD probands. Transmission and De Novo Association (TADA) analysis of a combined cohort consisting of Chinese ASD probands and controls, as well as ASD probands and controls from the Simons Simplex Collection and the Autism Sequencing Consortium, identified MUC4 as an ASD candidate gene with a PTADA of 0.000105.
7/1/2017

Increased from to 4
Description
De novo missense variants and rare inherited loss-of-function (LoF) variants in the MUC4 gene were identified in ASD probands from the Simons Simplex Collection and the Autism Sequencing Consortium (Iossifov et al., 2012; De Rubeis et al., 2014; Iossifov et al., 2014; Krumm et al., 2015). targeted sequencing of 536 Chinese ASD probands and 1457 Chinese controls in Guo et al., 2017 identified additional rare inherited LoF and damaging missense variants in this gene in ASD probands. Transmission and De Novo Association (TADA) analysis of a combined cohort consisting of Chinese ASD probands and controls, as well as ASD probands and controls from the Simons Simplex Collection and the Autism Sequencing Consortium, identified MUC4 as an ASD candidate gene with a PTADA of 0.000105.
Krishnan Probability Score
Score 0.42769608895581
Ranking 20913/25841 scored genes
[Show Scoring Methodology]
Sanders TADA Score
Score 0.94473503012567
Ranking 16192/18665 scored genes
[Show Scoring Methodology]
Zhang D Score
Score -0.016614563597012
Ranking 9227/20870 scored genes
[Show Scoring Methodology]
CNVs associated with MUC4(1 CNVs)
Sort By:
| 3q29 | 72 | Deletion-Duplication | 107 / 499 |