Human Gene Module / Chromosome 3 / MUC4

MUC4mucin 4, cell surface associated

SFARI Gene Score
2
Strong Candidate Criteria 2.1
Autism Reports / Total Reports
12 / 12
Rare Variants / Common Variants
91 / 0
Aliases
MUC4, ASGP,  HSA276359,  MUC-4
Associated Syndromes
-
Chromosome Band
3q29
Associated Disorders
-
Relevance to Autism

De novo missense variants and rare inherited loss-of-function (LoF) variants in the MUC4 gene were identified in ASD probands from the Simons Simplex Collection and the Autism Sequencing Consortium (Iossifov et al., 2012; De Rubeis et al., 2014; Iossifov et al., 2014; Krumm et al., 2015). Targeted sequencing of 536 Chinese ASD probands and 1457 Chinese controls in Guo et al., 2017 identified additional rare inherited LoF and damaging missense variants in this gene in ASD probands. Transmission and De Novo Association (TADA) analysis of a combined cohort consisting of Chinese ASD probands and controls, as well as ASD probands and controls from the Simons Simplex Collection and the Autism Sequencing Consortium, identified MUC4 as an ASD candidate gene with a PTADA of 0.000105.

Molecular Function

The major constituents of mucus, the viscous secretion that covers epithelial surfaces such as those in the trachea, colon, and cervix, are highly glycosylated proteins called mucins. These glycoproteins play important roles in the protection of the epithelial cells and have been implicated in epithelial renewal and differentiation. This gene encodes an integral membrane glycoprotein found on the cell surface, although secreted isoforms may exist.

SFARI Genomic Platforms
Reports related to MUC4 (12 Reports)
# Type Title Author, Year Autism Report Associated Disorders
1 Primary De novo gene disruptions in children on the autistic spectrum Iossifov I , et al. (2012) Yes -
2 Support Synaptic, transcriptional and chromatin genes disrupted in autism De Rubeis S , et al. (2014) Yes -
3 Support The contribution of de novo coding mutations to autism spectrum disorder Iossifov I et al. (2014) Yes -
4 Support Excess of rare, inherited truncating mutations in autism Krumm N , et al. (2015) Yes -
5 Recent Recommendation Targeted sequencing and functional analysis reveal brain-size-related genes and their networks in autism spectrum disorders Li J , et al. (2017) Yes -
6 Support Inherited and De Novo Genetic Risk for Autism Impacts Shared Networks Ruzzo EK , et al. (2019) Yes -
7 Support Exome sequencing of 457 autism families recruited online provides evidence for autism risk genes Feliciano P et al. (2019) Yes -
8 Support - Woodbury-Smith M et al. (2022) Yes -
9 Support - Cirnigliaro M et al. (2023) Yes -
10 Support - Ashlesha Gogate et al. (2024) Yes -
11 Support - Gabriela Repiská et al. (2025) Yes -
12 Support - Natividad Avila, Marina et al. (2026) Yes -
Rare Variants   (91)
Status Allele Change Residue Change Variant Type Inheritance Pattern Parental Transmission Family Type PubMed ID Author, Year
c.1678G>A p.Gly560Arg missense_variant Familial - - 28831199 Li J , et al. (2017)
c.83-3070C>G - stop_gained Familial Maternal Simplex 25961944 Krumm N , et al. (2015)
c.83-5854C>A - stop_gained Familial Maternal Simplex 25961944 Krumm N , et al. (2015)
c.83-5854C>A - stop_gained Familial Paternal Simplex 25961944 Krumm N , et al. (2015)
c.83-6910C>A - stop_gained Familial Maternal Simplex 25961944 Krumm N , et al. (2015)
c.2151G>A p.Pro717= synonymous_variant De novo - - 31452935 Feliciano P et al. (2019)
c.83-10030C>G - stop_gained Familial Paternal Simplex 25961944 Krumm N , et al. (2015)
c.83-10246C>G - stop_gained Familial Maternal Simplex 25961944 Krumm N , et al. (2015)
c.83-10246C>G - stop_gained Familial Paternal Simplex 25961944 Krumm N , et al. (2015)
c.2454C>A p.Ser818Arg missense_variant De novo - - 25363760 De Rubeis S , et al. (2014)
C>A p.Glu859Ter stop_gained Familial Maternal Simplex 25961944 Krumm N , et al. (2015)
CA>C -11 frameshift_variant Familial Maternal Simplex 25961944 Krumm N , et al. (2015)
CA>C -11 frameshift_variant Familial Paternal Simplex 25961944 Krumm N , et al. (2015)
TC>T -97 frameshift_variant Familial Maternal Simplex 25961944 Krumm N , et al. (2015)
T>TG -913? frameshift_variant Familial Maternal Simplex 25961944 Krumm N , et al. (2015)
A>AC -2064? frameshift_variant Familial Maternal Simplex 25961944 Krumm N , et al. (2015)
C>CA -3906? frameshift_variant Familial Maternal Simplex 25961944 Krumm N , et al. (2015)
G>GA -1743? frameshift_variant Familial Maternal Simplex 25961944 Krumm N , et al. (2015)
G>GA -4263? frameshift_variant Familial Maternal Simplex 25961944 Krumm N , et al. (2015)
G>GC -1749? frameshift_variant Familial Maternal Simplex 25961944 Krumm N , et al. (2015)
G>GT -1669? frameshift_variant Familial Maternal Simplex 25961944 Krumm N , et al. (2015)
G>GT -1669? frameshift_variant Familial Paternal Simplex 25961944 Krumm N , et al. (2015)
GCA>G -2829 frameshift_variant Familial Maternal Simplex 25961944 Krumm N , et al. (2015)
GCC>G -3133 frameshift_variant Familial Paternal Simplex 25961944 Krumm N , et al. (2015)
GTC>G -3621 frameshift_variant Familial Paternal Simplex 25961944 Krumm N , et al. (2015)
c.1403G>T p.Arg468Met missense_variant Unknown - - 35205252 Woodbury-Smith M et al. (2022)
A>AAG -2310? frameshift_variant Familial Maternal Simplex 25961944 Krumm N , et al. (2015)
A>ATT -1670? frameshift_variant Familial Maternal Simplex 25961944 Krumm N , et al. (2015)
A>ATT -1670? frameshift_variant Familial Paternal Simplex 25961944 Krumm N , et al. (2015)
G>GCA -2750? frameshift_variant Familial Maternal Simplex 25961944 Krumm N , et al. (2015)
G>GCA -2750? frameshift_variant Familial Paternal Simplex 25961944 Krumm N , et al. (2015)
G>GCA -4190? frameshift_variant Familial Maternal Simplex 25961944 Krumm N , et al. (2015)
G>GTC -1372? frameshift_variant Familial Maternal Simplex 25961944 Krumm N , et al. (2015)
c.236-2A>G - splice_site_variant Familial Paternal Simplex 25961944 Krumm N , et al. (2015)
GCGTC>G -3589 frameshift_variant Familial Maternal Simplex 25961944 Krumm N , et al. (2015)
c.3253G>C p.Asp1085His missense_variant De novo - Simplex 25363768 Iossifov I et al. (2014)
c.5683A>T p.Asn1895Tyr missense_variant De novo - Simplex 25363768 Iossifov I et al. (2014)
c.6533C>A p.Pro2178His missense_variant De novo - Simplex 25363768 Iossifov I et al. (2014)
c.2575G>T p.Glu859Ter stop_gained Familial Maternal Simplex 25961944 Krumm N , et al. (2015)
c.2575G>T p.Glu859Ter stop_gained Familial Paternal Simplex 25961944 Krumm N , et al. (2015)
c.2935C>T p.Arg979Ter stop_gained Familial Maternal Simplex 25961944 Krumm N , et al. (2015)
GTGTCA>G -2700 frameshift_variant Familial Maternal Simplex 25961944 Krumm N , et al. (2015)
GTGTCA>G -2700 frameshift_variant Familial Paternal Simplex 25961944 Krumm N , et al. (2015)
GTGTGA>G -1612 frameshift_variant Familial Maternal Simplex 25961944 Krumm N , et al. (2015)
c.9023C>T p.Ser3008Phe missense_variant De novo - Simplex 22542183 Iossifov I , et al. (2012)
A>ATAC p.Ala3753AlaTer stop_gained Familial Maternal Simplex 25961944 Krumm N , et al. (2015)
c.3235C>T p.Gln1079Ter stop_gained Familial Paternal Simplex 25961944 Krumm N , et al. (2015)
G>GCGTC -3862D? frameshift_variant Familial Maternal Simplex 25961944 Krumm N , et al. (2015)
G>GCGTC -3862D? frameshift_variant Familial Paternal Simplex 25961944 Krumm N , et al. (2015)
T>TGCTG -3993Q? frameshift_variant Familial Maternal Simplex 25961944 Krumm N , et al. (2015)
c.5068_5069insT p.Thr1690IlefsTer4 frameshift_variant Familial - - 28831199 Li J , et al. (2017)
c.5161_5162insC p.Val1721AlafsTer5 frameshift_variant Familial - - 28831199 Li J , et al. (2017)
A>AAGGCT -2742S? frameshift_variant Familial Paternal Simplex 25961944 Krumm N , et al. (2015)
G>GGTGTC -4174D? frameshift_variant Familial Paternal Simplex 25961944 Krumm N , et al. (2015)
GCCTGACC>G -3132 frameshift_variant Familial Paternal Simplex 25961944 Krumm N , et al. (2015)
c.1038G>A p.Pro346= synonymous_variant De novo - - 41912808 Natividad Avila, Marina et al. (2026)
c.3194C>T p.Ala1065Val missense_variant De novo - - 41912808 Natividad Avila, Marina et al. (2026)
c.7929C>T p.Val2643= synonymous_variant De novo - - 41912808 Natividad Avila, Marina et al. (2026)
G>GGGGTGGC -3008AT? frameshift_variant Familial Maternal Simplex 25961944 Krumm N , et al. (2015)
GCA>G,GCG,GCC -3933 frameshift_variant Familial Paternal Simplex 25961944 Krumm N , et al. (2015)
c.11079G>T p.Gln3693His missense_variant Unknown - Simplex 39632905 Ashlesha Gogate et al. (2024)
c.12193C>G p.Leu4065Val missense_variant Unknown - Simplex 39632905 Ashlesha Gogate et al. (2024)
c.11347T>A p.Ser3783Thr missense_variant De novo - - 41912808 Natividad Avila, Marina et al. (2026)
TCACCCA>CCCCCCC p.? splice_site_variant Familial Maternal Simplex 25961944 Krumm N , et al. (2015)
T>TGACCTGTGGA -973STG? frameshift_variant Familial Maternal Simplex 25961944 Krumm N , et al. (2015)
T>TGACCTGTGGA -973STG? frameshift_variant Familial Paternal Simplex 25961944 Krumm N , et al. (2015)
A>AGGGGTGGCGT -3008TPP? frameshift_variant Familial Paternal Simplex 25961944 Krumm N , et al. (2015)
c.943A>T p.Thr315Ser missense_variant De novo - Simplex 41912808 Natividad Avila, Marina et al. (2026)
c.3112G>A p.Val1038Ile missense_variant De novo - Simplex 41912808 Natividad Avila, Marina et al. (2026)
c.3160A>G p.Ser1054Gly missense_variant De novo - Simplex 41912808 Natividad Avila, Marina et al. (2026)
c.4469C>T p.Pro1490Leu missense_variant De novo - Simplex 41912808 Natividad Avila, Marina et al. (2026)
c.4649C>A p.Thr1550Asn missense_variant De novo - Simplex 41912808 Natividad Avila, Marina et al. (2026)
c.6410C>T p.Thr2137Ile missense_variant De novo - Simplex 41912808 Natividad Avila, Marina et al. (2026)
c.8244T>A p.Gly2748= synonymous_variant De novo - Simplex 41912808 Natividad Avila, Marina et al. (2026)
c.8280A>G p.Ser2760= synonymous_variant De novo - Simplex 41912808 Natividad Avila, Marina et al. (2026)
c.11608G>A p.Ala3870Thr missense_variant De novo - Simplex 41912808 Natividad Avila, Marina et al. (2026)
c.12016A>T p.Thr4006Ser missense_variant De novo - Simplex 41912808 Natividad Avila, Marina et al. (2026)
c.12494A>G p.Asp4165Gly missense_variant De novo - Simplex 41912808 Natividad Avila, Marina et al. (2026)
c.10268C>T p.Thr3423Ile missense_variant De novo - Unknown 41912808 Natividad Avila, Marina et al. (2026)
c.10421C>A p.Pro3474His missense_variant De novo - Multiplex 41912808 Natividad Avila, Marina et al. (2026)
c.292del p.Thr98ProfsTer93 frameshift_variant Familial Paternal Multiplex 31398340 Ruzzo EK , et al. (2019)
c.14678_14679del p.Pro4893ArgfsTer14 frameshift_variant Unknown - - 40869941 Gabriela Repiská et al. (2025)
c.31del p.Trp11GlyfsTer4 frameshift_variant Familial Paternal Multiplex 37506195 Cirnigliaro M et al. (2023)
c.11079G>T p.Gln3693His missense_variant Familial Both parents Simplex 39632905 Ashlesha Gogate et al. (2024)
c.6710_6711del p.Gln2237ArgfsTer16 frameshift_variant De novo - - 41912808 Natividad Avila, Marina et al. (2026)
c.11079G>T p.Gln3693His missense_variant Familial Both parents Multiplex 39632905 Ashlesha Gogate et al. (2024)
c.2356_2357del p.Gln786AspfsTer92 frameshift_variant Familial Paternal Multiplex 37506195 Cirnigliaro M et al. (2023)
ATCTGAAGTAAGCCTTCAGCGTGCTCACGTTCACTG>A p.? splice_site_variant Familial Paternal Simplex 25961944 Krumm N , et al. (2015)
ACCTGTGGATGCTGAGGAAGTGTCCGTGACAGGAAGACG>A -3680 frameshift_variant Familial Paternal Simplex 25961944 Krumm N , et al. (2015)
GTGTATGCTGAGGAAGTGTCGGTGACAGGAAGAGAGGTGGTGTC>G -2701 frameshift_variant Familial Paternal Simplex 25961944 Krumm N , et al. (2015)
c.3038_3039insGTCACGCCACCCCTCTTCCTGTCACCAC p.Ser1013ArgfsTer50 frameshift_variant De novo - Unknown 41912808 Natividad Avila, Marina et al. (2026)
Common Variants  

No common variants reported.

SFARI Gene score
2

Strong Candidate

De novo missense variants and rare inherited loss-of-function (LoF) variants in the MUC4 gene were identified in ASD probands from the Simons Simplex Collection and the Autism Sequencing Consortium (Iossifov et al., 2012; De Rubeis et al., 2014; Iossifov et al., 2014; Krumm et al., 2015). targeted sequencing of 536 Chinese ASD probands and 1457 Chinese controls in Guo et al., 2017 identified additional rare inherited LoF and damaging missense variants in this gene in ASD probands. Transmission and De Novo Association (TADA) analysis of a combined cohort consisting of Chinese ASD probands and controls, as well as ASD probands and controls from the Simons Simplex Collection and the Autism Sequencing Consortium, identified MUC4 as an ASD candidate gene with a PTADA of 0.000105.

Score Delta: Score remained at 2

2

Strong Candidate

See all Category 2 Genes

We considered a rigorous statistical comparison between cases and controls, yielding genome-wide statistical significance, with independent replication, to be the strongest possible evidence for a gene. These criteria were relaxed slightly for category 2.

4/1/2022
3
icon
2

Decreased from 3 to 2

Description

De novo missense variants and rare inherited loss-of-function (LoF) variants in the MUC4 gene were identified in ASD probands from the Simons Simplex Collection and the Autism Sequencing Consortium (Iossifov et al., 2012; De Rubeis et al., 2014; Iossifov et al., 2014; Krumm et al., 2015). targeted sequencing of 536 Chinese ASD probands and 1457 Chinese controls in Guo et al., 2017 identified additional rare inherited LoF and damaging missense variants in this gene in ASD probands. Transmission and De Novo Association (TADA) analysis of a combined cohort consisting of Chinese ASD probands and controls, as well as ASD probands and controls from the Simons Simplex Collection and the Autism Sequencing Consortium, identified MUC4 as an ASD candidate gene with a PTADA of 0.000105.

10/1/2019
4
icon
3

Decreased from 4 to 3

New Scoring Scheme
Description

De novo missense variants and rare inherited loss-of-function (LoF) variants in the MUC4 gene were identified in ASD probands from the Simons Simplex Collection and the Autism Sequencing Consortium (Iossifov et al., 2012; De Rubeis et al., 2014; Iossifov et al., 2014; Krumm et al., 2015). targeted sequencing of 536 Chinese ASD probands and 1457 Chinese controls in Guo et al., 2017 identified additional rare inherited LoF and damaging missense variants in this gene in ASD probands. Transmission and De Novo Association (TADA) analysis of a combined cohort consisting of Chinese ASD probands and controls, as well as ASD probands and controls from the Simons Simplex Collection and the Autism Sequencing Consortium, identified MUC4 as an ASD candidate gene with a PTADA of 0.000105.

7/1/2019
4
icon
4

Decreased from 4 to 4

Description

De novo missense variants and rare inherited loss-of-function (LoF) variants in the MUC4 gene were identified in ASD probands from the Simons Simplex Collection and the Autism Sequencing Consortium (Iossifov et al., 2012; De Rubeis et al., 2014; Iossifov et al., 2014; Krumm et al., 2015). targeted sequencing of 536 Chinese ASD probands and 1457 Chinese controls in Guo et al., 2017 identified additional rare inherited LoF and damaging missense variants in this gene in ASD probands. Transmission and De Novo Association (TADA) analysis of a combined cohort consisting of Chinese ASD probands and controls, as well as ASD probands and controls from the Simons Simplex Collection and the Autism Sequencing Consortium, identified MUC4 as an ASD candidate gene with a PTADA of 0.000105.

7/1/2017
icon
4

Increased from to 4

Description

De novo missense variants and rare inherited loss-of-function (LoF) variants in the MUC4 gene were identified in ASD probands from the Simons Simplex Collection and the Autism Sequencing Consortium (Iossifov et al., 2012; De Rubeis et al., 2014; Iossifov et al., 2014; Krumm et al., 2015). targeted sequencing of 536 Chinese ASD probands and 1457 Chinese controls in Guo et al., 2017 identified additional rare inherited LoF and damaging missense variants in this gene in ASD probands. Transmission and De Novo Association (TADA) analysis of a combined cohort consisting of Chinese ASD probands and controls, as well as ASD probands and controls from the Simons Simplex Collection and the Autism Sequencing Consortium, identified MUC4 as an ASD candidate gene with a PTADA of 0.000105.

Krishnan Probability Score

Score 0.42769608895581

Ranking 20913/25841 scored genes


[Show Scoring Methodology]
Krishnan and colleagues generated probability scores genome-wide by using a machine learning approach on a human brain-specific gene network. The method was first presented in Nat Neurosci 19, 1454-1462 (2016), and scores for more than 25,000 RefSeq genes can be accessed in column G of supplementary table 3 (see: http://www.nature.com/neuro/journal/v19/n11/extref/nn.4353-S5.xlsx). A searchable browser, with the ability to view networks of associated ASD risk genes, can be found at asd.princeton.edu.
Sanders TADA Score

Score 0.94473503012567

Ranking 16192/18665 scored genes


[Show Scoring Methodology]
The TADA score ('Transmission and De novo Association') was introduced by He et al. PLoS Genet 9(8):e1003671 (2013), and is a statistic that integrates evidence from both de novo and transmitted mutations. It forms the basis for the claim of 65 individual genes being strongly associated with autism risk at a false discovery rate of 0.1 (Sanders et al. Neuron 87, 1215-1233 (2015)). The calculated TADA score for 18,665 RefSeq genes can be found in column P of Supplementary Table 6 in the Sanders et al. paper (the column headed 'tadaFdrAscSscExomeSscAgpSmallDel'), which represents a combined analysis of exome data and small de novo deletions (see www.cell.com/cms/attachment/2038545319/2052606711/mmc7.xlsx).
Zhang D Score

Score -0.016614563597012

Ranking 9227/20870 scored genes


[Show Scoring Methodology]
The DAMAGES score (disease-associated mutation analysis using gene expression signatures), or D score, was developed to combine evidence from de novo loss-of- function mutation with evidence from cell-type- specific gene expression in the mouse brain (specifically translational profiles of 24 specific mouse CNS cell types isolated from 6 different brain regions). Genes with positive D scores are more likely to be associated with autism risk, with higher-confidence genes having higher D scores. This statistic was first presented by Zhang & Shen (Hum Mutat 38, 204- 215 (2017), and D scores for more than 20,000 RefSeq genes can be found in column M in supplementary table 2 from that paper.
CNVs associated with MUC4(1 CNVs)
3q29 72 Deletion-Duplication 107  /  499
Submit New Gene

Report an Error