NCAPH2non-SMC condensin II complex subunit H2
Autism Reports / Total Reports
2 / 2Rare Variants / Common Variants
3 / 0Aliases
NCAPH2, CAPH2Associated Syndromes
-Chromosome Band
22q13.33Associated Disorders
-Relevance to Autism
Integration of familial whole-exome datasets of 3,531 individuals from 1,704 simplex ASD families and 50 multiplex ASD families and expression data from the BrainSpan Atlas of the Developmental Human Brain in Luo et al., 2020 identified a neurodevelopmentally co-regulated, sex-differentially expressed cluster of exons enriched with ASD-segregating deleterious variants in the NCAPH2 gene (Bonferroni-corrected cluster P-value of 4.77E-04).
Molecular Function
This gene encodes one of the non-SMC subunits of the condensin II complex. This complex plays an essential role in mitotic chromosome assembly.
External Links
SFARI Genomic Platforms
Reports related to NCAPH2 (2 Reports)
| # | Type | Title | Author, Year | Autism Report | Associated Disorders |
|---|---|---|---|---|---|
| 1 | Primary | A multidimensional precision medicine approach identifies an autism subtype characterized by dyslipidemia | Luo Y et al. (2020) | Yes | - |
| 2 | Support | - | Yang Sui et al. (2026) | Yes | - |
Rare Variants (3)
| Status | Allele Change | Residue Change | Variant Type | Inheritance Pattern | Parental Transmission | Family Type | PubMed ID | Author, Year |
|---|---|---|---|---|---|---|---|---|
| c.1233+2C>T | - | splice_site_variant | Familial | - | - | 32778826 | Luo Y et al. (2020) | |
| c.1100del | p.Leu367ArgfsTer31 | frameshift_variant | Familial | - | - | 32778826 | Luo Y et al. (2020) | |
| CCCCAGGCCCCGCCTCCTCACCGCCCCGCCCGCCCAATCCGTGGCAGCCCCAAGCCCCGCCTCCTCGGCCCGCCCGCCCGCCCGCGGCAGT>C | - | upstream_gene_variant | Familial | Both parents | Simplex | 41577710 | Yang Sui et al. (2026) |
Common Variants
No common variants reported.
SFARI Gene score
Suggestive Evidence

Score Delta: Score remained at 3
criteria met
See SFARI Gene'scoring criteriaThe literature is replete with relatively small studies of candidate genes, using either common or rare variant approaches, which do not reach the criteria set out for categories 1 and 2. Genes that had two such lines of supporting evidence were placed in category 3, and those with one line of evidence were placed in category 4. Some additional lines of "accessory evidence" (indicated as "acc" in the score cards) could also boost a gene from category 4 to 3.
4/1/2022

Increased from to 3
Krishnan Probability Score
Score 0.44412084850401
Ranking 16195/25841 scored genes
[Show Scoring Methodology]
ExAC Score
Score 0.65283237294792
Ranking 4721/18225 scored genes
[Show Scoring Methodology]
Sanders TADA Score
Score 0.94046245091787
Ranking 14576/18665 scored genes
[Show Scoring Methodology]
Zhang D Score
Score 0.082307195252243
Ranking 6497/20870 scored genes
[Show Scoring Methodology]