Human Gene Module / Chromosome 22 / NCAPH2

NCAPH2non-SMC condensin II complex subunit H2

SFARI Gene Score
3
Suggestive Evidence Criteria 3.1
Autism Reports / Total Reports
2 / 2
Rare Variants / Common Variants
3 / 0
Aliases
NCAPH2, CAPH2
Associated Syndromes
-
Chromosome Band
22q13.33
Associated Disorders
-
Relevance to Autism

Integration of familial whole-exome datasets of 3,531 individuals from 1,704 simplex ASD families and 50 multiplex ASD families and expression data from the BrainSpan Atlas of the Developmental Human Brain in Luo et al., 2020 identified a neurodevelopmentally co-regulated, sex-differentially expressed cluster of exons enriched with ASD-segregating deleterious variants in the NCAPH2 gene (Bonferroni-corrected cluster P-value of 4.77E-04).

Molecular Function

This gene encodes one of the non-SMC subunits of the condensin II complex. This complex plays an essential role in mitotic chromosome assembly.

SFARI Genomic Platforms
Reports related to NCAPH2 (2 Reports)
# Type Title Author, Year Autism Report Associated Disorders
1 Primary A multidimensional precision medicine approach identifies an autism subtype characterized by dyslipidemia Luo Y et al. (2020) Yes -
2 Support - Yang Sui et al. (2026) Yes -
Rare Variants   (3)
Status Allele Change Residue Change Variant Type Inheritance Pattern Parental Transmission Family Type PubMed ID Author, Year
c.1233+2C>T - splice_site_variant Familial - - 32778826 Luo Y et al. (2020)
c.1100del p.Leu367ArgfsTer31 frameshift_variant Familial - - 32778826 Luo Y et al. (2020)
CCCCAGGCCCCGCCTCCTCACCGCCCCGCCCGCCCAATCCGTGGCAGCCCCAAGCCCCGCCTCCTCGGCCCGCCCGCCCGCCCGCGGCAGT>C - upstream_gene_variant Familial Both parents Simplex 41577710 Yang Sui et al. (2026)
Common Variants  

No common variants reported.

SFARI Gene score
3

Suggestive Evidence

Score Delta: Score remained at 3

3

Suggestive Evidence

See all Category 3 Genes

The literature is replete with relatively small studies of candidate genes, using either common or rare variant approaches, which do not reach the criteria set out for categories 1 and 2. Genes that had two such lines of supporting evidence were placed in category 3, and those with one line of evidence were placed in category 4. Some additional lines of "accessory evidence" (indicated as "acc" in the score cards) could also boost a gene from category 4 to 3.

4/1/2022
icon
3

Increased from to 3

Krishnan Probability Score

Score 0.44412084850401

Ranking 16195/25841 scored genes


[Show Scoring Methodology]
Krishnan and colleagues generated probability scores genome-wide by using a machine learning approach on a human brain-specific gene network. The method was first presented in Nat Neurosci 19, 1454-1462 (2016), and scores for more than 25,000 RefSeq genes can be accessed in column G of supplementary table 3 (see: http://www.nature.com/neuro/journal/v19/n11/extref/nn.4353-S5.xlsx). A searchable browser, with the ability to view networks of associated ASD risk genes, can be found at asd.princeton.edu.
ExAC Score

Score 0.65283237294792

Ranking 4721/18225 scored genes


[Show Scoring Methodology]
The Exome Aggregation Consortium (ExAC) is a summary database of 60,706 exomes that has been widely used to estimate 'constraint' on mutation for individual genes. It was introduced by Lek et al. Nature 536, 285-291 (2016), and the ExAC browser can be found at exac.broadinstitute.org. The pLI score was developed as measure of intolerance to loss-of- function mutation. A pLI > 0.9 is generally viewed as highly constrained, and thus any loss-of- function mutations in autism in such a gene would be more likely to confer risk. For a full list of pLI scores see: ftp://ftp.broadinstitute.org/pub/ExAC_release/release0.3.1/functional_gene_constraint/fordist_cle aned_exac_nonTCGA_z_pli_rec_null_data.txt
Sanders TADA Score

Score 0.94046245091787

Ranking 14576/18665 scored genes


[Show Scoring Methodology]
The TADA score ('Transmission and De novo Association') was introduced by He et al. PLoS Genet 9(8):e1003671 (2013), and is a statistic that integrates evidence from both de novo and transmitted mutations. It forms the basis for the claim of 65 individual genes being strongly associated with autism risk at a false discovery rate of 0.1 (Sanders et al. Neuron 87, 1215-1233 (2015)). The calculated TADA score for 18,665 RefSeq genes can be found in column P of Supplementary Table 6 in the Sanders et al. paper (the column headed 'tadaFdrAscSscExomeSscAgpSmallDel'), which represents a combined analysis of exome data and small de novo deletions (see www.cell.com/cms/attachment/2038545319/2052606711/mmc7.xlsx).
Zhang D Score

Score 0.082307195252243

Ranking 6497/20870 scored genes


[Show Scoring Methodology]
The DAMAGES score (disease-associated mutation analysis using gene expression signatures), or D score, was developed to combine evidence from de novo loss-of- function mutation with evidence from cell-type- specific gene expression in the mouse brain (specifically translational profiles of 24 specific mouse CNS cell types isolated from 6 different brain regions). Genes with positive D scores are more likely to be associated with autism risk, with higher-confidence genes having higher D scores. This statistic was first presented by Zhang & Shen (Hum Mutat 38, 204- 215 (2017), and D scores for more than 20,000 RefSeq genes can be found in column M in supplementary table 2 from that paper.
Submit New Gene

Report an Error