Human Gene Module / Chromosome 16 / TAOK2

TAOK2TAO kinase 2

SFARI Gene Score
2
Strong Candidate Criteria 2.1
Autism Reports / Total Reports
5 / 9
Rare Variants / Common Variants
24 / 0
Aliases
TAOK2, MAP3K17,  PSK,  PSK1,  PSK1-BETA,  TAO1,  TAO2
Associated Syndromes
-
Chromosome Band
16p11.2
Associated Disorders
-
Relevance to Autism

TAOK2 resides within the 16p11.2 microdeletion/microduplication region; deletions and duplications in this region are strongly associated with neurodevelopmental disorders, including ASD. A de novo loss-of-function (LoF) variant in the TAOK2 gene was identified in an ASD proband from a multiplex family in Yuen et al., 2017, while a second LoF variant in this gene was identified in another ASD proband in Lim et al., 2017. Taok2 heterozygous and knockout mice were found to display gene dosage-dependent impairments in cognition, anxiety, and social interaction, as well as dosage-dependent abnormalities in brain size and neural connectivity in multiple regions, deficits in cortical layering, dendrite and synapse formation, and reducted excitatory neurotransmission (Richter et al., 2018). Richter et al., 2018 also reported TAOK2 genetic variants identified by whole-genome and -exome sequencing of over 2600 families with ASD, including two de novo likely gene-disruptive variants [a missense variant (p.Ala135Pro) that was experimentally shown to display reduced kinase activity and alter dendrite growth and spine/synapse development, as well as a splice-site variant] in simplex families. Scharrenberg et al., 2022 showed that overexpression of TAOK2 with ASD-associated variants disrupted neuronal migration in an isoform-specific manner, neurons lacking Taok2 had unstable microtubules with reduced levels of acetylated tubulin and phosphorylated JNK1, mice lacking Taok2 developed gross cortical and cortex layering abnormalities, and acute Taok2 downregulation or Taok2 knockout delayed the migration of upper-layer cortical neurons in mice.

Molecular Function

This gene encodes a serine/threonine protein kinase that is involved in many different processes, including, cell signaling, microtubule organization and stability, and apoptosis.

External Links
Gene CardOpen Targets PlatformgnomAD browserSynGO portalPubMed
Human
Entrez GeneOMIMUniProtHumanBaseVariCarta
Mouse
Entrez GeneMouse Genome InformaticsAllen Brain Atlas
Fruit fly
Entrez Gene
SFARI Genomic Platforms
GPF browser SFARI genome browser
Reports related to TAOK2 (9 Reports)
# Type Title Author, Year Autism Report Associated Disorders
1 Support Autism spectrum disorder susceptibility gene TAOK2 affects basal dendrite formation in the neocortex de Anda FC , et al. (2012) No -
2 Support TAOK2 Kinase Mediates PSD95 Stability and Dendritic Spine Maturation through Septin7 Phosphorylation Yadav S , et al. (2017) No -
3 Primary Whole genome sequencing resource identifies 18 new candidate genes for autism spectrum disorder C Yuen RK et al. (2017) Yes -
4 Support Rates, distribution and implications of postzygotic mosaic mutations in autism spectrum disorder Lim ET , et al. (2017) Yes -
5 Recent Recommendation Altered TAOK2 activity causes autism-related neurodevelopmental and cognitive abnormalities through RhoA signaling Richter M , et al. (2018) Yes -
6 Support Conserved Tao Kinase Activity Regulates Dendritic Arborization, Cytoskeletal Dynamics, and Sensory Function in Drosophila Hu C et al. (2020) Yes -
7 Support - Nourbakhsh K et al. (2021) No -
8 Recent Recommendation - Scharrenberg R et al. (2022) Yes -
9 Support - Melad Henis et al. (2024) No -
Rare Variants   (24)
Status Allele Change Residue Change Variant Type Inheritance Pattern Parental Transmission Family Type PubMed ID Author, Year
- - missense_variant Unknown - - 29467497 Richter M , et al. (2018)
- - missense_variant Familial Maternal - 29467497 Richter M , et al. (2018)
- - missense_variant Familial Paternal - 29467497 Richter M , et al. (2018)
- - missense_variant Unknown Not maternal - 29467497 Richter M , et al. (2018)
c.1162G>T p.Glu388Ter stop_gained De novo - Simplex 28714951 Lim ET , et al. (2017)
c.2233-66G>A - missense_variant Familial Paternal - 29467497 Richter M , et al. (2018)
c.2233-96C>T - missense_variant Familial Paternal - 29467497 Richter M , et al. (2018)
c.1864C>T p.Gln622Ter stop_gained Unknown - Simplex 29467497 Richter M , et al. (2018)
c.403G>C p.Ala135Pro missense_variant De novo - Simplex 29467497 Richter M , et al. (2018)
c.563+12_563+15del - splice_site_variant De novo - Simplex 29467497 Richter M , et al. (2018)
c.1004C>T p.Ala335Val missense_variant Familial Paternal - 29467497 Richter M , et al. (2018)
c.2342A>G p.Glu781Gly missense_variant Familial Maternal - 29467497 Richter M , et al. (2018)
c.2474G>A p.Cys825Tyr missense_variant Familial Paternal - 29467497 Richter M , et al. (2018)
c.2609G>A p.Trp870Ter missense_variant Familial Maternal - 29467497 Richter M , et al. (2018)
c.2987G>A p.Arg996Gln missense_variant Familial Maternal - 29467497 Richter M , et al. (2018)
c.2512C>A p.Leu838Ile missense_variant Familial Paternal Simplex 29467497 Richter M , et al. (2018)
c.1466G>A p.Arg489Gln missense_variant Familial Paternal Multiplex 29467497 Richter M , et al. (2018)
c.3001C>G p.Leu1001Val missense_variant Familial Maternal Multiplex 29467497 Richter M , et al. (2018)
c.3046G>A p.Val1016Ile missense_variant Familial Maternal Multiplex 29467497 Richter M , et al. (2018)
c.3337C>T p.Arg1113Cys missense_variant Familial Maternal Multiplex 29467497 Richter M , et al. (2018)
c.3355C>A p.Pro1119Thr missense_variant Familial Maternal Multiplex 29467497 Richter M , et al. (2018)
c.1811_1865del p.Thr604SerfsTer45 frameshift_variant Unknown - Simplex 29467497 Richter M , et al. (2018)
c.2749del p.Leu917TrpfsTer3 frameshift_variant Familial Paternal Multiplex 29467497 Richter M , et al. (2018)
TGGGCCCCCCTGCTGCCGCGGTGCCC>T p.Pro1022Ter frameshift_variant De novo - Multiplex 28263302 C Yuen RK et al. (2017)
Common Variants  

No common variants reported.

SFARI Gene score
2

Strong Candidate

TAOK2 resides within the 16p11.2 microdeletion/microduplication region; deletions and duplications in this region are strongly associated with neurodevelopmental disorders, including ASD. A de novo loss-of-function (LoF) variant in the TAOK2 gene was identified in an ASD proband from a multiplex family in Yuen et al., 2017, while a second LoF variant in this gene was identified in another ASD proband in Lim et al., 2017. Taok2 heterozygous and knockout mice were found to display gene dosage-dependent impairments in cognition, anxiety, and social interaction, as well as dosage-dependent abnormalities in brain size and neural connectivity in multiple regions, deficits in cortical layering, dendrite and synapse formation, and reducted excitatory neurotransmission (Richter et al., 2018). Richter et al., 2018 also reported TAOK2 genetic variants identified by whole-genome and -exome sequencing of over 2600 families with ASD, including two de novo likely gene-disruptive variants [a missense variant (p.Ala135Pro) that was experimentally shown to display reduced kinase activity and alter dendrite growth and spine/synapse development, as well as a splice-site variant] in simplex families.

Score Delta: Score remained at 2

criteria met
See SFARI Gene'scoring criteria
2

Strong Candidate

See all Category 2 Genes

We considered a rigorous statistical comparison between cases and controls, yielding genome-wide statistical significance, with independent replication, to be the strongest possible evidence for a gene. These criteria were relaxed slightly for category 2.

4/1/2020
2
icon
2

Score remained at 2

Description

TAOK2 resides within the 16p11.2 microdeletion/microduplication region; deletions and duplications in this region are strongly associated with neurodevelopmental disorders, including ASD. A de novo loss-of-function (LoF) variant in the TAOK2 gene was identified in an ASD proband from a multiplex family in Yuen et al., 2017, while a second LoF variant in this gene was identified in another ASD proband in Lim et al., 2017. Taok2 heterozygous and knockout mice were found to display gene dosage-dependent impairments in cognition, anxiety, and social interaction, as well as dosage-dependent abnormalities in brain size and neural connectivity in multiple regions, deficits in cortical layering, dendrite and synapse formation, and reducted excitatory neurotransmission (Richter et al., 2018). Richter et al., 2018 also reported TAOK2 genetic variants identified by whole-genome and -exome sequencing of over 2600 families with ASD, including two de novo likely gene-disruptive variants [a missense variant (p.Ala135Pro) that was experimentally shown to display reduced kinase activity and alter dendrite growth and spine/synapse development, as well as a splice-site variant] in simplex families.

Reports Added
[Conserved Tao Kinase Activity Regulates Dendritic Arborization, Cytoskeletal Dynamics, and Sensory Function in Drosophila2020]
10/1/2019
2
icon
2

Score remained at 2

New Scoring Scheme
Description

TAOK2 resides within the 16p11.2 microdeletion/microduplication region; deletions and duplications in this region are strongly associated with neurodevelopmental disorders, including ASD. A de novo loss-of-function (LoF) variant in the TAOK2 gene was identified in an ASD proband from a multiplex family in Yuen et al., 2017, while a second LoF variant in this gene was identified in another ASD proband in Lim et al., 2017. Taok2 heterozygous and knockout mice were found to display gene dosage-dependent impairments in cognition, anxiety, and social interaction, as well as dosage-dependent abnormalities in brain size and neural connectivity in multiple regions, deficits in cortical layering, dendrite and synapse formation, and reducted excitatory neurotransmission (Richter et al., 2018). Richter et al., 2018 also reported TAOK2 genetic variants identified by whole-genome and -exome sequencing of over 2600 families with ASD, including two de novo likely gene-disruptive variants [a missense variant (p.Ala135Pro) that was experimentally shown to display reduced kinase activity and alter dendrite growth and spine/synapse development, as well as a splice-site variant] in simplex families.

Reports Added
[New Scoring Scheme]
7/1/2018
icon
2

Increased from to 2

Description

TAOK2 resides within the 16p11.2 microdeletion/microduplication region; deletions and duplications in this region are strongly associated with neurodevelopmental disorders, including ASD. A de novo loss-of-function (LoF) variant in the TAOK2 gene was identified in an ASD proband from a multiplex family in Yuen et al., 2017, while a second LoF variant in this gene was identified in another ASD proband in Lim et al., 2017. Taok2 heterozygous and knockout mice were found to display gene dosage-dependent impairments in cognition, anxiety, and social interaction, as well as dosage-dependent abnormalities in brain size and neural connectivity in multiple regions, deficits in cortical layering, dendrite and synapse formation, and reducted excitatory neurotransmission (Richter et al., 2018). Richter et al., 2018 also reported TAOK2 genetic variants identified by whole-genome and -exome sequencing of over 2600 families with ASD, including two de novo likely gene-disruptive variants [a missense variant (p.Ala135Pro) that was experimentally shown to display reduced kinase activity and alter dendrite growth and spine/synapse development, as well as a splice-site variant] in simplex families.

Krishnan Probability Score

Score 0.49687196905248

Ranking 2490/25841 scored genes


[Show Scoring Methodology]
Krishnan and colleagues generated probability scores genome-wide by using a machine learning approach on a human brain-specific gene network. The method was first presented in Nat Neurosci 19, 1454-1462 (2016), and scores for more than 25,000 RefSeq genes can be accessed in column G of supplementary table 3 (see: http://www.nature.com/neuro/journal/v19/n11/extref/nn.4353-S5.xlsx). A searchable browser, with the ability to view networks of associated ASD risk genes, can be found at asd.princeton.edu.
Original Source
ExAC Score

Score 0.99876449235246

Ranking 1118/18225 scored genes


[Show Scoring Methodology]
The Exome Aggregation Consortium (ExAC) is a summary database of 60,706 exomes that has been widely used to estimate 'constraint' on mutation for individual genes. It was introduced by Lek et al. Nature 536, 285-291 (2016), and the ExAC browser can be found at exac.broadinstitute.org. The pLI score was developed as measure of intolerance to loss-of- function mutation. A pLI > 0.9 is generally viewed as highly constrained, and thus any loss-of- function mutations in autism in such a gene would be more likely to confer risk. For a full list of pLI scores see: ftp://ftp.broadinstitute.org/pub/ExAC_release/release0.3.1/functional_gene_constraint/fordist_cle aned_exac_nonTCGA_z_pli_rec_null_data.txt
Original Source
Sanders TADA Score

Score 0.94809866518809

Ranking 17545/18665 scored genes


[Show Scoring Methodology]
The TADA score ('Transmission and De novo Association') was introduced by He et al. PLoS Genet 9(8):e1003671 (2013), and is a statistic that integrates evidence from both de novo and transmitted mutations. It forms the basis for the claim of 65 individual genes being strongly associated with autism risk at a false discovery rate of 0.1 (Sanders et al. Neuron 87, 1215-1233 (2015)). The calculated TADA score for 18,665 RefSeq genes can be found in column P of Supplementary Table 6 in the Sanders et al. paper (the column headed 'tadaFdrAscSscExomeSscAgpSmallDel'), which represents a combined analysis of exome data and small de novo deletions (see www.cell.com/cms/attachment/2038545319/2052606711/mmc7.xlsx).
Original Source
Zhang D Score

Score 0.16211617433633

Ranking 4938/20870 scored genes


[Show Scoring Methodology]
The DAMAGES score (disease-associated mutation analysis using gene expression signatures), or D score, was developed to combine evidence from de novo loss-of- function mutation with evidence from cell-type- specific gene expression in the mouse brain (specifically translational profiles of 24 specific mouse CNS cell types isolated from 6 different brain regions). Genes with positive D scores are more likely to be associated with autism risk, with higher-confidence genes having higher D scores. This statistic was first presented by Zhang & Shen (Hum Mutat 38, 204- 215 (2017), and D scores for more than 20,000 RefSeq genes can be found in column M in supplementary table 2 from that paper.
Original Source
CNVs associated with TAOK2(1 CNVs)
Sort By:
16p11.2 145 Deletion-Duplication 212  /  1657
Submit New Gene

Report an Error