Human Gene Module / Chromosome 16 / TSC2

TSC2tuberous sclerosis 2

Score
3S
Suggestive Evidence, Syndromic Criteria 3.1, Syndromic
Autism Reports / Total Reports
13 / 29
Rare Variants / Common Variants
70 / 1
Aliases
TSC2, LAM,  TSC4,  FLJ43106
Associated Syndromes
-
Genetic Category
Rare Single Gene Mutation, Syndromic, Genetic Association
Chromosome Band
16p13.3
Associated Disorders
ASD, ID, EPS, DD/NDD
Relevance to Autism

This gene has been associated with syndromic autism, where a subpopulation of individuals with a given syndrome develop autism. In particular, genetic association has been found between autism and tuberous sclerosis (and hence the TSC1 and TSC2 genes as well). As well, association with TSC2 and autism has been found in an AGRE cohort (Serajee et al., 2003), and a rare mutation in TSC2 has been identified in an individual with ASD (ORoak et al., 2012).

Molecular Function

The product of this gene is believed to be a tumor suppressor and is able to stimulate specific GTPases.

Reports related to TSC2 (29 Reports)
# Type Title Author, Year Autism Report Associated Disorders
1 Highly Cited Tsc tumour suppressor proteins antagonize amino-acid-TOR signalling. Gao X , et al. (2002) No -
2 Positive Association Association of INPP1, PIK3CG, and TSC2 gene variants with autistic disorder: implications for phosphatidylinositol signalling in autism. Serajee FJ , et al. (2003) Yes -
3 Recent Recommendation Neuroepileptic correlates of autistic symptomatology in tuberous sclerosis. Bolton PF (2004) No -
4 Recent Recommendation Regulation of neuronal morphology and function by the tumor suppressors Tsc1 and Tsc2. Tavazoie SF , et al. (2005) No -
5 Recent Recommendation Reversal of learning deficits in a Tsc2 mouse model of tuberous sclerosis. Ehninger D , et al. (2008) No -
6 Recent Recommendation Tuberous sclerosis complex proteins control axon formation. Choi YJ , et al. (2008) No -
7 Recent Recommendation ARD1 stabilization of TSC2 suppresses tumorigenesis through the mTOR signaling pathway. Kuo HP , et al. (2010) No -
8 Support Oligogenic heterozygosity in individuals with high-functioning autism spectrum disorders. Schaaf CP , et al. (2011) Yes -
9 Support Sporadic autism exomes reveal a highly interconnected protein network of de novo mutations. O'Roak BJ , et al. (2012) Yes -
10 Support High-throughput sequencing of mGluR signaling pathway genes reveals enrichment of rare variants in autism. Kelleher RJ 3rd , et al. (2012) Yes -
11 Negative Association Lack of association of rare functional variants in TSC1/TSC2 genes with autism spectrum disorder. Bahl S , et al. (2013) Yes -
12 Support Performance comparison of bench-top next generation sequencers using microdroplet PCR-based enrichment for targeted sequencing in patients with aut... Koshimizu E , et al. (2013) Yes ID, epilepsy
13 Recent Recommendation Identification of regions critical for the integrity of the TSC1-TSC2-TBC1D7 complex. Santiago Lima AJ , et al. (2014) No -
14 Recent Recommendation Loss of mTOR-dependent macroautophagy causes autistic-like synaptic pruning deficits. Tang G , et al. (2014) No -
15 Support Excess of rare, inherited truncating mutations in autism. Krumm N , et al. (2015) Yes -
16 Recent Recommendation Low load for disruptive mutations in autism genes and their biased transmission. Iossifov I , et al. (2015) Yes -
17 Support Next-generation sequencing using a pre-designed gene panel for the molecular diagnosis of congenital disorders in pediatric patients. Lim EC , et al. (2015) No MCAs
18 Support Everolimus improves neuropsychiatric symptoms in a patient with tuberous sclerosis carrying a novel TSC2 mutation. Hwang SK , et al. (2016) No ASD, DD, epilepsy
19 Support De novo genic mutations among a Chinese autism spectrum disorder cohort. Wang T , et al. (2016) Yes -
20 Support Targeted sequencing identifies 91 neurodevelopmental-disorder risk genes with autism and developmental-disability biases. Stessman HA , et al. (2017) Yes -
21 Support Somatic Mutations in TSC1 and TSC2 Cause Focal Cortical Dysplasia. Lim JS , et al. (2017) No -
22 Recent Recommendation Genetic testing including targeted gene panel in a diverse clinical population of children with autism spectrum disorder: Findings and implications. Kalsner L , et al. (2017) Yes -
23 Support Diagnostic exome sequencing of syndromic epilepsy patients in clinical practice. Tumien B , et al. (2017) No DD, specific learning disability
24 Recent Recommendation Purkinje cells derived from TSC patients display hypoexcitability and synaptic deficits associated with reduced FMRP levels and reversed by rapamycin. Sundberg M , et al. (2018) No -
25 Recent Recommendation Regionally specific TSC1 and TSC2 gene expression in tuberous sclerosis complex. Li Y , et al. (2018) No -
26 Support Targeted resequencing of 358 candidate genes for autism spectrum disorder in a Chinese cohort reveals diagnostic potential and genotype-phenotype c... Zhou WZ , et al. (2019) Yes -
27 Support Neurological Diseases With Autism Spectrum Disorder: Role of ASD Risk Genes. Xiong J , et al. (2019) Yes Tuberous sclerosis complex, epilepsy/seizures
28 Highly Cited Interaction between hamartin and tuberin, the TSC1 and TSC2 gene products. van Slegtenhorst M , et al. (1998) No -
29 Primary Autism and tuberous sclerosis. Smalley SL (1998) No ASD
Rare Variants   (70)
Status Allele Change Residue Change Variant Type Inheritance Pattern Parental Transmission Family Type PubMed ID Author, Year
N/A N/A - - - - 9813776 Smalley SL (1998)
A>G - missense_variant De novo - - 29271092 Kalsner L , et al. (2017)
A>G - missense_variant Unknown - - 29271092 Kalsner L , et al. (2017)
G>A - missense_variant Unknown - - 29271092 Kalsner L , et al. (2017)
CCTT>C - inframe_deletion Unknown - - 29271092 Kalsner L , et al. (2017)
c.4639G>A p.Val1547Ile missense_variant - - - 28215400 Lim JS , et al. (2017)
C>T - missense_variant Familial Paternal - 29271092 Kalsner L , et al. (2017)
G>A - missense_variant Familial Maternal - 29271092 Kalsner L , et al. (2017)
G>A - missense_variant Familial Paternal - 29271092 Kalsner L , et al. (2017)
G>C - missense_variant Familial Paternal - 29271092 Kalsner L , et al. (2017)
G>T - missense_variant Familial Maternal - 29271092 Kalsner L , et al. (2017)
T>C - missense_variant Familial Maternal - 29271092 Kalsner L , et al. (2017)
CCTT>C - inframe_deletion Familial Maternal - 29271092 Kalsner L , et al. (2017)
c.4662+1G>A p.? splice_site_variant De novo - - 29286531 Tumien B , et al. (2017)
c.2377G>A p.Glu793Lys missense_variant De novo - - 27824329 Wang T , et al. (2016)
c.1839+6G>A - intron_variant - - Multiplex 22558107 Kelleher RJ 3rd , et al. (2012)
c.5069-8C>T - intron_variant - - Multiplex 22558107 Kelleher RJ 3rd , et al. (2012)
c.5467A>T p.Lys1823Ter stop_gained De novo - - 28191889 Stessman HA , et al. (2017)
c.*5G>A - 3_prime_UTR_variant - - Multiplex 22558107 Kelleher RJ 3rd , et al. (2012)
c.*26G>A - 3_prime_UTR_variant - - Multiplex 22558107 Kelleher RJ 3rd , et al. (2012)
c.618C>T p.(=) synonymous_variant - - Multiplex 22558107 Kelleher RJ 3rd , et al. (2012)
c.1143G>A p.(=) synonymous_variant - - Multiplex 22558107 Kelleher RJ 3rd , et al. (2012)
c.3126G>T p.(=) synonymous_variant - - Multiplex 22558107 Kelleher RJ 3rd , et al. (2012)
c.4341C>T p.(=) synonymous_variant - - Multiplex 22558107 Kelleher RJ 3rd , et al. (2012)
c.5028G>A p.(=) synonymous_variant - - Multiplex 22558107 Kelleher RJ 3rd , et al. (2012)
c.5175G>A p.(=) synonymous_variant - - Multiplex 22558107 Kelleher RJ 3rd , et al. (2012)
c.4753_4763del p.Lys1585fs frameshift_variant De novo - - 30763456 Zhou WZ , et al. (2019)
c.1643G>T p.Arg548Met missense_variant De novo - Simplex 25961944 Krumm N , et al. (2015)
c.148A>G p.Met50Val missense_variant Unknown - Simplex 21624971 Schaaf CP , et al. (2011)
c.1939G>A p.Asp647Asn missense_variant Familial Paternal - 27824329 Wang T , et al. (2016)
c.3100G>A p.Val1034Ile missense_variant Familial Maternal - 27824329 Wang T , et al. (2016)
c.1081C>G p.Leu361Val missense_variant Familial Maternal - 30763456 Zhou WZ , et al. (2019)
c.1864C>T p.Arg622Trp missense_variant Familial Paternal - 31031587 Xiong J , et al. (2019)
c.886G>A p.Val296Met missense_variant Familial Paternal - 29286531 Tumien B , et al. (2017)
c.1378G>A p.Ala460Thr missense_variant Unknown - Simplex 21624971 Schaaf CP , et al. (2011)
c.1609C>T p.Arg537Cys missense_variant Unknown - Simplex 21624971 Schaaf CP , et al. (2011)
c.1816A>G p.Ile606Val missense_variant Unknown - Simplex 21624971 Schaaf CP , et al. (2011)
c.2712C>G p.Phe904Leu missense_variant Unknown - Simplex 21624971 Schaaf CP , et al. (2011)
c.433G>A p.Ala145Thr missense_variant - - Multiplex 22558107 Kelleher RJ 3rd , et al. (2012)
c.3161C>T p.Pro1054Leu missense_variant Unknown - Simplex 21624971 Schaaf CP , et al. (2011)
c.3905G>A p.Arg1302Gln missense_variant Unknown - Simplex 21624971 Schaaf CP , et al. (2011)
c.4273G>A p.Gly1425Arg missense_variant Unknown - Simplex 21624971 Schaaf CP , et al. (2011)
c.4738C>T p.Arg1580Trp missense_variant De novo - Simplex 22495309 O'Roak BJ , et al. (2012)
c.1292C>T p.Ala431Val missense_variant - - Multiplex 22558107 Kelleher RJ 3rd , et al. (2012)
c.1912G>A p.Val638Met missense_variant - - Multiplex 22558107 Kelleher RJ 3rd , et al. (2012)
c.2155T>C p.Tyr719His missense_variant - - Multiplex 22558107 Kelleher RJ 3rd , et al. (2012)
c.2621C>T p.Pro874Leu missense_variant - - Multiplex 22558107 Kelleher RJ 3rd , et al. (2012)
c.2032G>A p.Ala678Thr missense_variant Unknown - Unknown 24066114 Koshimizu E , et al. (2013)
c.3252C>G p.Asp1084Glu missense_variant - - Multiplex 22558107 Kelleher RJ 3rd , et al. (2012)
c.3827C>T p.Ser1276Phe missense_variant - - Multiplex 22558107 Kelleher RJ 3rd , et al. (2012)
c.3914C>T p.Pro1305Leu missense_variant - - Multiplex 22558107 Kelleher RJ 3rd , et al. (2012)
c.3974G>A p.Gly1325Asp missense_variant - - Multiplex 22558107 Kelleher RJ 3rd , et al. (2012)
c.4051G>A p.Glu1351Lys missense_variant - - Multiplex 22558107 Kelleher RJ 3rd , et al. (2012)
c.4316G>A p.Gly1439Asp missense_variant - - Multiplex 22558107 Kelleher RJ 3rd , et al. (2012)
c.4460C>G p.Ser1487Cys missense_variant - - Multiplex 22558107 Kelleher RJ 3rd , et al. (2012)
c.190A>G p.Ile64Val missense_variant Familial Paternal Simplex 23514105 Bahl S , et al. (2013)
c.454C>G p.His152Asp missense_variant Familial Maternal Simplex 23514105 Bahl S , et al. (2013)
c.1597A>C p.Lys533Gln missense_variant Familial Maternal Simplex 23514105 Bahl S , et al. (2013)
c.2861A>G p.Lys954Arg missense_variant Familial Paternal Simplex 23514105 Bahl S , et al. (2013)
c.2950G>C p.Glu984Gln missense_variant Familial Paternal Simplex 23514105 Bahl S , et al. (2013)
c.3364delC p.Arg1121ValfsTer69 frameshift_variant Unknown - Unknown 26666243 Lim EC , et al. (2015)
c.1597A>C p.Lys533Gln missense_variant Familial Maternal Simplex 21624971 Schaaf CP , et al. (2011)
c.2950G>C p.Glu984Gln missense_variant Familial Paternal Simplex 21624971 Schaaf CP , et al. (2011)
c.3290C>T p.Ala1097Val missense_variant Familial Paternal Simplex 21624971 Schaaf CP , et al. (2011)
c.5094C>A p.Ser1698Arg missense_variant Familial Maternal Simplex 21624971 Schaaf CP , et al. (2011)
c.4285G>T p.Ala1429Ser missense_variant Familial Both parents Simplex 23514105 Bahl S , et al. (2013)
C>CCAGCGGGTAGGGAATATGGGGCTCCCT - inframe_insertion Familial Paternal - 29271092 Kalsner L , et al. (2017)
c.700_701del p.Glu234fs frameshift_variant Familial - Multi-generational 27216612 Hwang SK , et al. (2016)
c.3845_3853delGCTGCCAAG p.1282_1285del inframe_deletion De novo - Simplex 21624971 Schaaf CP , et al. (2011)
c.2032G>A p.Ala678Thr missense_variant Familial (1 case); unknown (1 case) Maternal (1 case) Simplex 21624971 Schaaf CP , et al. (2011)
Common Variants   (1)
Status Allele Change Residue Change Variant Type Inheritance Pattern Paternal Transmission Family Type PubMed ID Author, Year
c.482-348A>G;c.755-348A>G;c.644-348A>G;c.551-348A>G C/T intron_variant - - - 14627686 Serajee FJ , et al. (2003)
SFARI Gene score
3S

Suggestive Evidence, Syndromic

3S

Score Delta: Increased from S to 3 + S

3

Suggestive Evidence

See all Category 3 Genes

The literature is replete with relatively small studies of candidate genes, using either common or rare variant approaches, which do not reach the criteria set out for categories 1 and 2. Genes that had two such lines of supporting evidence were placed in category 3, and those with one line of evidence were placed in category 4. Some additional lines of "accessory evidence" (indicated as "acc" in the score cards) could also boost a gene from category 4 to 3.

The syndromic category includes mutations that are associated with a substantial degree of increased risk and consistently linked to additional characteristics not required for an ASD diagnosis. If there is independent evidence implicating a gene in idiopathic ASD, it will be listed as "#S" (e.g., 2S, 3S, etc.). If there is no such independent evidence, the gene will be listed simply as "S."

1/1/2017
S
icon
S

Increased from S to S

Description

Mutations in TSC2 cause the autosomal dominant disorder tuberous sclerosis (TSC). About 25% of individuals with TSC have autism and 40%-50% meet diagnostic criteria within the autistic spectrum disorders.

10/1/2016
S
icon
S

Increased from S to S

Description

Mutations in TSC2 cause the autosomal dominant disorder tuberous sclerosis (TSC). About 25% of individuals with TSC have autism and 40%-50% meet diagnostic criteria within the autistic spectrum disorders.

4/1/2016
S
icon
S

Increased from S to S

Description

Mutations in TSC2 cause the autosomal dominant disorder tuberous sclerosis (TSC). About 25% of individuals with TSC have autism and 40%-50% meet diagnostic criteria within the autistic spectrum disorders.

Reports Added
[Association of INPP1, PIK3CG, and TSC2 gene variants with autistic disorder: implications for phosphatidylinositol signalling in autism.2003] [Oligogenic heterozygosity in individuals with high-functioning autism spectrum disorders.2011] [Sporadic autism exomes reveal a highly interconnected protein network of de novo mutations.2012] [Lack of association of rare functional variants in TSC1/TSC2 genes with autism spectrum disorder.2013] [Performance comparison of bench-top next generation sequencers using microdroplet PCR-based enrichment for targeted sequencing in patients with aut...2013] [High-throughput sequencing of mGluR signaling pathway genes reveals enrichment of rare variants in autism.2012] [Autism and tuberous sclerosis.1998] [Interaction between hamartin and tuberin, the TSC1 and TSC2 gene products.1998] [Tsc tumour suppressor proteins antagonize amino-acid-TOR signalling.2002] [Neuroepileptic correlates of autistic symptomatology in tuberous sclerosis.2004] [Regulation of neuronal morphology and function by the tumor suppressors Tsc1 and Tsc2.2005] [Reversal of learning deficits in a Tsc2 mouse model of tuberous sclerosis.2008] [Tuberous sclerosis complex proteins control axon formation.2008] [ARD1 stabilization of TSC2 suppresses tumorigenesis through the mTOR signaling pathway.2010] [Identification of regions critical for the integrity of the TSC1-TSC2-TBC1D7 complex.2014] [Loss of mTOR-dependent macroautophagy causes autistic-like synaptic pruning deficits.2014] [Excess of rare, inherited truncating mutations in autism.2015] [Next-generation sequencing using a pre-designed gene panel for the molecular diagnosis of congenital disorders in pediatric patients.2015] [Low load for disruptive mutations in autism genes and their biased transmission.2015] [Everolimus improves neuropsychiatric symptoms in a patient with tuberous sclerosis carrying a novel TSC2 mutation.2016]
1/1/2016
S
icon
S

Increased from S to S

Description

Mutations in TSC2 cause the autosomal dominant disorder tuberous sclerosis (TSC). About 25% of individuals with TSC have autism and 40%-50% meet diagnostic criteria within the autistic spectrum disorders.

Reports Added
[Association of INPP1, PIK3CG, and TSC2 gene variants with autistic disorder: implications for phosphatidylinositol signalling in autism.2003] [Oligogenic heterozygosity in individuals with high-functioning autism spectrum disorders.2011] [Sporadic autism exomes reveal a highly interconnected protein network of de novo mutations.2012] [Lack of association of rare functional variants in TSC1/TSC2 genes with autism spectrum disorder.2013] [Performance comparison of bench-top next generation sequencers using microdroplet PCR-based enrichment for targeted sequencing in patients with aut...2013] [High-throughput sequencing of mGluR signaling pathway genes reveals enrichment of rare variants in autism.2012] [Autism and tuberous sclerosis.1998] [Interaction between hamartin and tuberin, the TSC1 and TSC2 gene products.1998] [Tsc tumour suppressor proteins antagonize amino-acid-TOR signalling.2002] [Neuroepileptic correlates of autistic symptomatology in tuberous sclerosis.2004] [Regulation of neuronal morphology and function by the tumor suppressors Tsc1 and Tsc2.2005] [Reversal of learning deficits in a Tsc2 mouse model of tuberous sclerosis.2008] [Tuberous sclerosis complex proteins control axon formation.2008] [ARD1 stabilization of TSC2 suppresses tumorigenesis through the mTOR signaling pathway.2010] [Identification of regions critical for the integrity of the TSC1-TSC2-TBC1D7 complex.2014] [Loss of mTOR-dependent macroautophagy causes autistic-like synaptic pruning deficits.2014] [Excess of rare, inherited truncating mutations in autism.2015] [Next-generation sequencing using a pre-designed gene panel for the molecular diagnosis of congenital disorders in pediatric patients.2015] [Low load for disruptive mutations in autism genes and their biased transmission.2015]
4/1/2015
S
icon
S

Increased from S to S

Description

Mutations in TSC2 cause the autosomal dominant disorder tuberous sclerosis (TSC). About 25% of individuals with TSC have autism and 40%-50% meet diagnostic criteria within the autistic spectrum disorders.

7/1/2014
No data
icon
S

Increased from No data to S

Description

Mutations in TSC2 cause the autosomal dominant disorder tuberous sclerosis (TSC). About 25% of individuals with TSC have autism and 40%-50% meet diagnostic criteria within the autistic spectrum disorders.

Reports Added
[Interaction between hamartin and tuberin, the TSC1 and TSC2 gene products.1998] [Autism and tuberous sclerosis.1998] [Tsc tumour suppressor proteins antagonize amino-acid-TOR signalling.2002] [Association of INPP1, PIK3CG, and TSC2 gene variants with autistic disorder: implications for phosphatidylinositol signalling in autism.2003] [Neuroepileptic correlates of autistic symptomatology in tuberous sclerosis.2004] [Regulation of neuronal morphology and function by the tumor suppressors Tsc1 and Tsc2.2005] [Reversal of learning deficits in a Tsc2 mouse model of tuberous sclerosis.2008] [Tuberous sclerosis complex proteins control axon formation.2008] [ARD1 stabilization of TSC2 suppresses tumorigenesis through the mTOR signaling pathway.2010] [Oligogenic heterozygosity in individuals with high-functioning autism spectrum disorders.2011] [Sporadic autism exomes reveal a highly interconnected protein network of de novo mutations.2012] [High-throughput sequencing of mGluR signaling pathway genes reveals enrichment of rare variants in autism.2012] [Lack of association of rare functional variants in TSC1/TSC2 genes with autism spectrum disorder.2013] [Performance comparison of bench-top next generation sequencers using microdroplet PCR-based enrichment for targeted sequencing in patients with aut...2013] [Identification of regions critical for the integrity of the TSC1-TSC2-TBC1D7 complex.2014] [Loss of mTOR-dependent macroautophagy causes autistic-like synaptic pruning deficits.2014]
4/1/2014
No data
icon
S

Increased from No data to S

Description

Mutations in TSC2 cause the autosomal dominant disorder tuberous sclerosis (TSC). About 25% of individuals with TSC have autism and 40%-50% meet diagnostic criteria within the autistic spectrum disorders.

Krishnan Probability Score

Score 0.44870913166388

Ranking 11448/25841 scored genes


[Show Scoring Methodology]
Krishnan and colleagues generated probability scores genome-wide by using a machine learning approach on a human brain-specific gene network. The method was first presented in Nat Neurosci 19, 1454-1462 (2016), and scores for more than 25,000 RefSeq genes can be accessed in column G of supplementary table 3 (see: http://www.nature.com/neuro/journal/v19/n11/extref/nn.4353-S5.xlsx). A searchable browser, with the ability to view networks of associated ASD risk genes, can be found at asd.princeton.edu.
ExAC Score

Score 0.99999998343251

Ranking 149/18225 scored genes


[Show Scoring Methodology]
The Exome Aggregation Consortium (ExAC) is a summary database of 60,706 exomes that has been widely used to estimate 'constraint' on mutation for individual genes. It was introduced by Lek et al. Nature 536, 285-291 (2016), and the ExAC browser can be found at exac.broadinstitute.org. The pLI score was developed as measure of intolerance to loss-of- function mutation. A pLI > 0.9 is generally viewed as highly constrained, and thus any loss-of- function mutations in autism in such a gene would be more likely to confer risk. For a full list of pLI scores see: ftp://ftp.broadinstitute.org/pub/ExAC_release/release0.3.1/functional_gene_constraint/fordist_cle aned_exac_nonTCGA_z_pli_rec_null_data.txt
Iossifov Probability Score

Score 0.965

Ranking 66/239 scored genes


[Show Scoring Methodology]
Supplementary dataset S2 in the paper by Iossifov et al. (PNAS 112, E5600-E5607 (2015)) lists 239 genes with a probability of at least 0.8 of being associated with autism risk (column I). This probability metric combines the evidence from de novo likely-gene- disrupting and missense mutations and assesses it against the background mutation rate in unaffected individuals from the University of Washington’s Exome Variant Sequence database (evs.gs.washington.edu/EVS/). The list of probability scores can be found here: www.pnas.org/lookup/suppl/doi:10.1073/pnas.1516376112/- /DCSupplemental/pnas.1516376112.sd02.xlsx
Sanders TADA Score

Score 0.73326661355522

Ranking 1401/18665 scored genes


[Show Scoring Methodology]
The TADA score ('Transmission and De novo Association') was introduced by He et al. PLoS Genet 9(8):e1003671 (2013), and is a statistic that integrates evidence from both de novo and transmitted mutations. It forms the basis for the claim of 65 individual genes being strongly associated with autism risk at a false discovery rate of 0.1 (Sanders et al. Neuron 87, 1215-1233 (2015)). The calculated TADA score for 18,665 RefSeq genes can be found in column P of Supplementary Table 6 in the Sanders et al. paper (the column headed 'tadaFdrAscSscExomeSscAgpSmallDel'), which represents a combined analysis of exome data and small de novo deletions (see www.cell.com/cms/attachment/2038545319/2052606711/mmc7.xlsx).
Zhang D Score

Score 0.34792152642383

Ranking 2047/20870 scored genes


[Show Scoring Methodology]
The DAMAGES score (disease-associated mutation analysis using gene expression signatures), or D score, was developed to combine evidence from de novo loss-of- function mutation with evidence from cell-type- specific gene expression in the mouse brain (specifically translational profiles of 24 specific mouse CNS cell types isolated from 6 different brain regions). Genes with positive D scores are more likely to be associated with autism risk, with higher-confidence genes having higher D scores. This statistic was first presented by Zhang & Shen (Hum Mutat 38, 204- 215 (2017), and D scores for more than 20,000 RefSeq genes can be found in column M in supplementary table 2 from that paper.
CNVs associated with TSC2(1 CNVs)
16p13.3 47 Deletion-Duplication 73  /  475
Interaction Table
Interactor Symbol Interactor Name Interactor Organism Interactor Type Entrez ID Uniprot ID
4-Sep septin 4 Human Protein Binding 5414 O43236
AMPK AMP-activated protein kinase alpha subunit Fruit Fly Protein Modification 43904 O18645
ATPsynd ATP synthase subunit d, mitochondrial Fruit Fly Direct Regulation 42291 Q24251
CRB3 crumbs homolog 3 (Drosophila) Human Protein Binding 92359 Q9BUF7
PIP4ks Phosphatidylinositol 5-phosphate 4-kinase type-2 gamma Mouse Direct Regulation 117150 Q91XU3
SERPINI1 serpin peptidase inhibitor, clade I (neuroserpin), member 1 Human Protein Binding 5274 Q99574
SPERT spermatid associated Human Protein Binding 220082 Q8NA61
SRCRB4D scavenger receptor cysteine rich domain containing, group B (4 domains) Human Protein Binding 136853 Q8WTU2
Submit New Gene

Report an Error