ZNF626zinc finger protein 626
Autism Reports / Total Reports
3 / 4Rare Variants / Common Variants
16 / 0Aliases
-Associated Syndromes
-Chromosome Band
19p12Associated Disorders
-Relevance to Autism
Rare inherited loss-of-function variants in the ZNF626 gene were observed in ASD probands from the Simons Simplex Collection in Krumm et al., 2015. Transmission and De Novo Association (TADA) analysis of a combined cohort consisting of 536 Chinese ASD probands and 1457 Chinese controls, as well as ASD probands and controls from the Simons Simplex Collection and the Autism Sequencing Consortium, in Guo et al., 2017 identified ZNF626 as an ASD candidate gene with a PTADA of 0.000352.
Molecular Function
May be involved in transcriptional regulation.
External Links
SFARI Genomic Platforms
Reports related to ZNF626 (4 Reports)
# | Type | Title | Author, Year | Autism Report | Associated Disorders |
---|---|---|---|---|---|
1 | Primary | Excess of rare, inherited truncating mutations in autism | Krumm N , et al. (2015) | Yes | - |
2 | Recent Recommendation | Targeted sequencing and functional analysis reveal brain-size-related genes and their networks in autism spectrum disorders | Li J , et al. (2017) | No | - |
3 | Support | - | Zhou X et al. (2022) | Yes | - |
4 | Support | - | Cirnigliaro M et al. (2023) | Yes | - |
Rare Variants (16)
Status | Allele Change | Residue Change | Variant Type | Inheritance Pattern | Parental Transmission | Family Type | PubMed ID | Author, Year |
---|---|---|---|---|---|---|---|---|
c.226+286T>C | - | stop_lost | Familial | - | Simplex | 25961944 | Krumm N , et al. (2015) | |
T>A | p.Lys388Ter | stop_gained | Familial | - | Simplex | 25961944 | Krumm N , et al. (2015) | |
CT>C | -115 | frameshift_variant | Familial | - | Simplex | 25961944 | Krumm N , et al. (2015) | |
A>AT | -233? | frameshift_variant | Familial | - | Simplex | 25961944 | Krumm N , et al. (2015) | |
G>GT | -169? | frameshift_variant | Familial | - | Simplex | 25961944 | Krumm N , et al. (2015) | |
T>TA | -298? | frameshift_variant | Familial | - | Simplex | 25961944 | Krumm N , et al. (2015) | |
TTC>T | -249 | frameshift_variant | Familial | - | Simplex | 25961944 | Krumm N , et al. (2015) | |
c.1479C>T | p.Ser493%3D | synonymous_variant | De novo | - | - | 35982159 | Zhou X et al. (2022) | |
T>TAG | -298? | frameshift_variant | Familial | - | Simplex | 25961944 | Krumm N , et al. (2015) | |
c.679A>T | p.Lys227Ter | stop_gained | Familial | - | Simplex | 25961944 | Krumm N , et al. (2015) | |
G>GGACT | -88S? | frameshift_variant | Familial | - | Simplex | 25961944 | Krumm N , et al. (2015) | |
c.1162A>T | p.Lys388Ter | stop_gained | Familial | - | Simplex | 25961944 | Krumm N , et al. (2015) | |
c.1513G>T | p.Glu505Ter | stop_gained | Familial | - | Simplex | 25961944 | Krumm N , et al. (2015) | |
ATTCTCTCATGTGTAGTAAGG>A | -495 | frameshift_variant | Familial | - | Simplex | 25961944 | Krumm N , et al. (2015) | |
c.347del | p.Gly116AspfsTer3 | frameshift_variant | Familial | Maternal | Multiplex | 37506195 | Cirnigliaro M et al. (2023) | |
TGCCACATTCTTCACATTTGTAGGGTCTCTCTCCAGTATGAATTTTCTTATGTGTAGTAAGGTTAGAGGAGCACTTAAAAGCTTTGCCACATTCTTCACA | -444 | frameshift_variant | Familial | - | Simplex | 25961944 | Krumm N , et al. (2015) |
Common Variants
No common variants reported.
SFARI Gene score
Strong Candidate
Rare inherited loss-of-function variants in the ZNF626 gene were observed in ASD probands from the Simons Simplex Collection in Krumm et al., 2015. Transmission and De Novo Association (TADA) analysis of a combined cohort consisting of 536 Chinese ASD probands and 1457 Chinese controls, as well as ASD probands and controls from the Simons Simplex Collection and the Autism Sequencing Consortium, in Guo et al., 2017 identified ZNF626 as an ASD candidate gene with a PTADA of 0.000352.
Score Delta: Score remained at 2
criteria met
See SFARI Gene'scoring criteriaWe considered a rigorous statistical comparison between cases and controls, yielding genome-wide statistical significance, with independent replication, to be the strongest possible evidence for a gene. These criteria were relaxed slightly for category 2.
4/1/2022
Decreased from 3 to 2
Description
Rare inherited loss-of-function variants in the ZNF626 gene were observed in ASD probands from the Simons Simplex Collection in Krumm et al., 2015. Transmission and De Novo Association (TADA) analysis of a combined cohort consisting of 536 Chinese ASD probands and 1457 Chinese controls, as well as ASD probands and controls from the Simons Simplex Collection and the Autism Sequencing Consortium, in Guo et al., 2017 identified ZNF626 as an ASD candidate gene with a PTADA of 0.000352.
10/1/2019
Decreased from 4 to 3
New Scoring Scheme
Description
Rare inherited loss-of-function variants in the ZNF626 gene were observed in ASD probands from the Simons Simplex Collection in Krumm et al., 2015. Transmission and De Novo Association (TADA) analysis of a combined cohort consisting of 536 Chinese ASD probands and 1457 Chinese controls, as well as ASD probands and controls from the Simons Simplex Collection and the Autism Sequencing Consortium, in Guo et al., 2017 identified ZNF626 as an ASD candidate gene with a PTADA of 0.000352.
Reports Added
[New Scoring Scheme]7/1/2017
Increased from to 4
Description
Rare inherited loss-of-function variants in the ZNF626 gene were observed in ASD probands from the Simons Simplex Collection in Krumm et al., 2015. Transmission and De Novo Association (TADA) analysis of a combined cohort consisting of 536 Chinese ASD probands and 1457 Chinese controls, as well as ASD probands and controls from the Simons Simplex Collection and the Autism Sequencing Consortium, in Guo et al., 2017 identified ZNF626 as an ASD candidate gene with a PTADA of 0.000352.
Krishnan Probability Score
Score 0.4871406011609
Ranking 7047/25841 scored genes
[Show Scoring Methodology]
ExAC Score
Score 2.3449662444854E-7
Ranking 15468/18225 scored genes
[Show Scoring Methodology]
Sanders TADA Score
Score 0.93122022775984
Ranking 11640/18665 scored genes
[Show Scoring Methodology]