Human Gene Module / Chromosome 19 / ZNF626

ZNF626zinc finger protein 626

Suggestive Evidence Criteria 3.1
Autism Reports / Total Reports
1 / 2
Rare Variants / Common Variants
14 / 0
Associated Syndromes
Genetic Category
Rare Single Gene Mutation
Chromosome Band
Associated Disorders
Relevance to Autism

Rare inherited loss-of-function variants in the ZNF626 gene were observed in ASD probands from the Simons Simplex Collection in Krumm et al., 2015. Transmission and De Novo Association (TADA) analysis of a combined cohort consisting of 536 Chinese ASD probands and 1457 Chinese controls, as well as ASD probands and controls from the Simons Simplex Collection and the Autism Sequencing Consortium, in Guo et al., 2017 identified ZNF626 as an ASD candidate gene with a PTADA of 0.000352.

Molecular Function

May be involved in transcriptional regulation.

Reports related to ZNF626 (2 Reports)
# Type Title Author, Year Autism Report Associated Disorders
1 Primary Excess of rare, inherited truncating mutations in autism. Krumm N , et al. (2015) Yes -
2 Recent Recommendation Targeted sequencing and functional analysis reveal brain-size-related genes and their networks in autism spectrum disorders. Li J , et al. (2017) No -
Rare Variants   (14)
Status Allele Change Residue Change Variant Type Inheritance Pattern Parental Transmission Family Type PubMed ID Author, Year
c.226+286T>C - stop_lost Familial - Simplex 25961944 Krumm N , et al. (2015)
T>A p.Lys388Ter stop_gained Familial - Simplex 25961944 Krumm N , et al. (2015)
CT>C -115 frameshift_variant Familial - Simplex 25961944 Krumm N , et al. (2015)
A>AT -233? frameshift_variant Familial - Simplex 25961944 Krumm N , et al. (2015)
G>GT -169? frameshift_variant Familial - Simplex 25961944 Krumm N , et al. (2015)
T>TA -298? frameshift_variant Familial - Simplex 25961944 Krumm N , et al. (2015)
TTC>T -249 frameshift_variant Familial - Simplex 25961944 Krumm N , et al. (2015)
T>TAG -298? frameshift_variant Familial - Simplex 25961944 Krumm N , et al. (2015)
c.679A>T p.Lys227Ter stop_gained Familial - Simplex 25961944 Krumm N , et al. (2015)
G>GGACT -88S? frameshift_variant Familial - Simplex 25961944 Krumm N , et al. (2015)
c.1162A>T p.Lys388Ter stop_gained Familial - Simplex 25961944 Krumm N , et al. (2015)
c.1513G>T p.Glu505Ter stop_gained Familial - Simplex 25961944 Krumm N , et al. (2015)
ATTCTCTCATGTGTAGTAAGG>A -495 frameshift_variant Familial - Simplex 25961944 Krumm N , et al. (2015)
Common Variants  

No common variants reported.

SFARI Gene score

Suggestive Evidence

Rare inherited loss-of-function variants in the ZNF626 gene were observed in ASD probands from the Simons Simplex Collection in Krumm et al., 2015. Transmission and De Novo Association (TADA) analysis of a combined cohort consisting of 536 Chinese ASD probands and 1457 Chinese controls, as well as ASD probands and controls from the Simons Simplex Collection and the Autism Sequencing Consortium, in Guo et al., 2017 identified ZNF626 as an ASD candidate gene with a PTADA of 0.000352.

Score Delta: Score remained at 4


Suggestive Evidence

See all Category 3 Genes

The literature is replete with relatively small studies of candidate genes, using either common or rare variant approaches, which do not reach the criteria set out for categories 1 and 2. Genes that had two such lines of supporting evidence were placed in category 3, and those with one line of evidence were placed in category 4. Some additional lines of "accessory evidence" (indicated as "acc" in the score cards) could also boost a gene from category 4 to 3.


Decreased from 4 to 3

New Scoring Scheme

Rare inherited loss-of-function variants in the ZNF626 gene were observed in ASD probands from the Simons Simplex Collection in Krumm et al., 2015. Transmission and De Novo Association (TADA) analysis of a combined cohort consisting of 536 Chinese ASD probands and 1457 Chinese controls, as well as ASD probands and controls from the Simons Simplex Collection and the Autism Sequencing Consortium, in Guo et al., 2017 identified ZNF626 as an ASD candidate gene with a PTADA of 0.000352.

Reports Added
[New Scoring Scheme]

Increased from to 4


Rare inherited loss-of-function variants in the ZNF626 gene were observed in ASD probands from the Simons Simplex Collection in Krumm et al., 2015. Transmission and De Novo Association (TADA) analysis of a combined cohort consisting of 536 Chinese ASD probands and 1457 Chinese controls, as well as ASD probands and controls from the Simons Simplex Collection and the Autism Sequencing Consortium, in Guo et al., 2017 identified ZNF626 as an ASD candidate gene with a PTADA of 0.000352.

Krishnan Probability Score

Score 0.4871406011609

Ranking 7047/25841 scored genes

[Show Scoring Methodology]
Krishnan and colleagues generated probability scores genome-wide by using a machine learning approach on a human brain-specific gene network. The method was first presented in Nat Neurosci 19, 1454-1462 (2016), and scores for more than 25,000 RefSeq genes can be accessed in column G of supplementary table 3 (see: A searchable browser, with the ability to view networks of associated ASD risk genes, can be found at
ExAC Score

Score 2.3449662444854E-7

Ranking 15468/18225 scored genes

[Show Scoring Methodology]
The Exome Aggregation Consortium (ExAC) is a summary database of 60,706 exomes that has been widely used to estimate 'constraint' on mutation for individual genes. It was introduced by Lek et al. Nature 536, 285-291 (2016), and the ExAC browser can be found at The pLI score was developed as measure of intolerance to loss-of- function mutation. A pLI > 0.9 is generally viewed as highly constrained, and thus any loss-of- function mutations in autism in such a gene would be more likely to confer risk. For a full list of pLI scores see: aned_exac_nonTCGA_z_pli_rec_null_data.txt
Sanders TADA Score

Score 0.93122022775984

Ranking 11640/18665 scored genes

[Show Scoring Methodology]
The TADA score ('Transmission and De novo Association') was introduced by He et al. PLoS Genet 9(8):e1003671 (2013), and is a statistic that integrates evidence from both de novo and transmitted mutations. It forms the basis for the claim of 65 individual genes being strongly associated with autism risk at a false discovery rate of 0.1 (Sanders et al. Neuron 87, 1215-1233 (2015)). The calculated TADA score for 18,665 RefSeq genes can be found in column P of Supplementary Table 6 in the Sanders et al. paper (the column headed 'tadaFdrAscSscExomeSscAgpSmallDel'), which represents a combined analysis of exome data and small de novo deletions (see
Submit New Gene

Report an Error

SFARI Gene Update

We are pleased to announce some changes to the ongoing curation of the data in SFARI Gene. In the context of a continued effort to develop the human gene module and its manually curated list of autism risk genes, we are modifying other aspects of the site to focus on the information that is of greatest interest to the research community. The version of SFARI Gene that has been developed until now will be frozen and will remain available as “SFARI Gene Archive”. Please see the announcement for more details.