MECP2Methyl CpG binding protein 2
Autism Reports / Total Reports
61 / 164Rare Variants / Common Variants
339 / 0Aliases
MECP2, RTS, RTT, PPMX, MRX16, MRX79, AUTSX3, DKFZp686A24160Associated Syndromes
Rett syndrome, Rett syndrome, X-linked intellectual disability, MECP2 duplication syndrome, Atypcial Rett syndrome, ASD, DD, Rett syndrome, ASD, DD, Rett syndrome, DDChromosome Band
Xq28Associated Disorders
SCZ, DD/NDD, ADHD, ID, EP, EPS, ASDGenetic Category
Rare Single Gene Mutation, Syndromic, FunctionalRelevance to Autism
Mutations in the MECP2 gene underlie Rett syndrome, an autism spectrum disorder. Some studies have found that rare variations in the MECP2 gene are associated with autism, while others have looked and found no variants in autistic patients. It appears that EGR2 and MECP2 can regulate each other's expression (Swanberg et al., 2009).
Molecular Function
The encoded protein has methylation-dependent transcriptional repressor activity . It is also involved in regulation of RNA splicing.
External Links
SFARI Genomic Platforms
Reports related to MECP2 (164 Reports)
| # | Type | Title | Author, Year | Autism Report | Associated Disorders |
|---|---|---|---|---|---|
| 1 | Primary | Rett syndrome is caused by mutations in X-linked MECP2, encoding methyl-CpG-binding protein 2 | Amir RE , et al. (1999) | No | - |
| 2 | Support | Preserved speech variant is allelic of classic Rett syndrome | De Bona C , et al. (2000) | No | - |
| 3 | Support | A mutation in the rett syndrome gene, MECP2, causes X-linked mental retardation and progressive spasticity in males | Meloni I , et al. (2000) | No | - |
| 4 | Support | MECP2 mutation in male patients with non-specific X-linked mental retardation | Orrico A , et al. (2000) | No | - |
| 5 | Support | MECP2 is highly mutated in X-linked mental retardation | Couvert P , et al. (2001) | No | - |
| 6 | Negative Association | No mutations in the coding region of the Rett syndrome gene MECP2 in 59 autistic patients | Vourc'h P , et al. (2001) | No | - |
| 7 | Support | In-frame deletion in MECP2 causes mild nonspecific mental retardation | Yntema HG , et al. (2002) | No | - |
| 8 | Support | Neurodevelopmental disorders in males related to the gene causing Rett syndrome in females (MECP2) | Moog U , et al. (2003) | No | - |
| 9 | Support | Study of MECP2 gene in Rett syndrome variants and autistic girls | Zappella M , et al. (2003) | No | ASD |
| 10 | Support | Identification of MeCP2 mutations in a series of females with autistic disorder | Carney RM , et al. (2003) | Yes | - |
| 11 | Support | Chromosome 2 deletion encompassing the MAP2 gene in a patient with autism and Rett-like features | Pescucci C , et al. (2004) | Yes | - |
| 12 | Positive Association | MECP2 structural and 3'-UTR variants in schizophrenia, autism and other psychiatric diseases: a possible association with autism | Shibayama A , et al. (2004) | Yes | SCZ |
| 13 | Support | Submicroscopic duplication in Xq28 causes increased expression of the MECP2 gene in a boy with severe mental retardation and features of Rett syndrome | Meins M , et al. (2005) | No | RTT |
| 14 | Support | A novel familial MECP2 mutation in a young boy: clinical and molecular findings | Ventura P , et al. (2006) | No | Epilepsy |
| 15 | Recent Recommendation | A MECP2 mutation in a highly conserved aminoacid causing mental retardation in a male | Campos M Jr , et al. (2008) | No | - |
| 16 | Recent Recommendation | Genetic modifiers of MeCP2 function in Drosophila | Cukier HN , et al. (2008) | No | - |
| 17 | Recent Recommendation | Deletion of Mecp2 in Sim1-expressing neurons reveals a critical role for MeCP2 in feeding behavior, aggression, and the response to stress | Fyffe SL , et al. (2008) | No | - |
| 18 | Recent Recommendation | MECP2 genomic structure and function: insights from ENCODE | Singh J , et al. (2008) | No | - |
| 19 | Recent Recommendation | Reciprocal co-regulation of EGR2 and MECP2 is disrupted in Rett syndrome and autism | Swanberg SE , et al. (2008) | Yes | - |
| 20 | Recent Recommendation | MeCP2 deficiency disrupts axonal guidance, fasciculation, and targeting by altering Semaphorin 3F function | Degano AL , et al. (2009) | No | - |
| 21 | Recent Recommendation | Neuronal MeCP2 is expressed at near histone-octamer levels and globally alters the chromatin state | Skene PJ , et al. (2010) | No | - |
| 22 | Recent Recommendation | Dysfunction in GABA signalling mediates autism-like stereotypies and Rett syndrome phenotypes | Chao HT , et al. (2010) | No | - |
| 23 | Recent Recommendation | L1 retrotransposition in neurons is modulated by MeCP2 | Muotri AR , et al. (2010) | No | - |
| 24 | Support | A MECP2 missense mutation within the MBD domain in a Brazilian male with autistic disorder | Campos M Jr , et al. (2011) | Yes | - |
| 25 | Support | Oligogenic heterozygosity in individuals with high-functioning autism spectrum disorders | Schaaf CP , et al. (2011) | Yes | - |
| 26 | Recent Recommendation | Genome-wide activity-dependent MeCP2 phosphorylation regulates nervous system development and function | Cohen S , et al. (2011) | No | - |
| 27 | Support | A partial MECP2 duplication in a mildly affected adult male: a putative role for the 3' untranslated region in the MECP2 duplication phenotype | Hanchard NA , et al. (2012) | Yes | ADHD, epilepsy |
| 28 | Support | Range of genetic mutations associated with severe non-syndromic sporadic intellectual disability: an exome sequencing study | Rauch A , et al. (2012) | No | Epilepsy, ASD |
| 29 | Support | The expanding role of MBD genes in autism: identification of a MECP2 duplication and novel alterations in MBD5, MBD6, and SETDB1 | Cukier HN , et al. (2012) | Yes | - |
| 30 | Recent Recommendation | Overexpression of methyl-CpG binding protein 2 impairs T(H)1 responses | Yang T , et al. (2012) | No | - |
| 31 | Recent Recommendation | MeCP2 binds to 5hmC enriched within active genes and accessible chromatin in the nervous system | Melln M , et al. (2012) | No | - |
| 32 | Support | Rare complete knockouts in humans: population distribution and significant role in autism spectrum disorders | Lim ET , et al. (2013) | Yes | - |
| 33 | Support | Using whole-exome sequencing to identify inherited causes of autism | Yu TW , et al. (2013) | Yes | - |
| 34 | Recent Recommendation | Bisphenol A delays the perinatal chloride shift in cortical neurons by epigenetic effects on the Kcc2 promoter | Yeo M , et al. (2013) | No | - |
| 35 | Recent Recommendation | An AT-hook domain in MeCP2 determines the clinical course of Rett syndrome and related disorders | Baker SA , et al. (2013) | No | - |
| 36 | Recent Recommendation | Rett syndrome mutations abolish the interaction of MeCP2 with the NCoR/SMRT co-repressor | Lyst MJ , et al. (2013) | No | - |
| 37 | Recent Recommendation | Activity-dependent phosphorylation of MeCP2 threonine 308 regulates interaction with NCoR | Ebert DH , et al. (2013) | No | - |
| 38 | Recent Recommendation | Transcriptional regulation of the MET receptor tyrosine kinase gene by MeCP2 and sex-specific expression in autism and Rett syndrome | Plummer JT , et al. (2013) | No | - |
| 39 | Recent Recommendation | Oligodendrocyte lineage cells contribute unique features to Rett syndrome neuropathology | Nguyen MV , et al. (2013) | No | - |
| 40 | Recent Recommendation | Increased binding of MeCP2 to the GAD1 and RELN promoters may be mediated by an enrichment of 5-hmC in autism spectrum disorder (ASD) cerebellum | Zhubi A , et al. (2014) | No | - |
| 41 | Support | De novo mutations in schizophrenia implicate chromatin remodeling and support a genetic overlap with autism and intellectual disability | McCarthy SE , et al. (2014) | No | - |
| 42 | Recent Recommendation | GluD1 is a common altered player in neuronal differentiation from both MECP2-mutated and CDKL5-mutated iPS cells | Livide G , et al. (2014) | No | - |
| 43 | Support | Efficient strategy for the molecular diagnosis of intellectual disability using targeted high-throughput sequencing | Redin C , et al. (2014) | No | - |
| 44 | Support | Effectiveness of exome and genome sequencing guided by acuity of illness for diagnosis of neurodevelopmental disorders | Soden SE , et al. (2014) | No | ADHD |
| 45 | Support | Large-scale discovery of novel genetic causes of developmental disorders | Deciphering Developmental Disorders Study (2014) | No | Stereotypic behavior |
| 46 | Support | Mutations in epilepsy and intellectual disability genes in patients with features of Rett syndrome | Olson HE , et al. (2015) | No | Epilepsy |
| 47 | Support | MECP2 missense mutations outside the canonical MBD and TRD domains in males with intellectual disability | Bianciardi L , et al. (2015) | No | ASD |
| 48 | Support | Next-generation sequencing using a pre-designed gene panel for the molecular diagnosis of congenital disorders in pediatric patients | Lim EC , et al. (2015) | No | Developmental regression, hypotonia |
| 49 | Support | Comprehensive molecular testing in patients with high functioning autism spectrum disorder | Alvarez-Mora MI , et al. (2016) | Yes | - |
| 50 | Support | The MECP2 variant c.925C>T (p.Arg309Trp) causes intellectual disability in both males and females without classic features of Rett syndrome | Schnewolf-Greulich B , et al. (2016) | No | Epilepsy/seizures |
| 51 | Support | Identification of Intellectual Disability Genes in Female Patients with a Skewed X-Inactivation Pattern | Fieremans N , et al. (2016) | No | - |
| 52 | Support | Identification of a RAI1-associated disease network through integration of exome sequencing, transcriptomics, and 3D genomics | Loviglio MN , et al. (2016) | No | Behavioral abnormalities (self-injurious, aggressi |
| 53 | Support | De novo genic mutations among a Chinese autism spectrum disorder cohort | Wang T , et al. (2016) | Yes | - |
| 54 | Support | Clinical exome sequencing: results from 2819 samples reflecting 1000 families | Trujillano D , et al. (2016) | No | DD, ID, hypotonia |
| 55 | Support | Diagnostic Targeted Resequencing in 349 Patients with Drug-Resistant Pediatric Epilepsies Identifies Causative Mutations in 30 Different Genes | Parrini E , et al. (2016) | No | Rett syndrome |
| 56 | Support | Asperger syndrome and early-onset schizophrenia associated with a novel MECP2 deleterious missense variant | Curie A , et al. (2017) | Yes | SCZ |
| 57 | Support | Whole genome sequencing resource identifies 18 new candidate genes for autism spectrum disorder | C Yuen RK et al. (2017) | Yes | Rett syndrome |
| 58 | Support | A clinical utility study of exome sequencing versus conventional genetic testing in pediatric neurology | Vissers LE , et al. (2017) | No | - |
| 59 | Support | Familial cases and male cases with MECP2 mutations | Zhang Q , et al. (2017) | No | - |
| 60 | Support | Mapping autosomal recessive intellectual disability: combined microarray and exome sequencing identifies 26 novel candidate genes in 192 consanguineous families | Harripaul R , et al. (2017) | No | - |
| 61 | Support | Genomic diagnosis for children with intellectual disability and/or developmental delay | Bowling KM , et al. (2017) | Yes | - |
| 62 | Support | Identification of autism-related MECP2 mutations by whole-exome sequencing and functional validation | Wen Z , et al. (2017) | Yes | - |
| 63 | Support | Targeted sequencing and functional analysis reveal brain-size-related genes and their networks in autism spectrum disorders | Li J , et al. (2017) | Yes | - |
| 64 | Support | Clinical and molecular genetic characterization of familial MECP2 duplication syndrome in a Chinese family | Li X , et al. (2017) | No | ASD, ID, epilepsy/seizures |
| 65 | Support | Diagnostic exome sequencing of syndromic epilepsy patients in clinical practice | Tumien B , et al. (2017) | No | - |
| 66 | Recent Recommendation | Further delineation of the MECP2 duplication syndrome phenotype in 59 French male patients, with a particular focus on morphological and neurological features | Miguet M , et al. (2018) | No | Stereotypic movements |
| 67 | Support | Diagnostic value of partial exome sequencing in developmental disorders | Gieldon L , et al. (2018) | No | - |
| 68 | Support | Mosaic MECP2 variants in males with classical Rett syndrome features, including stereotypical hand movements | Schnewolf-Greulich B , et al. (2018) | No | - |
| 69 | Support | Inherited and multiple de novo mutations in autism/developmental delay risk genes suggest a multifactorial model | Guo H , et al. (2018) | Yes | - |
| 70 | Support | Both rare and common genetic variants contribute to autism in the Faroe Islands | Leblond CS , et al. (2019) | Yes | - |
| 71 | Support | Elucidation of the phenotypic spectrum and genetic landscape in primary and secondary microcephaly | Boonsawat P , et al. (2019) | No | DD, ID |
| 72 | Support | The combination of whole-exome sequencing and copy number variation sequencing enables the diagnosis of rare neurological disorders | Jiao Q , et al. (2019) | No | ASD, epilepsy/seizures |
| 73 | Support | Neurological Diseases With Autism Spectrum Disorder: Role of ASD Risk Genes | Xiong J , et al. (2019) | Yes | ID, epilepsy/seizures |
| 74 | Support | Lessons Learned from Large-Scale, First-Tier Clinical Exome Sequencing in a Highly Consanguineous Population | Monies D , et al. (2019) | No | Epilepsy/seizures, ASD, stereotypies |
| 75 | Support | Comprehensive Analysis of Rare Variants of 101 Autism-Linked Genes in a Hungarian Cohort of Autism Spectrum Disorder Patients | Balicza P , et al. (2019) | Yes | Rett syndrome |
| 76 | Support | The Clinical and Genetic Features of Co-occurring Epilepsy and Autism Spectrum Disorder in Chinese Children | Long S , et al. (2019) | Yes | - |
| 77 | Support | Diagnostic Yields of Trio-WES Accompanied by CNVseq for Rare Neurodevelopmental Disorders | Gao C , et al. (2019) | No | - |
| 78 | Support | Characterization of intellectual disability and autism comorbidity through gene panel sequencing | Aspromonte MC , et al. (2019) | Yes | - |
| 79 | Support | Exome sequencing of 457 autism families recruited online provides evidence for autism risk genes | Feliciano P et al. (2019) | Yes | - |
| 80 | Support | Rare genetic susceptibility variants assessment in autism spectrum disorder: detection rate and practical use | Husson T , et al. (2020) | Yes | - |
| 81 | Support | Phenotypic and genetic spectrum of epilepsy with myoclonic atonic seizures | Tang S et al. (2020) | No | - |
| 82 | Support | Next-Generation Sequencing in Korean Children With Autism Spectrum Disorder and Comorbid Epilepsy | Lee J et al. (2020) | Yes | Epilepsy/seizures, Rett syndrome |
| 83 | Support | Targeted re-sequencing for early diagnosis of genetic causes of childhood epilepsy: the Italian experience from the 'beyond epilepsy' project | Amadori E et al. (2020) | No | Autistic behavior |
| 84 | Support | Next Generation Sequencing of 134 Children with Autism Spectrum Disorder and Regression | Yin J et al. (2020) | Yes | Developmental regression, epilepsy/seizures |
| 85 | Support | Graded and pan-neural disease phenotypes of Rett Syndrome linked with dosage of functional MeCP2 | Chen X et al. (2020) | No | - |
| 86 | Support | - | Mojarad BA et al. (2021) | No | - |
| 87 | Support | - | Brunet T et al. (2021) | No | - |
| 88 | Support | - | Chen JS et al. (2021) | Yes | - |
| 89 | Support | - | Zou D et al. (2021) | Yes | - |
| 90 | Support | - | Arvio M et al. (2021) | No | - |
| 91 | Support | - | Gardner EJ et al. (2021) | No | - |
| 92 | Support | - | Du X et al. (2021) | Yes | Epilepsy/seizures |
| 93 | Support | - | Chen S et al. (2021) | Yes | DD, ID, epilepsy/seizures |
| 94 | Recent Recommendation | - | Zhou J et al. (2022) | No | - |
| 95 | Support | - | Xia S et al. (2022) | No | - |
| 96 | Support | - | Albizzati E et al. (2022) | No | - |
| 97 | Support | - | Verberne EA et al. (2022) | No | - |
| 98 | Support | - | Wang Q et al. (2022) | No | - |
| 99 | Support | - | Brea-Fernández AJ et al. (2022) | No | - |
| 100 | Support | - | Leite AJDC et al. (2022) | No | - |
| 101 | Support | - | Chuan Z et al. (2022) | No | ASD, DD, ID |
| 102 | Support | - | Hu C et al. (2022) | Yes | - |
| 103 | Support | - | Krgovic D et al. (2022) | No | Autistic behavior, stereotypy |
| 104 | Support | - | Chen Y et al. (2021) | No | Stereotypy |
| 105 | Support | - | Zhou X et al. (2022) | Yes | - |
| 106 | Support | - | Xu M et al. (2022) | No | - |
| 107 | Support | - | Torres-Prez JV et al. (2022) | No | - |
| 108 | Support | - | Li X et al. (2023) | No | - |
| 109 | Support | - | Yuan B et al. (2023) | Yes | - |
| 110 | Support | - | Miyake N et al. (2023) | Yes | - |
| 111 | Support | - | Spataro N et al. (2023) | No | - |
| 112 | Support | - | Hu C et al. (2023) | Yes | - |
| 113 | Support | - | Wang J et al. (2023) | Yes | - |
| 114 | Support | - | Cirnigliaro M et al. (2023) | Yes | - |
| 115 | Support | - | Sanchis-Juan A et al. (2023) | No | - |
| 116 | Support | - | Sheth F et al. (2023) | Yes | DD, ID, epilepsy/seizures |
| 117 | Support | - | Ko YJ et al. (2023) | Yes | - |
| 118 | Support | - | Amerh S Alqahtani et al. (2023) | No | - |
| 119 | Support | - | Yue Chai et al. (2023) | Yes | - |
| 120 | Support | - | Karthika Ajit Valaparambil et al. () | Yes | ADHD, DD, ID, epilepsy/seizures |
| 121 | Support | - | Sabin A Nettles et al. (2023) | No | - |
| 122 | Support | - | Fang-Xiao Xu et al. (2023) | No | - |
| 123 | Support | - | M Cecilia Poli et al. () | Yes | - |
| 124 | Support | - | Aniqa Tasnim et al. (2024) | Yes | Somatosensory behaviors |
| 125 | Support | - | Luigi Vetri et al. (2024) | No | - |
| 126 | Support | - | Marketa Wayhelova et al. (2024) | No | - |
| 127 | Support | - | Purvi Majethia et al. (2024) | No | DD |
| 128 | Support | - | Tamam Khalaf et al. (2024) | No | ASD, epilepsy/seizures |
| 129 | Support | - | Kirsten Furley et al. () | No | ASD, ID |
| 130 | Support | - | Nicholas J Santistevan et al. () | No | - |
| 131 | Recent Recommendation | - | Yi Liu et al. (2024) | No | - |
| 132 | Support | - | Ruohao Wu et al. (2024) | No | ASD, ADHD, epilepsy/seizures |
| 133 | Support | - | Alistair T Pagnamenta et al. (2024) | No | Autistic features, stereotypy |
| 134 | Support | - | Axel Schmidt et al. (2024) | No | ID, epilepsy/seizures, stereotypy |
| 135 | Support | - | Karen Lob et al. () | Yes | ADHD, DD, ID, epilepsy/seizures |
| 136 | Support | - | Liene Thys et al. (2024) | No | DD, ID, epilepsy/seizures, stereotypy |
| 137 | Support | - | Hosneara Akter et al. () | No | ASD or autistic behavior, ID |
| 138 | Support | - | Chengyan Li et al. (2024) | Yes | Epilepsy/seizures |
| 139 | Support | - | Ashlesha Gogate et al. (2024) | Yes | - |
| 140 | Support | - | Paola Granata et al. (2024) | Yes | - |
| 141 | Support | - | Davut Pehlivan et al. (2024) | No | - |
| 142 | Support | - | Maria Cristina Aspromonte et al. (2025) | No | ASD/autistic traits, epilepsy/seizures |
| 143 | Support | - | Kriti Arora et al. (2025) | Yes | DD, epilepsy/seizures |
| 144 | Support | - | Peng-Bo Jing et al. (2025) | Yes | - |
| 145 | Support | - | Eric Chen et al. (2025) | Yes | - |
| 146 | Support | - | Lyudmila Belenska-Todorova et al. (2025) | Yes | DD, epilepsy/seizures |
| 147 | Support | - | Sebastian Neuens et al. (2025) | No | DD, epilepsy/seizures, stereotypy |
| 148 | Support | - | Shruti Bajaj et al. () | Yes | DD |
| 149 | Support | - | Chris-Tiann Roberts et al. (2025) | No | ASD |
| 150 | Support | - | Gabriela Repiská et al. (2025) | Yes | - |
| 151 | Support | - | Ruohao Wu et al. (2025) | Yes | ADHD |
| 152 | Recent Recommendation | - | Miguel F Tenreiro et al. (2025) | No | ASD |
| 153 | Support | - | Aslihan Sanri et al. () | Yes | - |
| 154 | Support | - | Metin Eser et al. (2025) | Yes | - |
| 155 | Support | - | Yang Sui et al. (2026) | Yes | - |
| 156 | Support | - | Giancarlo Mancuso et al. (2026) | Yes | - |
| 157 | Support | - | Gülsüm Kayhan et al. (2026) | Yes | DD, epilepsy/seizures |
| 158 | Support | - | Yuan Zheng et al. (2026) | No | Stereotypy |
| 159 | Support | - | Harripaul, Ricardo et al. (2026) | Yes | - |
| 160 | Support | - | Osaki, Tatsuya et al. (2026) | No | - |
| 161 | Support | - | Luoni, Mirko et al. (2026) | No | - |
| 162 | Support | - | Wang, Yu-Meng et al. (2026) | No | - |
| 163 | Highly Cited | MeCP2 is a transcriptional repressor with abundant binding sites in genomic chromatin | Nan X , et al. (1997) | No | - |
| 164 | Highly Cited | Transcriptional repression by the methyl-CpG-binding protein MeCP2 involves a histone deacetylase complex | Nan X , et al. (1998) | No | - |
Rare Variants (339)
| Status | Allele Change | Residue Change | Variant Type | Inheritance Pattern | Parental Transmission | Family Type | PubMed ID | Author, Year |
|---|---|---|---|---|---|---|---|---|
| - | - | delins | De novo | - | - | 34626536 | Gardner EJ et al. (2021) | |
| - | - | deletion | De novo | - | - | 34626536 | Gardner EJ et al. (2021) | |
| - | - | copy_number_gain | Unknown | - | - | 34773222 | Du X et al. (2021) | |
| CT>GT | - | intron_variant | - | - | - | 11309367 | Couvert P , et al. (2001) | |
| - | - | copy_number_loss | De novo | - | - | 30945278 | Jiao Q , et al. (2019) | |
| - | - | translocation | De novo | - | - | 34626536 | Gardner EJ et al. (2021) | |
| - | - | copy_number_gain | De novo | - | - | 29286531 | Tumien B , et al. (2017) | |
| IVS2-61C>G | - | intron_variant | - | - | - | 11007980 | Orrico A , et al. (2000) | |
| - | - | copy_number_loss | De novo | - | - | 27864847 | Parrini E , et al. (2016) | |
| - | - | copy_number_loss | De novo | - | - | 34626536 | Gardner EJ et al. (2021) | |
| - | - | copy_number_loss | Unknown | - | - | 38374498 | Purvi Majethia et al. (2024) | |
| - | - | copy_number_gain | Familial | Maternal | - | 31178897 | Gao C , et al. (2019) | |
| c.502C>T | p.Arg168Ter | stop_gained | - | - | - | 11007980 | Orrico A , et al. (2000) | |
| c.763C>T | p.Arg255Ter | stop_gained | - | - | - | 11007980 | Orrico A , et al. (2000) | |
| c.656C>T | p.(=) | synonymous_variant | - | - | - | 11007980 | Orrico A , et al. (2000) | |
| c.1558insA | - | frameshift_variant | - | - | - | 15211631 | Shibayama A , et al. (2004) | |
| c.916C>T | p.Arg306Ter | stop_gained | De novo | - | - | 35741772 | Hu C et al. (2022) | |
| c.916C>T | p.Arg306Ter | stop_gained | Unknown | - | - | 35741772 | Hu C et al. (2022) | |
| c.837C>T | - | stop_gained | De novo | - | Simplex | 10508514 | Amir RE , et al. (1999) | |
| c.1145C>T | p.(=) | synonymous_variant | - | - | - | 11007980 | Orrico A , et al. (2000) | |
| c.849C>G | p.(=) | synonymous_variant | - | - | - | 11309367 | Couvert P , et al. (2001) | |
| c.808C>T | p.Arg270Ter | stop_gained | De novo | - | - | 39136901 | Karen Lob et al. () | |
| c.880C>T | p.Arg294Ter | stop_gained | De novo | - | - | 39136901 | Karen Lob et al. () | |
| c.1035A>G | p.(=) | synonymous_variant | - | - | - | 11309367 | Couvert P , et al. (2001) | |
| c.1363G>T | p.Ala455Ser | stop_gained | Unknown | - | - | 34145886 | Zou D et al. (2021) | |
| c.686C>A | p.Pro229His | stop_gained | De novo | - | - | 31178897 | Gao C , et al. (2019) | |
| c.502C>T | p.Arg168Ter | stop_gained | De novo | - | - | 34800434 | Chen S et al. (2021) | |
| c.844C>T | p.Arg282Ter | stop_gained | De novo | - | - | 34800434 | Chen S et al. (2021) | |
| c.916C>T | p.Arg306Ter | stop_gained | De novo | - | - | 34800434 | Chen S et al. (2021) | |
| c.427G>T | p.Ala143Ser | stop_gained | De novo | - | - | 35982159 | Zhou X et al. (2022) | |
| c.916C>T | p.Arg306Ter | stop_gained | De novo | - | - | 36881370 | Yuan B et al. (2023) | |
| - | - | copy_number_gain | Familial | Maternal | - | 28333917 | Vissers LE , et al. (2017) | |
| c.582C>T | p.(=) | synonymous_variant | - | - | - | 21600714 | Campos M Jr , et al. (2011) | |
| c.-187_-186del | - | 5_prime_UTR_variant | Unknown | - | - | 34773222 | Du X et al. (2021) | |
| c.799C>T | p.Arg267Ter | stop_gained | De novo | - | - | 27824329 | Wang T , et al. (2016) | |
| c.916C>T | p.Arg306Ter | stop_gained | De novo | - | - | 27824329 | Wang T , et al. (2016) | |
| c.763C>T | p.Arg255Ter | stop_gained | De novo | - | - | 31139143 | Long S , et al. (2019) | |
| c.799C>T | p.Arg267Ter | stop_gained | Unknown | - | - | 35571021 | Chuan Z et al. (2022) | |
| c.1081_*457del | - | stop_lost | De novo | - | Simplex | 41577710 | Yang Sui et al. (2026) | |
| - | - | inversion | De novo | - | Simplex | 38776926 | Alistair T Pagnamenta et al. (2024) | |
| c.844C>T | p.Arg282Ter | stop_gained | De novo | - | - | 31031587 | Xiong J , et al. (2019) | |
| c.916C>T | p.Arg306Ter | stop_gained | De novo | - | - | 31031587 | Xiong J , et al. (2019) | |
| c.538C>T | p.Arg180Ter | stop_gained | De novo | - | - | 41127290 | Ruohao Wu et al. (2025) | |
| c.410A>G | p.Glu137Gly | missense_variant | - | - | - | 11309367 | Couvert P , et al. (2001) | |
| c.850A>G | p.Lys284Glu | missense_variant | - | - | - | 11309367 | Couvert P , et al. (2001) | |
| c.897C>T | p.Ala299= | synonymous_variant | - | - | - | 11309367 | Couvert P , et al. (2001) | |
| c.467A>G | p.Lys156Arg | missense_variant | Unknown | - | - | 34773222 | Du X et al. (2021) | |
| c.473C>T | p.Thr158Met | missense_variant | Unknown | - | - | 34773222 | Du X et al. (2021) | |
| c.824T>C | p.Val275Ala | missense_variant | Unknown | - | - | 34773222 | Du X et al. (2021) | |
| c.509C>T | p.Thr170Met | missense_variant | De novo | - | - | 37007974 | Hu C et al. (2023) | |
| c.917G>A | p.Arg306Gln | missense_variant | De novo | - | - | 37007974 | Hu C et al. (2023) | |
| c.916C>T | p.Arg306Ter | stop_gained | De novo | - | - | 36980980 | Spataro N et al. (2023) | |
| c.223C>T | p.Arg75Ter | stop_gained | Unknown | - | - | 39342494 | Hosneara Akter et al. () | |
| c.1196C>T | p.Pro399Leu | missense_variant | - | - | - | 11309367 | Couvert P , et al. (2001) | |
| c.1358G>A | p.Arg453Gln | missense_variant | - | - | - | 11309367 | Couvert P , et al. (2001) | |
| c.21C>G | p.Ala7= | intron_variant | De novo | - | - | 28554332 | Bowling KM , et al. (2017) | |
| c.403A>G | p.Lys135Glu | missense_variant | Unknown | - | - | 32477112 | Lee J et al. (2020) | |
| c.455C>G | p.Pro152Arg | missense_variant | Unknown | - | - | 32477112 | Lee J et al. (2020) | |
| c.602C>T | p.Ala201Val | missense_variant | Unknown | - | - | 32477112 | Lee J et al. (2020) | |
| c.910C>T | p.Leu313Phe | missense_variant | Unknown | - | - | 37645600 | Ko YJ et al. (2023) | |
| c.397C>T | p.Arg133Cys | missense_variant | Unknown | - | - | 39136901 | Karen Lob et al. () | |
| c.215G>A | p.Gly72Asp | missense_variant | De novo | - | - | 35982159 | Zhou X et al. (2022) | |
| - | - | copy_number_gain | Familial | Maternal | Simplex | 15689435 | Meins M , et al. (2005) | |
| - | - | copy_number_gain | Familial | Maternal | Unknown | 33619735 | Brunet T et al. (2021) | |
| c.880C>T | p.Arg294Ter | stop_gained | De novo | - | - | 12770674 | Carney RM , et al. (2003) | |
| c.763C>T | p.Arg255Ter | stop_gained | De novo | - | - | 27864847 | Parrini E , et al. (2016) | |
| c.763C>T | p.Arg255Ter | stop_gained | De novo | - | - | 31134136 | Balicza P , et al. (2019) | |
| c.799C>T | p.Arg267Ter | stop_gained | Unknown | - | - | 38536866 | Kirsten Furley et al. () | |
| c.502C>T | p.Arg168Ter | stop_gained | De novo | - | - | 39213953 | Liene Thys et al. (2024) | |
| c.763C>T | p.Arg255Ter | stop_gained | De novo | - | - | 39213953 | Liene Thys et al. (2024) | |
| c.808C>T | p.Arg270Ter | stop_gained | De novo | - | - | 39213953 | Liene Thys et al. (2024) | |
| c.880C>T | p.Arg294Ter | stop_gained | De novo | - | - | 39213953 | Liene Thys et al. (2024) | |
| c.529C>T | p.Arg177Ter | stop_gained | Unknown | - | - | 39342494 | Hosneara Akter et al. () | |
| c.538C>T | p.Arg180Ter | stop_gained | Unknown | - | - | 40117183 | Kriti Arora et al. (2025) | |
| c.808C>T | p.Arg270Ter | stop_gained | Unknown | - | - | 40117183 | Kriti Arora et al. (2025) | |
| c.587C>G | p.Thr196Ser | missense_variant | - | - | - | 15211631 | Shibayama A , et al. (2004) | |
| c.479C>G | p.Thr160Arg | missense_variant | - | - | - | 21600714 | Campos M Jr , et al. (2011) | |
| c.26+2T>G | - | splice_site_variant | Unknown | - | - | 39039281 | Axel Schmidt et al. (2024) | |
| c.925C>T | p.Gln309Ter | missense_variant | De novo | - | - | 31178897 | Gao C , et al. (2019) | |
| c.673C>A | p.Pro225Thr | missense_variant | De novo | - | - | 32469098 | Tang S et al. (2020) | |
| c.473C>T | p.Thr158Met | missense_variant | De novo | - | - | 34800434 | Chen S et al. (2021) | |
| c.509C>T | p.Thr170Met | missense_variant | De novo | - | - | 34800434 | Chen S et al. (2021) | |
| c.674C>G | p.Pro225Arg | missense_variant | Unknown | - | - | 34800434 | Chen S et al. (2021) | |
| c.352C>T | p.Arg118Trp | missense_variant | De novo | - | - | 35982159 | Zhou X et al. (2022) | |
| c.437C>G | p.Ser146Cys | missense_variant | De novo | - | - | 35982159 | Zhou X et al. (2022) | |
| c.508A>G | p.Thr170Ala | missense_variant | De novo | - | - | 35982159 | Zhou X et al. (2022) | |
| c.686C>T | p.Pro229Leu | missense_variant | De novo | - | - | 35982159 | Zhou X et al. (2022) | |
| c.710C>G | p.Pro237Arg | missense_variant | De novo | - | - | 35982159 | Zhou X et al. (2022) | |
| c.851C>T | p.Pro284Leu | missense_variant | De novo | - | - | 35982159 | Zhou X et al. (2022) | |
| c.916C>T | p.Arg306Ter | missense_variant | De novo | - | - | 35982159 | Zhou X et al. (2022) | |
| c.925C>T | p.Gln309Ter | missense_variant | De novo | - | - | 35982159 | Zhou X et al. (2022) | |
| c.1160C>T | p.Ser387Phe | synonymous_variant | - | - | - | 11309367 | Couvert P , et al. (2001) | |
| c.502C>T | p.Arg168Ter | stop_gained | De novo | - | - | 28333917 | Vissers LE , et al. (2017) | |
| c.502C>T | p.Arg168Ter | stop_gained | De novo | - | - | 28554332 | Bowling KM , et al. (2017) | |
| c.1127C>G | p.Pro376Arg | missense_variant | - | - | - | 15211631 | Shibayama A , et al. (2004) | |
| c.1189G>A | p.Glu397Lys | missense_variant | - | - | - | 21600714 | Campos M Jr , et al. (2011) | |
| c.1233C>T | p.Pro411= | synonymous_variant | - | - | - | 21600714 | Campos M Jr , et al. (2011) | |
| c.844C>T | p.Arg282Ter | stop_gained | De novo | - | Simplex | 28831199 | Li J , et al. (2017) | |
| c.916C>T | p.Arg306Ter | stop_gained | De novo | - | Simplex | 37645600 | Ko YJ et al. (2023) | |
| c.674C>T | p.Pro225Leu | missense_variant | De novo | - | - | 12615169 | Moog U , et al. (2003) | |
| c.398G>A | p.Arg133His | missense_variant | De novo | - | - | 30945278 | Jiao Q , et al. (2019) | |
| c.473C>T | p.Thr158Met | missense_variant | De novo | - | - | 30945278 | Jiao Q , et al. (2019) | |
| c.397C>T | p.Arg133Cys | missense_variant | De novo | - | - | 31139143 | Long S , et al. (2019) | |
| c.509C>T | p.Thr170Met | missense_variant | De novo | - | - | 31139143 | Long S , et al. (2019) | |
| c.916C>T | p.Arg306Ter | missense_variant | De novo | - | - | 31139143 | Long S , et al. (2019) | |
| c.25C>G | p.Pro9Ala | missense_variant | Unknown | - | - | 39342494 | Hosneara Akter et al. () | |
| c.880C>T | p.Arg294Ter | stop_gained | Unknown | - | - | 27159028 | Fieremans N , et al. (2016) | |
| c.502C>T | p.Arg168Ter | stop_gained | De novo | - | - | 39039281 | Axel Schmidt et al. (2024) | |
| c.502C>T | p.Arg168Ter | stop_gained | Unknown | - | - | 39039281 | Axel Schmidt et al. (2024) | |
| c.880C>T | p.Arg294Ter | stop_gained | De novo | - | Simplex | 28785396 | Wen Z , et al. (2017) | |
| c.538C>T | p.Arg180Ter | stop_gained | De novo | - | Simplex | 30564305 | Guo H , et al. (2018) | |
| c.799C>T | p.Arg267Ter | stop_gained | De novo | - | Simplex | 30564305 | Guo H , et al. (2018) | |
| c.763C>T | p.Arg255Ter | stop_gained | De novo | - | Simplex | 35266334 | Wang Q et al. (2022) | |
| c.799C>T | p.Arg267Ter | stop_gained | De novo | - | Simplex | 35982159 | Zhou X et al. (2022) | |
| c.916C>T | p.Arg306Ter | stop_gained | De novo | - | Simplex | 35982159 | Zhou X et al. (2022) | |
| c.844C>T | p.Arg282Ter | stop_gained | De novo | - | Simplex | 37393044 | Wang J et al. (2023) | |
| c.473C>T | p.Thr158Met | missense_variant | De novo | - | - | 31031587 | Xiong J , et al. (2019) | |
| c.509C>T | p.Thr170Met | missense_variant | De novo | - | - | 31031587 | Xiong J , et al. (2019) | |
| c.763C>T | p.Arg255Ter | stop_gained | Unknown | - | Unknown | 26666243 | Lim EC , et al. (2015) | |
| c.820C>T | p.Gln274Ter | stop_gained | Unknown | - | Unknown | 33753861 | Chen JS et al. (2021) | |
| c.538C>T | p.Arg180Ter | stop_gained | De novo | - | Simplex | 37543562 | Sheth F et al. (2023) | |
| c.316C>T | p.Arg106Trp | missense_variant | De novo | - | - | 25914188 | Olson HE , et al. (2015) | |
| c.961C>T | p.Arg321Trp | missense_variant | De novo | - | - | 35813072 | Krgovic D et al. (2022) | |
| c.140C>T | p.Ala47Val | missense_variant | Unknown | - | - | 39342494 | Hosneara Akter et al. () | |
| c.194C>T | p.Thr65Met | missense_variant | Unknown | - | - | 39342494 | Hosneara Akter et al. () | |
| c.502C>T | p.Arg168Ter | stop_gained | Unknown | - | - | 31209962 | Aspromonte MC , et al. (2019) | |
| c.880C>T | p.Arg294Ter | stop_gained | De novo | - | - | 31209962 | Aspromonte MC , et al. (2019) | |
| c.502C>T | p.Arg168Ter | stop_gained | De novo | - | Simplex | 25167861 | Redin C , et al. (2014) | |
| c.397C>T | p.Arg133Cys | missense_variant | De novo | - | - | 27864847 | Parrini E , et al. (2016) | |
| c.915G>T | p.Lys305Asn | missense_variant | De novo | - | - | 27864847 | Parrini E , et al. (2016) | |
| c.397C>T | p.Arg133Cys | missense_variant | De novo | - | - | 30091983 | Gieldon L , et al. (2018) | |
| c.491C>G | p.Pro164Arg | missense_variant | Unknown | - | - | 38536866 | Kirsten Furley et al. () | |
| c.509C>T | p.Thr170Met | missense_variant | Unknown | - | - | 38536866 | Kirsten Furley et al. () | |
| c.473C>T | p.Thr158Met | missense_variant | De novo | - | - | 39213953 | Liene Thys et al. (2024) | |
| c.517A>G | p.Lys173Glu | missense_variant | Unknown | - | - | 39342494 | Hosneara Akter et al. () | |
| c.433C>T | p.Arg145Cys | missense_variant | Unknown | - | - | 40117183 | Kriti Arora et al. (2025) | |
| c.509C>T | p.Thr170Met | missense_variant | De novo | - | - | 40117183 | Kriti Arora et al. (2025) | |
| c.800G>A | p.Arg267Gln | stop_gained | Unknown | - | Simplex | 28263302 | C Yuen RK et al. (2017) | |
| c.538C>T | p.Arg180Ter | stop_gained | Unknown | - | Unknown | 31130284 | Monies D , et al. (2019) | |
| c.916C>T | p.Arg306Ter | stop_gained | Unknown | - | Unknown | 31130284 | Monies D , et al. (2019) | |
| c.502C>T | p.Arg168Ter | stop_gained | Unknown | - | Unknown | 32631363 | Amadori E et al. (2020) | |
| c.844C>T | p.Arg282Ter | stop_gained | De novo | - | Simplex | 38764027 | Ruohao Wu et al. (2024) | |
| c.1922A>T | p.Asp641Val | missense_variant | Unknown | - | - | 38536866 | Kirsten Furley et al. () | |
| c.433C>T | p.Arg145Cys | missense_variant | De novo | - | - | 38256219 | Luigi Vetri et al. (2024) | |
| c.378-3C>G | p.? | splice_region_variant | Unknown | - | - | 38438125 | Tamam Khalaf et al. (2024) | |
| - | - | copy_number_gain | Familial | Paternal | Multiplex | 22883432 | Hanchard NA , et al. (2012) | |
| - | - | inversion | Familial | Maternal | Simplex | 38776926 | Alistair T Pagnamenta et al. (2024) | |
| c.439A>G | p.Lys147Glu | missense_variant | Unknown | - | Unknown | 32722525 | Yin J et al. (2020) | |
| c.423C>G | p.Tyr141Ter | stop_gained | De novo | - | Simplex | 10854091 | De Bona C , et al. (2000) | |
| c.502C>T | p.Arg168Ter | stop_gained | De novo | - | Simplex | 10854091 | De Bona C , et al. (2000) | |
| c.763C>T | p.Arg255Ter | stop_gained | De novo | - | Simplex | 10854091 | De Bona C , et al. (2000) | |
| c.808C>T | p.Arg270Ter | stop_gained | De novo | - | Simplex | 10854091 | De Bona C , et al. (2000) | |
| c.880C>T | p.Arg294Ter | stop_gained | De novo | - | Simplex | 10854091 | De Bona C , et al. (2000) | |
| c.916C>T | p.Arg306Ter | missense_variant | Unknown | - | - | 38438125 | Tamam Khalaf et al. (2024) | |
| c.952C>T | p.Arg318Cys | missense_variant | Unknown | - | - | 38438125 | Tamam Khalaf et al. (2024) | |
| c.316C>T | p.Arg106Trp | missense_variant | De novo | - | - | 39039281 | Axel Schmidt et al. (2024) | |
| c.419C>T | p.Ala140Val | missense_variant | Unknown | - | - | 39039281 | Axel Schmidt et al. (2024) | |
| - | - | copy_number_gain | Familial | Maternal | Multi-generational | 29141583 | Li X , et al. (2017) | |
| c.455C>T | p.Ala152Val | missense_variant | De novo | - | Simplex | 28785396 | Wen Z , et al. (2017) | |
| c.352C>T | p.Arg118Trp | missense_variant | De novo | - | Simplex | 35873028 | Chen Y et al. (2021) | |
| c.434G>A | p.Arg145His | missense_variant | De novo | - | Simplex | 35873028 | Chen Y et al. (2021) | |
| c.916C>T | p.Arg306Ter | missense_variant | De novo | - | Simplex | 35873028 | Chen Y et al. (2021) | |
| c.433C>T | p.Arg145Cys | missense_variant | De novo | - | Simplex | 35982159 | Zhou X et al. (2022) | |
| c.710C>G | p.Pro237Arg | missense_variant | De novo | - | Simplex | 35982159 | Zhou X et al. (2022) | |
| c.916C>T | p.Arg306Ter | missense_variant | De novo | - | Simplex | 35982159 | Zhou X et al. (2022) | |
| c.710C>G | p.Pro237Arg | missense_variant | De novo | - | Simplex | 37393044 | Wang J et al. (2023) | |
| c.952C>T | p.Arg318Cys | missense_variant | De novo | - | Simplex | 37393044 | Wang J et al. (2023) | |
| c.63-44T>C | - | intron_variant | Unknown | Unknown | Unknown | 23055267 | Cukier HN , et al. (2012) | |
| c.538C>T | p.Arg180Ter | stop_gained | De novo | - | Simplex | 39528574 | Chengyan Li et al. (2024) | |
| c.1164_1207del | p.Pro389Ter | stop_gained | Unknown | - | - | 39039281 | Axel Schmidt et al. (2024) | |
| c.1214C>T | p.Pro405Leu | missense_variant | De novo | - | - | 18678449 | Campos M Jr , et al. (2008) | |
| c.1164_1207del | p.Lys389Ter | frameshift_variant | De novo | - | - | 35982159 | Zhou X et al. (2022) | |
| c.1108G>A | p.Ala370Thr | missense_variant | De novo | - | Simplex | 30564305 | Guo H , et al. (2018) | |
| c.538C>T | p.Arg180Ter | stop_gained | Unknown | Not maternal | - | 27824329 | Wang T , et al. (2016) | |
| c.433C>T | p.Arg145Cys | missense_variant | De novo | - | Simplex | 37543562 | Sheth F et al. (2023) | |
| c.491C>G | p.Pro164Arg | missense_variant | De novo | - | Simplex | 37543562 | Sheth F et al. (2023) | |
| c.952C>T | p.Arg318Cys | missense_variant | De novo | - | Simplex | 37543562 | Sheth F et al. (2023) | |
| c.434G>C | p.Arg145Pro | missense_variant | De novo | - | Simplex | 40841582 | Shruti Bajaj et al. () | |
| c.413+94C>T | - | intron_variant | Unknown | Unknown | Unknown | 23055267 | Cukier HN , et al. (2012) | |
| c.1357C>T | p.Arg453Ter | stop_gained | De novo | - | Simplex | 12707946 | Zappella M , et al. (2003) | |
| c.1638G>C | - | 3_prime_UTR_variant | Familial | Maternal | - | 15211631 | Shibayama A , et al. (2004) | |
| c.6809T>C | - | 3_prime_UTR_variant | Familial | Maternal | - | 15211631 | Shibayama A , et al. (2004) | |
| c.397C>A | p.Arg133Cys | missense_variant | De novo | - | Simplex | 10508514 | Amir RE , et al. (1999) | |
| c.464T>C | p.Phe155Ser | missense_variant | De novo | - | Simplex | 10508514 | Amir RE , et al. (1999) | |
| c.473C>T | p.Thr158Met | missense_variant | De novo | - | Simplex | 10508514 | Amir RE , et al. (1999) | |
| c.916C>T | p.Arg306Ter | missense_variant | De novo | - | Simplex | 25167861 | Redin C , et al. (2014) | |
| c.916C>T | p.Arg306Ter | missense_variant | De novo | - | Simplex | 36973392 | Miyake N et al. (2023) | |
| c.941C>G | p.Pro314Arg | missense_variant | De novo | - | Simplex | 36973392 | Miyake N et al. (2023) | |
| c.433C>T | p.Arg145Cys | missense_variant | De novo | - | Simplex | 41409310 | Aslihan Sanri et al. () | |
| c.21del | p.Ala8ArgfsTer36 | frameshift_variant | De novo | - | - | 25914188 | Olson HE , et al. (2015) | |
| c.413+102A>G | - | intron_variant | Unknown | Unknown | Unknown | 23055267 | Cukier HN , et al. (2012) | |
| c.916C>T | p.Arg306Ter | stop_gained | De novo | - | Simplex | 27848944 | Trujillano D , et al. (2016) | |
| c.433C>T | p.Arg145Cys | missense_variant | De novo | - | - | 40592404 | Sebastian Neuens et al. (2025) | |
| c.509C>T | p.Thr170Met | missense_variant | De novo | - | - | 40592404 | Sebastian Neuens et al. (2025) | |
| c.1208C>G | p.Pro403Arg | missense_variant | Familial | Maternal | - | 34800434 | Chen S et al. (2021) | |
| c.59_60del | p.Arg20ThrfsTer21 | frameshift_variant | De novo | - | - | 34800434 | Chen S et al. (2021) | |
| c.806del | p.Ala269ValfsTer32 | frameshift_variant | De novo | - | - | 30945278 | Jiao Q , et al. (2019) | |
| c.791del | p.Gly264AlafsTer37 | frameshift_variant | De novo | - | - | 35571021 | Chuan Z et al. (2022) | |
| c.500G>C | p.Arg167Pro | missense_variant | Unknown | - | Multiplex | 34457282 | Arvio M et al. (2021) | |
| c.608C>T | p.Pro203Leu | missense_variant | Unknown | - | Unknown | 11007980 | Orrico A , et al. (2000) | |
| c.352C>T | p.Arg118Trp | missense_variant | Unknown | - | Unknown | 31130284 | Monies D , et al. (2019) | |
| c.433C>T | p.Arg145Cys | missense_variant | De novo | - | Unknown | 31130284 | Monies D , et al. (2019) | |
| c.952C>T | p.Arg318Cys | missense_variant | Unknown | - | Unknown | 31130284 | Monies D , et al. (2019) | |
| c.845A>G | p.Glu282Gly | missense_variant | De novo | - | Simplex | 32094338 | Husson T , et al. (2020) | |
| c.397C>T | p.Arg133Cys | missense_variant | Unknown | - | Unknown | 32631363 | Amadori E et al. (2020) | |
| c.952C>T | p.Arg318Cys | missense_variant | De novo | - | Simplex | 38764027 | Ruohao Wu et al. (2024) | |
| c.819G>T | p.(=) | synonymous_variant | Familial | Paternal | - | 14986829 | Pescucci C , et al. (2004) | |
| c.808C>T | p.Arg270Ter | stop_gained | De novo | - | - | 30417326 | Schnewolf-Greulich B , et al. (2018) | |
| c.47_57del | p.Gly16GlufsTer22 | frameshift_variant | Unknown | - | - | 31139143 | Long S , et al. (2019) | |
| c.1164_1207del | p.Lys389Ter | frameshift_variant | De novo | - | - | 36980980 | Spataro N et al. (2023) | |
| c.1104C>G | p.Ser368Arg | missense_variant | Unknown | - | Unknown | 31130284 | Monies D , et al. (2019) | |
| c.398G>T | p.Arg133Leu | missense_variant | De novo | - | Simplex | 10854091 | De Bona C , et al. (2000) | |
| c.674C>G | p.Pro225Arg | missense_variant | De novo | - | Simplex | 10854091 | De Bona C , et al. (2000) | |
| c.1366G>A | p.Ala456Thr | missense_variant | Unknown | - | - | 26845707 | Alvarez-Mora MI , et al. (2016) | |
| c.1158_1201del | p.Glu386AspfsTer4 | frameshift_variant | Unknown | - | - | 35741772 | Hu C et al. (2022) | |
| c.1208C>G | p.Pro403Arg | missense_variant | Familial | Maternal | - | 31031587 | Xiong J , et al. (2019) | |
| c.1216G>A | p.Glu406Lys | missense_variant | Familial | Maternal | - | 31031587 | Xiong J , et al. (2019) | |
| c.1200_1243del | p.Pro401Ter | frameshift_variant | De novo | - | - | 34626536 | Gardner EJ et al. (2021) | |
| c.91del | p.Gln31ArgfsTer13 | frameshift_variant | Unknown | - | - | 35253369 | Verberne EA et al. (2022) | |
| c.397C>T | p.Arg133Cys | missense_variant | De novo | - | Simplex | 12707946 | Zappella M , et al. (2003) | |
| c.307C>T | p.Arg103Trp | missense_variant | De novo | - | Simplex | 30675382 | Leblond CS , et al. (2019) | |
| c.504C>G | p.Asp168Glu | missense_variant | De novo | - | Simplex | 39528574 | Chengyan Li et al. (2024) | |
| c.710C>G | p.Pro237Arg | missense_variant | De novo | - | Simplex | 39528574 | Chengyan Li et al. (2024) | |
| c.908C>G | p.Ser303Cys | missense_variant | Unknown | - | - | 40869941 | Gabriela Repiská et al. (2025) | |
| - | - | copy_number_gain | Familial | Maternal | Simplex | 38776926 | Alistair T Pagnamenta et al. (2024) | |
| - | - | copy_number_loss | Familial | Maternal | Simplex | 38776926 | Alistair T Pagnamenta et al. (2024) | |
| c.964C>T | p.Pro322Ser | missense_variant | Familial | Maternal | - | 16966553 | Ventura P , et al. (2006) | |
| c.724C>A | p.Pro242Thr | missense_variant | Familial | Maternal | - | 38177409 | M Cecilia Poli et al. () | |
| c.65T>C | p.(=) | synonymous_variant | Unknown | Unknown | Unknown | 23055267 | Cukier HN , et al. (2012) | |
| c.604C>T | p.Arg202Cys | missense_variant | De novo | - | Simplex | 24776741 | McCarthy SE , et al. (2014) | |
| c.844C>T | p.Arg282Ter | stop_gained | De novo | - | Simplex | 37799141 | Amerh S Alqahtani et al. (2023) | |
| c.799C>T | p.Arg267Ter | stop_gained | De novo | - | Simplex | 41865132 | Harripaul, Ricardo et al. (2026) | |
| c.538C>T | p.Arg180Ter | stop_gained | Unknown | Not maternal | Simplex | 30564305 | Guo H , et al. (2018) | |
| c.1447G>T | p.Glu483Ter | stop_gained | Familial | Maternal | Multiplex | 23352163 | Yu TW , et al. (2013) | |
| c.1200_1243del | p.Pro401Ter | frameshift_variant | Unknown | - | - | 38438125 | Tamam Khalaf et al. (2024) | |
| c.916C>T | p.Arg306Ter | stop_gained | De novo | - | Simplex | 41751633 | Gülsüm Kayhan et al. (2026) | |
| c.1416_1417del | p.Ile473CysfsTer25 | frameshift_variant | De novo | - | - | 34800434 | Chen S et al. (2021) | |
| c.1136_1152del | p.His379LeufsTer20 | frameshift_variant | De novo | - | - | 35982159 | Zhou X et al. (2022) | |
| c.1483G>T | p.Glu495Ter | stop_gained | Familial | Maternal | Multiplex | 23352160 | Lim ET , et al. (2013) | |
| c.1030C>T | p.Arg344Trp | missense_variant | Unknown | Not maternal | - | 37822516 | Yue Chai et al. (2023) | |
| c.455C>T | p.Ala152Val | missense_variant | Unknown | - | Simplex | 37541188 | Sanchis-Juan A et al. (2023) | |
| c.925C>T | p.Arg309Trp | missense_variant | De novo | - | - | 26936630 | Schnewolf-Greulich B , et al. (2016) | |
| c.925C>T | p.Gln309Ter | missense_variant | De novo | - | - | 26936630 | Schnewolf-Greulich B , et al. (2016) | |
| c.656C>T | p.(=) | synonymous_variant | Familial | Paternal | Multiplex | 10508514 | Amir RE , et al. (1999) | |
| c.771_814del | p.Met258ProfsTer70 | frameshift_variant | De novo | - | - | 25914188 | Olson HE , et al. (2015) | |
| c.1080_1194delins60 | p.Pro362fs | frameshift_variant | De novo | - | - | 39213953 | Liene Thys et al. (2024) | |
| c.1376C>T | p.Ala459Val | missense_variant | Unknown | - | Simplex | 37541188 | Sanchis-Juan A et al. (2023) | |
| c.952C>T | p.Arg318Cys | missense_variant | De novo | - | Simplex | 39632905 | Ashlesha Gogate et al. (2024) | |
| c.433C>T | p.Arg145Cys | missense_variant | Unknown | - | - | 37943464 | Karthika Ajit Valaparambil et al. () | |
| c.1162C>T | p.Pro388Ser | missense_variant | Familial | Maternal | Simplex | 28785396 | Wen Z , et al. (2017) | |
| c.842dup | p.Arg282ProfsTer61 | frameshift_variant | De novo | - | Simplex | 37543562 | Sheth F et al. (2023) | |
| c.23_27del | p.Ala8GlufsTer32 | frameshift_variant | De novo | - | Simplex | 37543562 | Sheth F et al. (2023) | |
| c.1416_1417del | p.Ile473CysfsTer25 | frameshift_variant | De novo | - | - | 31031587 | Xiong J , et al. (2019) | |
| c.1160C>T | p.Pro387Leu | missense_variant | Familial | Maternal | - | 39654053 | Paola Granata et al. (2024) | |
| c.842del | p.Gly281AlafsTer20 | frameshift_variant | De novo | - | - | 38374498 | Purvi Majethia et al. (2024) | |
| c.952C>T | p.Arg318Cys | missense_variant | De novo | - | Simplex | 41596607 | Giancarlo Mancuso et al. (2026) | |
| c.596C>G | p.Pro199Arg | missense_variant | Familial | Maternal | Multiplex | 23352163 | Yu TW , et al. (2013) | |
| c.1307C>T | p.(=) | synonymous_variant | Unknown | Not maternal | Simplex | 10508514 | Amir RE , et al. (1999) | |
| c.1193_1233del | p.Leu398HisfsTer5 | frameshift_variant | De novo | - | - | 12770674 | Carney RM , et al. (2003) | |
| c.1164_1198del | p.Lys389ThrfsTer4 | frameshift_variant | De novo | - | - | 35390071 | Leite AJDC et al. (2022) | |
| c.312A>G | p.Gly104= | synonymous_variant | Unknown | Unknown | Unknown | 23055267 | Cukier HN , et al. (2012) | |
| c.786C>T | p.Arg262= | synonymous_variant | Unknown | Unknown | Unknown | 23055267 | Cukier HN , et al. (2012) | |
| c.870C>T | p.Ala290= | synonymous_variant | Unknown | Unknown | Unknown | 23055267 | Cukier HN , et al. (2012) | |
| c.978C>T | p.Ile326= | synonymous_variant | Unknown | Unknown | Unknown | 23055267 | Cukier HN , et al. (2012) | |
| c.509C>T | p.Thr170Met | missense_variant | Unknown | - | Simplex | 37799141 | Amerh S Alqahtani et al. (2023) | |
| c.473C>T | p.Thr158Met | missense_variant | De novo | - | Multi-generational | 30945278 | Jiao Q , et al. (2019) | |
| c.1164_1207del | p.Lys389Ter | stop_gained | Familial | Maternal | Simplex | 28394482 | Zhang Q , et al. (2017) | |
| c.1227_1229del | p.Glu409del | stop_gained | Familial | Maternal | Simplex | 28394482 | Zhang Q , et al. (2017) | |
| c.1409G>A | p.Arg470His | missense_variant | Familial | Maternal | Simplex | 28394482 | Zhang Q , et al. (2017) | |
| c.432del | p.Arg145AlafsTer6 | frameshift_variant | De novo | - | Simplex | 10854091 | De Bona C , et al. (2000) | |
| c.1071A>G | p.Lys357= | synonymous_variant | Unknown | Unknown | Unknown | 23055267 | Cukier HN , et al. (2012) | |
| c.1371G>A | p.Thr457= | synonymous_variant | Unknown | Unknown | Unknown | 23055267 | Cukier HN , et al. (2012) | |
| c.1157_1197del | p.Glu386AlafsTer5 | frameshift_variant | De novo | - | - | 28554332 | Bowling KM , et al. (2017) | |
| c.524G>A | p.Gly175Glu | missense_variant | De novo | - | Simplex | 41751633 | Gülsüm Kayhan et al. (2026) | |
| c.397C>T | p.Arg133Cys | missense_variant | Familial | Maternal | Multiplex | 28394482 | Zhang Q , et al. (2017) | |
| c.441C>G | p.Asp147Glu | missense_variant | Familial | Maternal | Multiplex | 28394482 | Zhang Q , et al. (2017) | |
| c.1271T>C | p.Val424Ala | missense_variant | Familial | Maternal | Simplex | 41420732 | Metin Eser et al. (2025) | |
| c.1265dup | p.Ser422ArgfsTer26 | frameshift_variant | De novo | - | Simplex | 38764027 | Ruohao Wu et al. (2024) | |
| c.722dup | p.Pro242AlafsTer6 | frameshift_variant | De novo | - | Multiplex | 28263302 | C Yuen RK et al. (2017) | |
| c.1164_1207del | p.Pro389Ter | frameshift_variant | De novo | - | Multiplex | 28263302 | C Yuen RK et al. (2017) | |
| c.641C>G | p.Ala214Gly | missense_variant | Familial | Maternal | Simplex | 21624971 | Schaaf CP , et al. (2011) | |
| c.719C>G | p.Thr240Ser | missense_variant | Familial | Maternal | Simplex | 23055267 | Cukier HN , et al. (2012) | |
| c.806del | p.Ala269ValfsTer32 | frameshift_variant | De novo | - | Simplex | 10854091 | De Bona C , et al. (2000) | |
| c.763C>T | p.Arg255Ter | stop_gained | Unknown | - | Simplex | 40019509 | Maria Cristina Aspromonte et al. (2025) | |
| c.808C>T | p.Arg270Ter | stop_gained | De novo | - | Simplex | 40019509 | Maria Cristina Aspromonte et al. (2025) | |
| c.808C>T | p.Arg270Ter | stop_gained | Unknown | - | Simplex | 40019509 | Maria Cristina Aspromonte et al. (2025) | |
| c.281_284dup | p.Arg96ThrfsTer8 | frameshift_variant | De novo | - | Simplex | 38764027 | Ruohao Wu et al. (2024) | |
| c.419C>T | p.Ala140Val | missense_variant | Familial | Maternal | Multiplex | 25473036 | Soden SE , et al. (2014) | |
| c.1108G>A | p.Ala370Thr | missense_variant | Familial | Maternal | Simplex | 23055267 | Cukier HN , et al. (2012) | |
| c.1157del | p.Glu386GlyfsTer35 | frameshift_variant | De novo | - | Simplex | 10854091 | De Bona C , et al. (2000) | |
| c.1159del | p.Ser387ProfsTer34 | frameshift_variant | De novo | - | Simplex | 10854091 | De Bona C , et al. (2000) | |
| c.1152_1155del | p.His384GlnfsTer36 | frameshift_variant | Unknown | - | - | 39039281 | Axel Schmidt et al. (2024) | |
| c.499C>T | p.Arg167Trp | missense_variant | Familial | Maternal | Multiplex | 11309367 | Couvert P , et al. (2001) | |
| c.719C>G | p.Thr240Ser | missense_variant | Familial | Maternal | Multiplex | 23055267 | Cukier HN , et al. (2012) | |
| c.1200_1222del | p.Pro401ArgfsTer8 | frameshift_variant | De novo | - | Simplex | 23020937 | Rauch A , et al. (2012) | |
| c.316C>T | p.Arg106Trp | missense_variant | Unknown | Not maternal | Multiplex | 10508514 | Amir RE , et al. (1999) | |
| c.455C>T | p.Ala152Val | missense_variant | Familial | Maternal | - | 35322241 | Brea-Fernández AJ et al. (2022) | |
| c.1167_1200del | p.Pro390AlafsTer8 | frameshift_variant | Unknown | - | Simplex | 28263302 | C Yuen RK et al. (2017) | |
| c.1157_1185del | p.Glu386AlafsTer9 | frameshift_variant | Unknown | - | Unknown | 32631363 | Amadori E et al. (2020) | |
| c.792_795del | p.Arg265SerfsTer35 | frameshift_variant | De novo | - | - | 38321498 | Marketa Wayhelova et al. (2024) | |
| c.925C>T | p.Gln309Ter | missense_variant | Familial | Maternal | - | 26936630 | Schnewolf-Greulich B , et al. (2016) | |
| c.1208dup | p.Glu404Ter | stop_gained | Familial | Maternal | - | 40558542 | Lyudmila Belenska-Todorova et al. (2025) | |
| c.746del | p.Gly249ValfsTer11 | frameshift_variant | Familial | Maternal | Simplex | 30564305 | Guo H , et al. (2018) | |
| c.44_45insCGAGG | p.Gly16GlufsTer30 | frameshift_variant | De novo | - | Simplex | 41810194 | Yuan Zheng et al. (2026) | |
| c.1158_1198del | p.Glu386AspfsTer5 | frameshift_variant | De novo | - | Simplex | 10854091 | De Bona C , et al. (2000) | |
| c.569G>A | p.Arg190His | missense_variant | Familial | - | Multi-generational | 28397838 | Harripaul R , et al. (2017) | |
| c.499C>T | p.Arg167Trp | missense_variant | Familial | Maternal | Multiplex | 26490184 | Bianciardi L , et al. (2015) | |
| c.554G>T | p.Gly185Val | missense_variant | Familial | Maternal | Multiplex | 26490184 | Bianciardi L , et al. (2015) | |
| c.1309dup | p.Glu437GlyfsTer11 | frameshift_variant | De novo | - | - | 30417326 | Schnewolf-Greulich B , et al. (2018) | |
| c.1233dup | p.Thr412HisfsTer5 | frameshift_variant | Unknown | - | - | 37943464 | Karthika Ajit Valaparambil et al. () | |
| c.316C>T | p.Arg106Trp | missense_variant | Unknown | - | Simplex | 40019509 | Maria Cristina Aspromonte et al. (2025) | |
| c.473C>T | p.Thr158Met | missense_variant | Unknown | - | Simplex | 40019509 | Maria Cristina Aspromonte et al. (2025) | |
| c.1216G>A | p.Glu406Lys | stop_gained | Familial | Maternal | Multi-generational | 10986043 | Meloni I , et al. (2000) | |
| c.1161_1400del | p.Pro388_Glu467del | inframe_deletion | Familial | Maternal | - | 11807877 | Yntema HG , et al. (2002) | |
| c.1158_1164del | p.Ser387ArgfsTer32 | frameshift_variant | Unknown | - | Unknown | 33526774 | Mojarad BA et al. (2021) | |
| c.148_152del | p.Glu50ArgfsTer5 | frameshift_variant | Unknown | - | Simplex | 37541188 | Sanchis-Juan A et al. (2023) | |
| c.1409G>A | p.Arg470His | missense_variant | Familial | Maternal | Simplex | 39632905 | Ashlesha Gogate et al. (2024) | |
| c.1225_1226del | p.Ser409GlnfsTer26 | frameshift_variant | De novo | - | Simplex | 39528574 | Chengyan Li et al. (2024) | |
| c.1234dup | p.Thr412AsnfsTer5 | frameshift_variant | De novo | - | Simplex | 41865132 | Harripaul, Ricardo et al. (2026) | |
| c.1174_1192del | p.Val392CysfsTer23 | frameshift_variant | Unknown | - | - | 41751633 | Gülsüm Kayhan et al. (2026) | |
| c.397C>T | p.Arg133Cys | missense_variant | Familial | Maternal | Multi-generational | 28394482 | Zhang Q , et al. (2017) | |
| c.916C>T | p.Arg306Ter | missense_variant | Familial | Maternal | Multi-generational | 28394482 | Zhang Q , et al. (2017) | |
| c.1193_1199del | p.Leu398HisfsTer21 | frameshift_variant | Familial | Maternal | - | 31452935 | Feliciano P et al. (2019) | |
| c.419C>T | p.Ala140Val | missense_variant | Familial | Maternal | Multi-generational | 11007980 | Orrico A , et al. (2000) | |
| c.1198_1239delinsTGAGGACTTGAG | p.Pro400_Ser413delinsTer | stop_gained | De novo | - | - | 34626536 | Gardner EJ et al. (2021) | |
| c.433C>T | p.Arg145Cys | missense_variant | De novo | - | Simplex | 25533962 | Deciphering Developmental Disorders Study (2014) | |
| c.1122del | p.Lys375ArgfsTer46 | frameshift_variant | Familial | Maternal | Multiplex | 37506195 | Cirnigliaro M et al. (2023) | |
| c.1231A>G | p.Ser411Gly | missense_variant | Familial | Maternal | Unknown | 40019509 | Maria Cristina Aspromonte et al. (2025) | |
| c.1197_1222delinsAGC | p.Pro400AlafsTer9 | frameshift_variant | Unknown | - | - | 37943464 | Karthika Ajit Valaparambil et al. () | |
| c.1447G>T;c.1483G>T | p.Glu483Ter;p.Glu495Ter | stop_gained | Familial | Maternal | Multiplex | 28263302 | C Yuen RK et al. (2017) | |
| c.1165_1233del69ins21 | p.Pro389_Pro411del23ins7 | frameshift_variant | De novo | - | Simplex | 10854091 | De Bona C , et al. (2000) | |
| c.1138_1144del | p.His380ThrfsTer39 | frameshift_variant | Familial | Maternal | Multiplex | 30842647 | Boonsawat P , et al. (2019) | |
| c.954A>T | p.Glu318Asp | complex_structural_alteration | Familial | Maternal | Multi-generational | 25167861 | Redin C , et al. (2014) | |
| c.694insT | Stop after 27 out of frame AA's | frameshift_variant | Unknown | Not maternal | Simplex | 10508514 | Amir RE , et al. (1999) | |
| c.491G>T | p.Ser164Ile | missense_variant | De novo (germline mosaicism) | - | Multiplex (dizygotic twins) | 28230711 | Curie A , et al. (2017) | |
| c.763C>T(c.799C>T) | p.Arg255Ter (p.Arg267Ter) | stop_gained | De novo | - | Simplex | 25533962 | Deciphering Developmental Disorders Study (2014) | |
| GGGGGGCTGGTGGGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGT>G | p.Pro398fsTer | frameshift_variant | Familial | Maternal | - | 27799067 | Loviglio MN , et al. (2016) | |
| c.473C>T(c.509C>T) | p.Thr158Met (p.Thr170Met) | missense_variant | De novo | - | Simplex | 25533962 | Deciphering Developmental Disorders Study (2014) | |
| NM_004992.3:c.1097_1235delins50bp | p.Arg354_Val412delins41 | complex_structural_alteration | Familial | Maternal | Multi-generational | 25167861 | Redin C , et al. (2014) |
Common Variants
No common variants reported.
SFARI Gene score
High Confidence, Syndromic

Score Delta: Score remained at 1S
criteria met
See SFARI Gene'scoring criteriaWe considered a rigorous statistical comparison between cases and controls, yielding genome-wide statistical significance, with independent replication, to be the strongest possible evidence for a gene. These criteria were relaxed slightly for category 2.
The syndromic category includes mutations that are associated with a substantial degree of increased risk and consistently linked to additional characteristics not required for an ASD diagnosis. If there is independent evidence implicating a gene in idiopathic ASD, it will be listed as "#S" (e.g., 2S, 3S, etc.). If there is no such independent evidence, the gene will be listed simply as "S."
4/1/2021

Score remained at 1
Description
Mutations in MECP2 cause Rett syndrome (Amir et al., 1999), which has been recognized as an autism spectrum disorder (DSM-IV). MECP2 mutations were identified in four females and one male with a clinical diagnosis of Angelman syndrome (Watson et al., 2001). Brain samples from several related neurodevelopmental disorders, including autism, pervasive developmental disorder, Prader-Willi and Angelman syndromes showed significant differences in MECP2 expression from age-matched controls by apparently different transcriptional and post-transcriptional mechanisms (Samaco et al., 2004). Significant defects in UBE3A/E6AP and GABRB3 expression has been observed in MECP2 deficient mice and human Rett, Angelman and autism brains compared with controls (Samaco et al., 2005). A significant reduction in frontal cortex MECP2 expression compared to age-matched controls was found in autism (79%), RTT (100%), Angelman syndrome (100%), Prader-Willi syndrome (75%), Down syndrome (60%), and attention deficit hyperactivity disorder (100%) samples. As well, significantly increased MECP2 promoter methylation was seen in autistic male frontal cortex compared to controls (Nagarajan et al., 2006). Rare mutations and genetic association with MECP2 has been identified in autistic individuals (Loat et al., 2008), with de novo loss-of-function variants observed in four ASD probands (Carney et al., 2003; Wang et al., 2016). In addition, autism and other neuropsychiatric symptoms are prevalent in individuals with MECP2 duplication syndrome (Ramocki et al., 2009). Wen et al., 2017 identified two female ASD probands with de novo variants in the MECP2 gene (one nonsense variant and one missense variant that was experimentally shown to have a possible loss-of-function effect), as well as a maternally-inherited missense variant that was experimentally shown to affect dendritic and axonal growth in a male ASD proband.
1/1/2021

Score remained at 1
Description
Mutations in MECP2 cause Rett syndrome (Amir et al., 1999), which has been recognized as an autism spectrum disorder (DSM-IV). MECP2 mutations were identified in four females and one male with a clinical diagnosis of Angelman syndrome (Watson et al., 2001). Brain samples from several related neurodevelopmental disorders, including autism, pervasive developmental disorder, Prader-Willi and Angelman syndromes showed significant differences in MECP2 expression from age-matched controls by apparently different transcriptional and post-transcriptional mechanisms (Samaco et al., 2004). Significant defects in UBE3A/E6AP and GABRB3 expression has been observed in MECP2 deficient mice and human Rett, Angelman and autism brains compared with controls (Samaco et al., 2005). A significant reduction in frontal cortex MECP2 expression compared to age-matched controls was found in autism (79%), RTT (100%), Angelman syndrome (100%), Prader-Willi syndrome (75%), Down syndrome (60%), and attention deficit hyperactivity disorder (100%) samples. As well, significantly increased MECP2 promoter methylation was seen in autistic male frontal cortex compared to controls (Nagarajan et al., 2006). Rare mutations and genetic association with MECP2 has been identified in autistic individuals (Loat et al., 2008), with de novo loss-of-function variants observed in four ASD probands (Carney et al., 2003; Wang et al., 2016). In addition, autism and other neuropsychiatric symptoms are prevalent in individuals with MECP2 duplication syndrome (Ramocki et al., 2009). Wen et al., 2017 identified two female ASD probands with de novo variants in the MECP2 gene (one nonsense variant and one missense variant that was experimentally shown to have a possible loss-of-function effect), as well as a maternally-inherited missense variant that was experimentally shown to affect dendritic and axonal growth in a male ASD proband.
7/1/2020

Score remained at 1
Description
Mutations in MECP2 cause Rett syndrome (Amir et al., 1999), which has been recognized as an autism spectrum disorder (DSM-IV). MECP2 mutations were identified in four females and one male with a clinical diagnosis of Angelman syndrome (Watson et al., 2001). Brain samples from several related neurodevelopmental disorders, including autism, pervasive developmental disorder, Prader-Willi and Angelman syndromes showed significant differences in MECP2 expression from age-matched controls by apparently different transcriptional and post-transcriptional mechanisms (Samaco et al., 2004). Significant defects in UBE3A/E6AP and GABRB3 expression has been observed in MECP2 deficient mice and human Rett, Angelman and autism brains compared with controls (Samaco et al., 2005). A significant reduction in frontal cortex MECP2 expression compared to age-matched controls was found in autism (79%), RTT (100%), Angelman syndrome (100%), Prader-Willi syndrome (75%), Down syndrome (60%), and attention deficit hyperactivity disorder (100%) samples. As well, significantly increased MECP2 promoter methylation was seen in autistic male frontal cortex compared to controls (Nagarajan et al., 2006). Rare mutations and genetic association with MECP2 has been identified in autistic individuals (Loat et al., 2008), with de novo loss-of-function variants observed in four ASD probands (Carney et al., 2003; Wang et al., 2016). In addition, autism and other neuropsychiatric symptoms are prevalent in individuals with MECP2 duplication syndrome (Ramocki et al., 2009). Wen et al., 2017 identified two female ASD probands with de novo variants in the MECP2 gene (one nonsense variant and one missense variant that was experimentally shown to have a possible loss-of-function effect), as well as a maternally-inherited missense variant that was experimentally shown to affect dendritic and axonal growth in a male ASD proband.
Reports Added
[Targeted re-sequencing for early diagnosis of genetic causes of childhood epilepsy: the Italian experience from the 'beyond epilepsy' project2020] [Next Generation Sequencing of 134 Children with Autism Spectrum Disorder and Regression2020] [Graded and pan-neural disease phenotypes of Rett Syndrome linked with dosage of functional MeCP22020]4/1/2020

Score remained at 1
Description
Mutations in MECP2 cause Rett syndrome (Amir et al., 1999), which has been recognized as an autism spectrum disorder (DSM-IV). MECP2 mutations were identified in four females and one male with a clinical diagnosis of Angelman syndrome (Watson et al., 2001). Brain samples from several related neurodevelopmental disorders, including autism, pervasive developmental disorder, Prader-Willi and Angelman syndromes showed significant differences in MECP2 expression from age-matched controls by apparently different transcriptional and post-transcriptional mechanisms (Samaco et al., 2004). Significant defects in UBE3A/E6AP and GABRB3 expression has been observed in MECP2 deficient mice and human Rett, Angelman and autism brains compared with controls (Samaco et al., 2005). A significant reduction in frontal cortex MECP2 expression compared to age-matched controls was found in autism (79%), RTT (100%), Angelman syndrome (100%), Prader-Willi syndrome (75%), Down syndrome (60%), and attention deficit hyperactivity disorder (100%) samples. As well, significantly increased MECP2 promoter methylation was seen in autistic male frontal cortex compared to controls (Nagarajan et al., 2006). Rare mutations and genetic association with MECP2 has been identified in autistic individuals (Loat et al., 2008), with de novo loss-of-function variants observed in four ASD probands (Carney et al., 2003; Wang et al., 2016). In addition, autism and other neuropsychiatric symptoms are prevalent in individuals with MECP2 duplication syndrome (Ramocki et al., 2009). Wen et al., 2017 identified two female ASD probands with de novo variants in the MECP2 gene (one nonsense variant and one missense variant that was experimentally shown to have a possible loss-of-function effect), as well as a maternally-inherited missense variant that was experimentally shown to affect dendritic and axonal growth in a male ASD proband.
1/1/2020

Score remained at 1
Description
Mutations in MECP2 cause Rett syndrome (Amir et al., 1999), which has been recognized as an autism spectrum disorder (DSM-IV). MECP2 mutations were identified in four females and one male with a clinical diagnosis of Angelman syndrome (Watson et al., 2001). Brain samples from several related neurodevelopmental disorders, including autism, pervasive developmental disorder, Prader-Willi and Angelman syndromes showed significant differences in MECP2 expression from age-matched controls by apparently different transcriptional and post-transcriptional mechanisms (Samaco et al., 2004). Significant defects in UBE3A/E6AP and GABRB3 expression has been observed in MECP2 deficient mice and human Rett, Angelman and autism brains compared with controls (Samaco et al., 2005). A significant reduction in frontal cortex MECP2 expression compared to age-matched controls was found in autism (79%), RTT (100%), Angelman syndrome (100%), Prader-Willi syndrome (75%), Down syndrome (60%), and attention deficit hyperactivity disorder (100%) samples. As well, significantly increased MECP2 promoter methylation was seen in autistic male frontal cortex compared to controls (Nagarajan et al., 2006). Rare mutations and genetic association with MECP2 has been identified in autistic individuals (Loat et al., 2008), with de novo loss-of-function variants observed in four ASD probands (Carney et al., 2003; Wang et al., 2016). In addition, autism and other neuropsychiatric symptoms are prevalent in individuals with MECP2 duplication syndrome (Ramocki et al., 2009). Wen et al., 2017 identified two female ASD probands with de novo variants in the MECP2 gene (one nonsense variant and one missense variant that was experimentally shown to have a possible loss-of-function effect), as well as a maternally-inherited missense variant that was experimentally shown to affect dendritic and axonal growth in a male ASD proband.
10/1/2019

Decreased from 2S to 1
New Scoring Scheme
Description
Mutations in MECP2 cause Rett syndrome (Amir et al., 1999), which has been recognized as an autism spectrum disorder (DSM-IV). MECP2 mutations were identified in four females and one male with a clinical diagnosis of Angelman syndrome (Watson et al., 2001). Brain samples from several related neurodevelopmental disorders, including autism, pervasive developmental disorder, Prader-Willi and Angelman syndromes showed significant differences in MECP2 expression from age-matched controls by apparently different transcriptional and post-transcriptional mechanisms (Samaco et al., 2004). Significant defects in UBE3A/E6AP and GABRB3 expression has been observed in MECP2 deficient mice and human Rett, Angelman and autism brains compared with controls (Samaco et al., 2005). A significant reduction in frontal cortex MECP2 expression compared to age-matched controls was found in autism (79%), RTT (100%), Angelman syndrome (100%), Prader-Willi syndrome (75%), Down syndrome (60%), and attention deficit hyperactivity disorder (100%) samples. As well, significantly increased MECP2 promoter methylation was seen in autistic male frontal cortex compared to controls (Nagarajan et al., 2006). Rare mutations and genetic association with MECP2 has been identified in autistic individuals (Loat et al., 2008), with de novo loss-of-function variants observed in four ASD probands (Carney et al., 2003; Wang et al., 2016). In addition, autism and other neuropsychiatric symptoms are prevalent in individuals with MECP2 duplication syndrome (Ramocki et al., 2009). Wen et al., 2017 identified two female ASD probands with de novo variants in the MECP2 gene (one nonsense variant and one missense variant that was experimentally shown to have a possible loss-of-function effect), as well as a maternally-inherited missense variant that was experimentally shown to affect dendritic and axonal growth in a male ASD proband.
7/1/2019

Decreased from 2S to 2S
Description
Mutations in MECP2 cause Rett syndrome (Amir et al., 1999), which has been recognized as an autism spectrum disorder (DSM-IV). MECP2 mutations were identified in four females and one male with a clinical diagnosis of Angelman syndrome (Watson et al., 2001). Brain samples from several related neurodevelopmental disorders, including autism, pervasive developmental disorder, Prader-Willi and Angelman syndromes showed significant differences in MECP2 expression from age-matched controls by apparently different transcriptional and post-transcriptional mechanisms (Samaco et al., 2004). Significant defects in UBE3A/E6AP and GABRB3 expression has been observed in MECP2 deficient mice and human Rett, Angelman and autism brains compared with controls (Samaco et al., 2005). A significant reduction in frontal cortex MECP2 expression compared to age-matched controls was found in autism (79%), RTT (100%), Angelman syndrome (100%), Prader-Willi syndrome (75%), Down syndrome (60%), and attention deficit hyperactivity disorder (100%) samples. As well, significantly increased MECP2 promoter methylation was seen in autistic male frontal cortex compared to controls (Nagarajan et al., 2006). Rare mutations and genetic association with MECP2 has been identified in autistic individuals (Loat et al., 2008), with de novo loss-of-function variants observed in four ASD probands (Carney et al., 2003; Wang et al., 2016). In addition, autism and other neuropsychiatric symptoms are prevalent in individuals with MECP2 duplication syndrome (Ramocki et al., 2009). Wen et al., 2017 identified two female ASD probands with de novo variants in the MECP2 gene (one nonsense variant and one missense variant that was experimentally shown to have a possible loss-of-function effect), as well as a maternally-inherited missense variant that was experimentally shown to affect dendritic and axonal growth in a male ASD proband.
Reports Added
[Lessons Learned from Large-Scale, First-Tier Clinical Exome Sequencing in a Highly Consanguineous Population.2019] [Comprehensive Analysis of Rare Variants of 101 Autism-Linked Genes in a Hungarian Cohort of Autism Spectrum Disorder Patients.2019] [The Clinical and Genetic Features of Co-occurring Epilepsy and Autism Spectrum Disorder in Chinese Children.2019] [Diagnostic Yields of Trio-WES Accompanied by CNVseq for Rare Neurodevelopmental Disorders.2019] [Characterization of intellectual disability and autism comorbidity through gene panel sequencing.2019]4/1/2019

Decreased from 2S to 2S
Description
Mutations in MECP2 cause Rett syndrome (Amir et al., 1999), which has been recognized as an autism spectrum disorder (DSM-IV). MECP2 mutations were identified in four females and one male with a clinical diagnosis of Angelman syndrome (Watson et al., 2001). Brain samples from several related neurodevelopmental disorders, including autism, pervasive developmental disorder, Prader-Willi and Angelman syndromes showed significant differences in MECP2 expression from age-matched controls by apparently different transcriptional and post-transcriptional mechanisms (Samaco et al., 2004). Significant defects in UBE3A/E6AP and GABRB3 expression has been observed in MECP2 deficient mice and human Rett, Angelman and autism brains compared with controls (Samaco et al., 2005). A significant reduction in frontal cortex MECP2 expression compared to age-matched controls was found in autism (79%), RTT (100%), Angelman syndrome (100%), Prader-Willi syndrome (75%), Down syndrome (60%), and attention deficit hyperactivity disorder (100%) samples. As well, significantly increased MECP2 promoter methylation was seen in autistic male frontal cortex compared to controls (Nagarajan et al., 2006). Rare mutations and genetic association with MECP2 has been identified in autistic individuals (Loat et al., 2008), with de novo loss-of-function variants observed in four ASD probands (Carney et al., 2003; Wang et al., 2016). In addition, autism and other neuropsychiatric symptoms are prevalent in individuals with MECP2 duplication syndrome (Ramocki et al., 2009). Wen et al., 2017 identified two female ASD probands with de novo variants in the MECP2 gene (one nonsense variant and one missense variant that was experimentally shown to have a possible loss-of-function effect), as well as a maternally-inherited missense variant that was experimentally shown to affect dendritic and axonal growth in a male ASD proband.
Reports Added
[Elucidation of the phenotypic spectrum and genetic landscape in primary and secondary microcephaly.2019] [The combination of whole-exome sequencing and copy number variation sequencing enables the diagnosis of rare neurological disorders.2019] [Neurological Diseases With Autism Spectrum Disorder: Role of ASD Risk Genes.2019]1/1/2019

Decreased from 2S to 2S
Description
Mutations in MECP2 cause Rett syndrome (Amir et al., 1999), which has been recognized as an autism spectrum disorder (DSM-IV). MECP2 mutations were identified in four females and one male with a clinical diagnosis of Angelman syndrome (Watson et al., 2001). Brain samples from several related neurodevelopmental disorders, including autism, pervasive developmental disorder, Prader-Willi and Angelman syndromes showed significant differences in MECP2 expression from age-matched controls by apparently different transcriptional and post-transcriptional mechanisms (Samaco et al., 2004). Significant defects in UBE3A/E6AP and GABRB3 expression has been observed in MECP2 deficient mice and human Rett, Angelman and autism brains compared with controls (Samaco et al., 2005). A significant reduction in frontal cortex MECP2 expression compared to age-matched controls was found in autism (79%), RTT (100%), Angelman syndrome (100%), Prader-Willi syndrome (75%), Down syndrome (60%), and attention deficit hyperactivity disorder (100%) samples. As well, significantly increased MECP2 promoter methylation was seen in autistic male frontal cortex compared to controls (Nagarajan et al., 2006). Rare mutations and genetic association with MECP2 has been identified in autistic individuals (Loat et al., 2008), with de novo loss-of-function variants observed in four ASD probands (Carney et al., 2003; Wang et al., 2016). In addition, autism and other neuropsychiatric symptoms are prevalent in individuals with MECP2 duplication syndrome (Ramocki et al., 2009). Wen et al., 2017 identified two female ASD probands with de novo variants in the MECP2 gene (one nonsense variant and one missense variant that was experimentally shown to have a possible loss-of-function effect), as well as a maternally-inherited missense variant that was experimentally shown to affect dendritic and axonal growth in a male ASD proband.
10/1/2018

Decreased from 2S to 2S
Description
Mutations in MECP2 cause Rett syndrome (Amir et al., 1999), which has been recognized as an autism spectrum disorder (DSM-IV). MECP2 mutations were identified in four females and one male with a clinical diagnosis of Angelman syndrome (Watson et al., 2001). Brain samples from several related neurodevelopmental disorders, including autism, pervasive developmental disorder, Prader-Willi and Angelman syndromes showed significant differences in MECP2 expression from age-matched controls by apparently different transcriptional and post-transcriptional mechanisms (Samaco et al., 2004). Significant defects in UBE3A/E6AP and GABRB3 expression has been observed in MECP2 deficient mice and human Rett, Angelman and autism brains compared with controls (Samaco et al., 2005). A significant reduction in frontal cortex MECP2 expression compared to age-matched controls was found in autism (79%), RTT (100%), Angelman syndrome (100%), Prader-Willi syndrome (75%), Down syndrome (60%), and attention deficit hyperactivity disorder (100%) samples. As well, significantly increased MECP2 promoter methylation was seen in autistic male frontal cortex compared to controls (Nagarajan et al., 2006). Rare mutations and genetic association with MECP2 has been identified in autistic individuals (Loat et al., 2008), with de novo loss-of-function variants observed in four ASD probands (Carney et al., 2003; Wang et al., 2016). In addition, autism and other neuropsychiatric symptoms are prevalent in individuals with MECP2 duplication syndrome (Ramocki et al., 2009). Wen et al., 2017 identified two female ASD probands with de novo variants in the MECP2 gene (one nonsense variant and one missense variant that was experimentally shown to have a possible loss-of-function effect), as well as a maternally-inherited missense variant that was experimentally shown to affect dendritic and axonal growth in a male ASD proband.
7/1/2018

Decreased from 2S to 2S
Description
Mutations in MECP2 cause Rett syndrome (Amir et al., 1999), which has been recognized as an autism spectrum disorder (DSM-IV). MECP2 mutations were identified in four females and one male with a clinical diagnosis of Angelman syndrome (Watson et al., 2001). Brain samples from several related neurodevelopmental disorders, including autism, pervasive developmental disorder, Prader-Willi and Angelman syndromes showed significant differences in MECP2 expression from age-matched controls by apparently different transcriptional and post-transcriptional mechanisms (Samaco et al., 2004). Significant defects in UBE3A/E6AP and GABRB3 expression has been observed in MECP2 deficient mice and human Rett, Angelman and autism brains compared with controls (Samaco et al., 2005). A significant reduction in frontal cortex MECP2 expression compared to age-matched controls was found in autism (79%), RTT (100%), Angelman syndrome (100%), Prader-Willi syndrome (75%), Down syndrome (60%), and attention deficit hyperactivity disorder (100%) samples. As well, significantly increased MECP2 promoter methylation was seen in autistic male frontal cortex compared to controls (Nagarajan et al., 2006). Rare mutations and genetic association with MECP2 has been identified in autistic individuals (Loat et al., 2008), with de novo loss-of-function variants observed in four ASD probands (Carney et al., 2003; Wang et al., 2016). In addition, autism and other neuropsychiatric symptoms are prevalent in individuals with MECP2 duplication syndrome (Ramocki et al., 2009). Wen et al., 2017 identified two female ASD probands with de novo variants in the MECP2 gene (one nonsense variant and one missense variant that was experimentally shown to have a possible loss-of-function effect), as well as a maternally-inherited missense variant that was experimentally shown to affect dendritic and axonal growth in a male ASD proband.
10/1/2017

Decreased from 2S to 2S
Description
Mutations in MECP2 cause Rett syndrome (Amir et al., 1999), which has been recognized as an autism spectrum disorder (DSM-IV). MECP2 mutations were identified in four females and one male with a clinical diagnosis of Angelman syndrome (Watson et al., 2001). Brain samples from several related neurodevelopmental disorders, including autism, pervasive developmental disorder, Prader-Willi and Angelman syndromes showed significant differences in MECP2 expression from age-matched controls by apparently different transcriptional and post-transcriptional mechanisms (Samaco et al., 2004). Significant defects in UBE3A/E6AP and GABRB3 expression has been observed in MECP2 deficient mice and human Rett, Angelman and autism brains compared with controls (Samaco et al., 2005). A significant reduction in frontal cortex MECP2 expression compared to age-matched controls was found in autism (79%), RTT (100%), Angelman syndrome (100%), Prader-Willi syndrome (75%), Down syndrome (60%), and attention deficit hyperactivity disorder (100%) samples. As well, significantly increased MECP2 promoter methylation was seen in autistic male frontal cortex compared to controls (Nagarajan et al., 2006). Rare mutations and genetic association with MECP2 has been identified in autistic individuals (Loat et al., 2008), with de novo loss-of-function variants observed in four ASD probands (Carney et al., 2003; Wang et al., 2016). In addition, autism and other neuropsychiatric symptoms are prevalent in individuals with MECP2 duplication syndrome (Ramocki et al., 2009). Wen et al., 2017 identified two female ASD probands with de novo variants in the MECP2 gene (one nonsense variant and one missense variant that was experimentally shown to have a possible loss-of-function effect), as well as a maternally-inherited missense variant that was experimentally shown to affect dendritic and axonal growth in a male ASD proband.
7/1/2017

Decreased from 2S to 2S
Description
Mutations in MECP2 cause Rett syndrome (Amir et al., 1999), which has been recognized as an autism spectrum disorder (DSM-IV). MECP2 mutations were identified in four females and one male with a clinical diagnosis of Angelman syndrome (Watson et al., 2001). Brain samples from several related neurodevelopmental disorders, including autism, pervasive developmental disorder, Prader-Willi and Angelman syndromes showed significant differences in MECP2 expression from age-matched controls by apparently different transcriptional and post-transcriptional mechanisms (Samaco et al., 2004). Significant defects in UBE3A/E6AP and GABRB3 expression has been observed in MECP2 deficient mice and human Rett, Angelman and autism brains compared with controls (Samaco et al., 2005). A significant reduction in frontal cortex MECP2 expression compared to age-matched controls was found in autism (79%), RTT (100%), Angelman syndrome (100%), Prader-Willi syndrome (75%), Down syndrome (60%), and attention deficit hyperactivity disorder (100%) samples. As well, significantly increased MECP2 promoter methylation was seen in autistic male frontal cortex compared to controls (Nagarajan et al., 2006). Rare mutations and genetic association with MECP2 has been identified in autistic individuals (Loat et al., 2008), with de novo loss-of-function variants observed in four ASD probands (Carney et al., 2003; Wang et al., 2016). In addition, autism and other neuropsychiatric symptoms are prevalent in individuals with MECP2 duplication syndrome (Ramocki et al., 2009). Wen et al., 2017 identified two female ASD probands with de novo variants in the MECP2 gene (one nonsense variant and one missense variant that was experimentally shown to have a possible loss-of-function effect), as well as a maternally-inherited missense variant that was experimentally shown to affect dendritic and axonal growth in a male ASD proband.
4/1/2017

Decreased from 2S to 2S
Description
Mutations in MECP2 cause Rett syndrome (Amir et al., 1999), which has been recognized as an autism spectrum disorder (DSM-IV). MECP2 mutations were identified in four females and one male with a clinical diagnosis of Angelman syndrome (Watson et al., 2001). Brain samples from several related neurodevelopmental disorders, including autism, pervasive developmental disorder, Prader-Willi and Angelman syndromes showed significant differences in MECP2 expression from age-matched controls by apparently different transcriptional and post-transcriptional mechanisms (Samaco et al., 2004). Significant defects in UBE3A/E6AP and GABRB3 expression has been observed in MECP2 deficient mice and human Rett, Angelman and autism brains compared with controls (Samaco et al., 2005). A significant reduction in frontal cortex MECP2 expression compared to age-matched controls was found in autism (79%), RTT (100%), Angelman syndrome (100%), Prader-Willi syndrome (75%), Down syndrome (60%), and attention deficit hyperactivity disorder (100%) samples. As well, significantly increased MECP2 promoter methylation was seen in autistic male frontal cortex compared to controls (Nagarajan et al., 2006). Rare mutations and genetic association with MECP2 has been identified in autistic individuals (Loat et al., 2008), with de novo loss-of-function variants observed in four ASD probands (Carney et al., 2003; Wang et al., 2016). In addition, autism and other neuropsychiatric symptoms are prevalent in individuals with MECP2 duplication syndrome (Ramocki et al., 2009).
Reports Added
[Identification of MeCP2 mutations in a series of females with autistic disorder.2003] [Oligogenic heterozygosity in individuals with high-functioning autism spectrum disorders.2011] [A partial MECP2 duplication in a mildly affected adult male: a putative role for the 3' untranslated region in the MECP2 duplication phenotype.2012] [The expanding role of MBD genes in autism: identification of a MECP2 duplication and novel alterations in MBD5, MBD6, and SETDB1.2012] [Using whole-exome sequencing to identify inherited causes of autism.2013] [Rare complete knockouts in humans: population distribution and significant role in autism spectrum disorders.2013] [Reciprocal co-regulation of EGR2 and MECP2 is disrupted in Rett syndrome and autism.2008] [Chromosome 2 deletion encompassing the MAP2 gene in a patient with autism and Rett-like features.2004] [MECP2 structural and 3'-UTR variants in schizophrenia, autism and other psychiatric diseases: a possible association with autism.2004] [A MECP2 missense mutation within the MBD domain in a Brazilian male with autistic disorder.2011] [Large-scale discovery of novel genetic causes of developmental disorders.2014] [Range of genetic mutations associated with severe non-syndromic sporadic intellectual disability: an exome sequencing study.2012] [Efficient strategy for the molecular diagnosis of intellectual disability using targeted high-throughput sequencing.2014] [A mutation in the rett syndrome gene, MECP2, causes X-linked mental retardation and progressive spasticity in males.2000] [MECP2 mutation in male patients with non-specific X-linked mental retardation.2000] [MECP2 is highly mutated in X-linked mental retardation.2001] [In-frame deletion in MECP2 causes mild nonspecific mental retardation.2002] [Neurodevelopmental disorders in males related to the gene causing Rett syndrome in females (MECP2).2003] [Submicroscopic duplication in Xq28 causes increased expression of the MECP2 gene in a boy with severe mental retardation and features of Rett syndr...2005] [A novel familial MECP2 mutation in a young boy: clinical and molecular findings.2006] [A MECP2 mutation in a highly conserved aminoacid causing mental retardation in a male.2008] [Rett syndrome is caused by mutations in X-linked MECP2, encoding methyl-CpG-binding protein 2.1999] [Preserved speech variant is allelic of classic Rett syndrome.2000] [No mutations in the coding region of the Rett syndrome gene MECP2 in 59 autistic patients.2001] [Study of MECP2 gene in Rett syndrome variants and autistic girls.2003] [De novo mutations in schizophrenia implicate chromatin remodeling and support a genetic overlap with autism and intellectual disability.2014] [MeCP2 is a transcriptional repressor with abundant binding sites in genomic chromatin.1997] [Transcriptional repression by the methyl-CpG-binding protein MeCP2 involves a histone deacetylase complex.1998] [Genetic modifiers of MeCP2 function in Drosophila.2008] [Deletion of Mecp2 in Sim1-expressing neurons reveals a critical role for MeCP2 in feeding behavior, aggression, and the response to stress.2008] [MECP2 genomic structure and function: insights from ENCODE.2008] [MeCP2 deficiency disrupts axonal guidance, fasciculation, and targeting by altering Semaphorin 3F function.2009] [Neuronal MeCP2 is expressed at near histone-octamer levels and globally alters the chromatin state.2010] [Dysfunction in GABA signalling mediates autism-like stereotypies and Rett syndrome phenotypes.2010] [L1 retrotransposition in neurons is modulated by MeCP2.2010] [Genome-wide activity-dependent MeCP2 phosphorylation regulates nervous system development and function.2011] [Overexpression of methyl-CpG binding protein 2 impairs T(H)1 responses.2012] [MeCP2 binds to 5hmC enriched within active genes and accessible chromatin in the nervous system.2012] [Bisphenol A delays the perinatal chloride shift in cortical neurons by epigenetic effects on the Kcc2 promoter.2013] [An AT-hook domain in MeCP2 determines the clinical course of Rett syndrome and related disorders.2013] [Rett syndrome mutations abolish the interaction of MeCP2 with the NCoR/SMRT co-repressor.2013] [Activity-dependent phosphorylation of MeCP2 threonine 308 regulates interaction with NCoR.2013] [Transcriptional regulation of the MET receptor tyrosine kinase gene by MeCP2 and sex-specific expression in autism and Rett syndrome.2013] [Oligodendrocyte lineage cells contribute unique features to Rett syndrome neuropathology.2013] [Increased binding of MeCP2 to the GAD1 and RELN promoters may be mediated by an enrichment of 5-hmC in autism spectrum disorder (ASD) cerebellum.2014] [GluD1 is a common altered player in neuronal differentiation from both MECP2-mutated and CDKL5-mutated iPS cells.2014] [Next-generation sequencing using a pre-designed gene panel for the molecular diagnosis of congenital disorders in pediatric patients.2015] [Comprehensive molecular testing in patients with high functioning autism spectrum disorder.2016] [Mutations in epilepsy and intellectual disability genes in patients with features of Rett syndrome.2015] [MECP2 missense mutations outside the canonical MBD and TRD domains in males with intellectual disability.2015] [The MECP2 variant c.925C>T (p.Arg309Trp) causes intellectual disability in both males and females without classic features of Rett syndrome.2016] [Effectiveness of exome and genome sequencing guided by acuity of illness for diagnosis of neurodevelopmental disorders.2014] [Identification of Intellectual Disability Genes in Female Patients with A Skewed X Inactivation Pattern.2016] [Identification of a RAI1-associated disease network through integration of exome sequencing, transcriptomics, and 3D genomics.2016] [De novo genic mutations among a Chinese autism spectrum disorder cohort.2016] [Clinical exome sequencing: results from 2819 samples reflecting 1000 families.2016] [Diagnostic Targeted Resequencing in 349 Patients with Drug-Resistant Pediatric Epilepsies Identifies Causative Mutations in 30 Different Genes.2016] [Asperger syndrome and early-onset schizophrenia associated with a novel MECP2 deleterious missense variant.2017] [Whole genome sequencing resource identifies 18 new candidate genes for autism spectrum disorder2017] [A clinical utility study of exome sequencing versus conventional genetic testing in pediatric neurology.2017] [Mapping autosomal recessive intellectual disability: combined microarray and exome sequencing identifies 26 novel candidate genes in 192 consanguin...2017] [Familial cases and male cases with MECP2 mutations.2017] [Genomic diagnosis for children with intellectual disability and/or developmental delay.2017]1/1/2017

Decreased from 2S to 2S
Description
Mutations in MECP2 cause Rett syndrome (Amir et al., 1999), which has been recognized as an autism spectrum disorder (DSM-IV). MECP2 mutations were identified in four females and one male with a clinical diagnosis of Angelman syndrome (Watson et al., 2001). Brain samples from several related neurodevelopmental disorders, including autism, pervasive developmental disorder, Prader-Willi and Angelman syndromes showed significant differences in MECP2 expression from age-matched controls by apparently different transcriptional and post-transcriptional mechanisms (Samaco et al., 2004). Significant defects in UBE3A/E6AP and GABRB3 expression has been observed in MECP2 deficient mice and human Rett, Angelman and autism brains compared with controls (Samaco et al., 2005). A significant reduction in frontal cortex MECP2 expression compared to age-matched controls was found in autism (79%), RTT (100%), Angelman syndrome (100%), Prader-Willi syndrome (75%), Down syndrome (60%), and attention deficit hyperactivity disorder (100%) samples. As well, significantly increased MECP2 promoter methylation was seen in autistic male frontal cortex compared to controls (Nagarajan et al., 2006). Rare mutations and genetic association with MECP2 has been identified in autistic individuals (Loat et al., 2008), with de novo loss-of-function variants observed in four ASD probands (Carney et al., 2003; Wang et al., 2016). In addition, autism and other neuropsychiatric symptoms are prevalent in individuals with MECP2 duplication syndrome (Ramocki et al., 2009).
10/1/2016

Increased from S to 2S
Description
Mutations in MECP2 cause Rett syndrome (Amir et al., 1999), which has been recognized as an autism spectrum disorder (DSM-IV). MECP2 mutations were identified in four females and one male with a clinical diagnosis of Angelman syndrome (Watson et al., 2001). Brain samples from several related neurodevelopmental disorders, including autism, pervasive developmental disorder, Prader-Willi and Angelman syndromes showed significant differences in MECP2 expression from age-matched controls by apparently different transcriptional and post-transcriptional mechanisms (Samaco et al., 2004). Significant defects in UBE3A/E6AP and GABRB3 expression has been observed in MECP2 deficient mice and human Rett, Angelman and autism brains compared with controls (Samaco et al., 2005). A significant reduction in frontal cortex MECP2 expression compared to age-matched controls was found in autism (79%), RTT (100%), Angelman syndrome (100%), Prader-Willi syndrome (75%), Down syndrome (60%), and attention deficit hyperactivity disorder (100%) samples. As well, significantly increased MECP2 promoter methylation was seen in autistic male frontal cortex compared to controls (Nagarajan et al., 2006). Rare mutations and genetic association with MECP2 has been identified in autistic individuals (Loat et al., 2008), with de novo loss-of-function variants observed in four ASD probands (Carney et al., 2003; Wang et al., 2016). In addition, autism and other neuropsychiatric symptoms are prevalent in individuals with MECP2 duplication syndrome (Ramocki et al., 2009).
Reports Added
[Identification of a RAI1-associated disease network through integration of exome sequencing, transcriptomics, and 3D genomics.2016] [De novo genic mutations among a Chinese autism spectrum disorder cohort.2016] [Clinical exome sequencing: results from 2819 samples reflecting 1000 families.2016]4/1/2016

Increased from S to S
Description
Mutations in MECP2 cause Rett syndrome (Amir et al., 1999), which has been recognized as an autism spectrum disorder (DSM-IV). MECP2 mutations were identified in four females and one male with a clinical diagnosis of Angelman syndrome (Watson et al., 2001). Brain samples from several related neurodevelopmental disorders, including autism, pervasive developmental disorder, Prader-Willi and Angelman syndromes showed significant differences in MECP2 expression from age-matched controls by apparently different transcriptional and post-transcriptional mechanisms (Samaco et al., 2004). Significant defects in UBE3A/E6AP and GABRB3 expression has been observed in MECP2 deficient mice and human Rett, Angelman and autism brains compared with controls (Samaco et al., 2005). A significant reduction in frontal cortex MECP2 expression compared to age-matched controls was found in autism (79%), RTT (100%), Angelman syndrome (100%), Prader-Willi syndrome (75%), Down syndrome (60%), and attention deficit hyperactivity disorder (100%) samples. As well, significantly increased MECP2 promoter methylation was seen in autistic male frontal cortex compared to controls (Nagarajan et al., 2006). Rare mutations and genetic association with MECP2 has been identified in autistic individuals (Loat et al., 2008). In addition, autism and other neuropsychiatric symptoms are prevalent in individuals with MECP2 duplication syndrome (Ramocki et al., 2009).
Reports Added
[Identification of MeCP2 mutations in a series of females with autistic disorder.2003] [Oligogenic heterozygosity in individuals with high-functioning autism spectrum disorders.2011] [A partial MECP2 duplication in a mildly affected adult male: a putative role for the 3' untranslated region in the MECP2 duplication phenotype.2012] [The expanding role of MBD genes in autism: identification of a MECP2 duplication and novel alterations in MBD5, MBD6, and SETDB1.2012] [Using whole-exome sequencing to identify inherited causes of autism.2013] [Rare complete knockouts in humans: population distribution and significant role in autism spectrum disorders.2013] [Reciprocal co-regulation of EGR2 and MECP2 is disrupted in Rett syndrome and autism.2008] [Chromosome 2 deletion encompassing the MAP2 gene in a patient with autism and Rett-like features.2004] [MECP2 structural and 3'-UTR variants in schizophrenia, autism and other psychiatric diseases: a possible association with autism.2004] [A MECP2 missense mutation within the MBD domain in a Brazilian male with autistic disorder.2011] [Large-scale discovery of novel genetic causes of developmental disorders.2014] [Range of genetic mutations associated with severe non-syndromic sporadic intellectual disability: an exome sequencing study.2012] [Efficient strategy for the molecular diagnosis of intellectual disability using targeted high-throughput sequencing.2014] [A mutation in the rett syndrome gene, MECP2, causes X-linked mental retardation and progressive spasticity in males.2000] [MECP2 mutation in male patients with non-specific X-linked mental retardation.2000] [MECP2 is highly mutated in X-linked mental retardation.2001] [In-frame deletion in MECP2 causes mild nonspecific mental retardation.2002] [Neurodevelopmental disorders in males related to the gene causing Rett syndrome in females (MECP2).2003] [Submicroscopic duplication in Xq28 causes increased expression of the MECP2 gene in a boy with severe mental retardation and features of Rett syndr...2005] [A novel familial MECP2 mutation in a young boy: clinical and molecular findings.2006] [A MECP2 mutation in a highly conserved aminoacid causing mental retardation in a male.2008] [Rett syndrome is caused by mutations in X-linked MECP2, encoding methyl-CpG-binding protein 2.1999] [Preserved speech variant is allelic of classic Rett syndrome.2000] [No mutations in the coding region of the Rett syndrome gene MECP2 in 59 autistic patients.2001] [Study of MECP2 gene in Rett syndrome variants and autistic girls.2003] [De novo mutations in schizophrenia implicate chromatin remodeling and support a genetic overlap with autism and intellectual disability.2014] [MeCP2 is a transcriptional repressor with abundant binding sites in genomic chromatin.1997] [Transcriptional repression by the methyl-CpG-binding protein MeCP2 involves a histone deacetylase complex.1998] [Genetic modifiers of MeCP2 function in Drosophila.2008] [Deletion of Mecp2 in Sim1-expressing neurons reveals a critical role for MeCP2 in feeding behavior, aggression, and the response to stress.2008] [MECP2 genomic structure and function: insights from ENCODE.2008] [MeCP2 deficiency disrupts axonal guidance, fasciculation, and targeting by altering Semaphorin 3F function.2009] [Neuronal MeCP2 is expressed at near histone-octamer levels and globally alters the chromatin state.2010] [Dysfunction in GABA signalling mediates autism-like stereotypies and Rett syndrome phenotypes.2010] [L1 retrotransposition in neurons is modulated by MeCP2.2010] [Genome-wide activity-dependent MeCP2 phosphorylation regulates nervous system development and function.2011] [Overexpression of methyl-CpG binding protein 2 impairs T(H)1 responses.2012] [MeCP2 binds to 5hmC enriched within active genes and accessible chromatin in the nervous system.2012] [Bisphenol A delays the perinatal chloride shift in cortical neurons by epigenetic effects on the Kcc2 promoter.2013] [An AT-hook domain in MeCP2 determines the clinical course of Rett syndrome and related disorders.2013] [Rett syndrome mutations abolish the interaction of MeCP2 with the NCoR/SMRT co-repressor.2013] [Activity-dependent phosphorylation of MeCP2 threonine 308 regulates interaction with NCoR.2013] [Transcriptional regulation of the MET receptor tyrosine kinase gene by MeCP2 and sex-specific expression in autism and Rett syndrome.2013] [Oligodendrocyte lineage cells contribute unique features to Rett syndrome neuropathology.2013] [Increased binding of MeCP2 to the GAD1 and RELN promoters may be mediated by an enrichment of 5-hmC in autism spectrum disorder (ASD) cerebellum.2014] [GluD1 is a common altered player in neuronal differentiation from both MECP2-mutated and CDKL5-mutated iPS cells.2014] [Next-generation sequencing using a pre-designed gene panel for the molecular diagnosis of congenital disorders in pediatric patients.2015] [Comprehensive molecular testing in patients with high functioning autism spectrum disorder.2016] [Mutations in epilepsy and intellectual disability genes in patients with features of Rett syndrome.2015] [MECP2 missense mutations outside the canonical MBD and TRD domains in males with intellectual disability.2015] [The MECP2 variant c.925C>T (p.Arg309Trp) causes intellectual disability in both males and females without classic features of Rett syndrome.2016] [Effectiveness of exome and genome sequencing guided by acuity of illness for diagnosis of neurodevelopmental disorders.2014] [Identification of Intellectual Disability Genes in Female Patients with A Skewed X Inactivation Pattern.2016]1/1/2016

Increased from S to S
Description
Mutations in MECP2 cause Rett syndrome (Amir et al., 1999), which has been recognized as an autism spectrum disorder (DSM-IV). MECP2 mutations were identified in four females and one male with a clinical diagnosis of Angelman syndrome (Watson et al., 2001). Brain samples from several related neurodevelopmental disorders, including autism, pervasive developmental disorder, Prader-Willi and Angelman syndromes showed significant differences in MECP2 expression from age-matched controls by apparently different transcriptional and post-transcriptional mechanisms (Samaco et al., 2004). Significant defects in UBE3A/E6AP and GABRB3 expression has been observed in MECP2 deficient mice and human Rett, Angelman and autism brains compared with controls (Samaco et al., 2005). A significant reduction in frontal cortex MECP2 expression compared to age-matched controls was found in autism (79%), RTT (100%), Angelman syndrome (100%), Prader-Willi syndrome (75%), Down syndrome (60%), and attention deficit hyperactivity disorder (100%) samples. As well, significantly increased MECP2 promoter methylation was seen in autistic male frontal cortex compared to controls (Nagarajan et al., 2006). Rare mutations and genetic association with MECP2 has been identified in autistic individuals (Loat et al., 2008). In addition, autism and other neuropsychiatric symptoms are prevalent in individuals with MECP2 duplication syndrome (Ramocki et al., 2009).
Reports Added
[Identification of MeCP2 mutations in a series of females with autistic disorder.2003] [Oligogenic heterozygosity in individuals with high-functioning autism spectrum disorders.2011] [A partial MECP2 duplication in a mildly affected adult male: a putative role for the 3' untranslated region in the MECP2 duplication phenotype.2012] [The expanding role of MBD genes in autism: identification of a MECP2 duplication and novel alterations in MBD5, MBD6, and SETDB1.2012] [Using whole-exome sequencing to identify inherited causes of autism.2013] [Rare complete knockouts in humans: population distribution and significant role in autism spectrum disorders.2013] [Reciprocal co-regulation of EGR2 and MECP2 is disrupted in Rett syndrome and autism.2008] [Chromosome 2 deletion encompassing the MAP2 gene in a patient with autism and Rett-like features.2004] [MECP2 structural and 3'-UTR variants in schizophrenia, autism and other psychiatric diseases: a possible association with autism.2004] [A MECP2 missense mutation within the MBD domain in a Brazilian male with autistic disorder.2011] [Large-scale discovery of novel genetic causes of developmental disorders.2014] [Range of genetic mutations associated with severe non-syndromic sporadic intellectual disability: an exome sequencing study.2012] [Efficient strategy for the molecular diagnosis of intellectual disability using targeted high-throughput sequencing.2014] [A mutation in the rett syndrome gene, MECP2, causes X-linked mental retardation and progressive spasticity in males.2000] [MECP2 mutation in male patients with non-specific X-linked mental retardation.2000] [MECP2 is highly mutated in X-linked mental retardation.2001] [In-frame deletion in MECP2 causes mild nonspecific mental retardation.2002] [Neurodevelopmental disorders in males related to the gene causing Rett syndrome in females (MECP2).2003] [Submicroscopic duplication in Xq28 causes increased expression of the MECP2 gene in a boy with severe mental retardation and features of Rett syndr...2005] [A novel familial MECP2 mutation in a young boy: clinical and molecular findings.2006] [A MECP2 mutation in a highly conserved aminoacid causing mental retardation in a male.2008] [Rett syndrome is caused by mutations in X-linked MECP2, encoding methyl-CpG-binding protein 2.1999] [Preserved speech variant is allelic of classic Rett syndrome.2000] [No mutations in the coding region of the Rett syndrome gene MECP2 in 59 autistic patients.2001] [Study of MECP2 gene in Rett syndrome variants and autistic girls.2003] [De novo mutations in schizophrenia implicate chromatin remodeling and support a genetic overlap with autism and intellectual disability.2014] [MeCP2 is a transcriptional repressor with abundant binding sites in genomic chromatin.1997] [Transcriptional repression by the methyl-CpG-binding protein MeCP2 involves a histone deacetylase complex.1998] [Genetic modifiers of MeCP2 function in Drosophila.2008] [Deletion of Mecp2 in Sim1-expressing neurons reveals a critical role for MeCP2 in feeding behavior, aggression, and the response to stress.2008] [MECP2 genomic structure and function: insights from ENCODE.2008] [MeCP2 deficiency disrupts axonal guidance, fasciculation, and targeting by altering Semaphorin 3F function.2009] [Neuronal MeCP2 is expressed at near histone-octamer levels and globally alters the chromatin state.2010] [Dysfunction in GABA signalling mediates autism-like stereotypies and Rett syndrome phenotypes.2010] [L1 retrotransposition in neurons is modulated by MeCP2.2010] [Genome-wide activity-dependent MeCP2 phosphorylation regulates nervous system development and function.2011] [Overexpression of methyl-CpG binding protein 2 impairs T(H)1 responses.2012] [MeCP2 binds to 5hmC enriched within active genes and accessible chromatin in the nervous system.2012] [Bisphenol A delays the perinatal chloride shift in cortical neurons by epigenetic effects on the Kcc2 promoter.2013] [An AT-hook domain in MeCP2 determines the clinical course of Rett syndrome and related disorders.2013] [Rett syndrome mutations abolish the interaction of MeCP2 with the NCoR/SMRT co-repressor.2013] [Activity-dependent phosphorylation of MeCP2 threonine 308 regulates interaction with NCoR.2013] [Transcriptional regulation of the MET receptor tyrosine kinase gene by MeCP2 and sex-specific expression in autism and Rett syndrome.2013] [Oligodendrocyte lineage cells contribute unique features to Rett syndrome neuropathology.2013] [Increased binding of MeCP2 to the GAD1 and RELN promoters may be mediated by an enrichment of 5-hmC in autism spectrum disorder (ASD) cerebellum.2014] [GluD1 is a common altered player in neuronal differentiation from both MECP2-mutated and CDKL5-mutated iPS cells.2014] [Next-generation sequencing using a pre-designed gene panel for the molecular diagnosis of congenital disorders in pediatric patients.2015] [Comprehensive molecular testing in patients with high functioning autism spectrum disorder.2016] [Mutations in epilepsy and intellectual disability genes in patients with features of Rett syndrome.2015] [MECP2 missense mutations outside the canonical MBD and TRD domains in males with intellectual disability.2015]1/1/2015

Increased from S to S
Description
Mutations in MECP2 cause Rett syndrome (Amir et al., 1999), which has been recognized as an autism spectrum disorder (DSM-IV). MECP2 mutations were identified in four females and one male with a clinical diagnosis of Angelman syndrome (Watson et al., 2001). Brain samples from several related neurodevelopmental disorders, including autism, pervasive developmental disorder, Prader-Willi and Angelman syndromes showed significant differences in MECP2 expression from age-matched controls by apparently different transcriptional and post-transcriptional mechanisms (Samaco et al., 2004). Significant defects in UBE3A/E6AP and GABRB3 expression has been observed in MECP2 deficient mice and human Rett, Angelman and autism brains compared with controls (Samaco et al., 2005). A significant reduction in frontal cortex MECP2 expression compared to age-matched controls was found in autism (79%), RTT (100%), Angelman syndrome (100%), Prader-Willi syndrome (75%), Down syndrome (60%), and attention deficit hyperactivity disorder (100%) samples. As well, significantly increased MECP2 promoter methylation was seen in autistic male frontal cortex compared to controls (Nagarajan et al., 2006). Rare mutations and genetic association with MECP2 has been identified in autistic individuals (Loat et al., 2008). In addition, autism and other neuropsychiatric symptoms are prevalent in individuals with MECP2 duplication syndrome (Ramocki et al., 2009).
Reports Added
[Rare complete knockouts in humans: population distribution and significant role in autism spectrum disorders.2013] [Large-scale discovery of novel genetic causes of developmental disorders.2014] [Efficient strategy for the molecular diagnosis of intellectual disability using targeted high-throughput sequencing.2014]7/1/2014

Increased from No data to S
Description
Mutations in MECP2 cause Rett syndrome (Amir et al., 1999), which has been recognized as an autism spectrum disorder (DSM-IV). MECP2 mutations were identified in four females and one male with a clinical diagnosis of Angelman syndrome (Watson et al., 2001). Brain samples from several related neurodevelopmental disorders, including autism, pervasive developmental disorder, Prader-Willi and Angelman syndromes showed significant differences in MECP2 expression from age-matched controls by apparently different transcriptional and post-transcriptional mechanisms (Samaco et al., 2004). Significant defects in UBE3A/E6AP and GABRB3 expression has been observed in MECP2 deficient mice and human Rett, Angelman and autism brains compared with controls (Samaco et al., 2005). A significant reduction in frontal cortex MECP2 expression compared to age-matched controls was found in autism (79%), RTT (100%), Angelman syndrome (100%), Prader-Willi syndrome (75%), Down syndrome (60%), and attention deficit hyperactivity disorder (100%) samples. As well, significantly increased MECP2 promoter methylation was seen in autistic male frontal cortex compared to controls (Nagarajan et al., 2006). Rare mutations and genetic association with MECP2 has been identified in autistic individuals (Loat et al., 2008). In addition, autism and other neuropsychiatric symptoms are prevalent in individuals with MECP2 duplication syndrome (Ramocki et al., 2009).
Reports Added
[MeCP2 is a transcriptional repressor with abundant binding sites in genomic chromatin.1997] [Transcriptional repression by the methyl-CpG-binding protein MeCP2 involves a histone deacetylase complex.1998] [Rett syndrome is caused by mutations in X-linked MECP2, encoding methyl-CpG-binding protein 2.1999] [A mutation in the rett syndrome gene, MECP2, causes X-linked mental retardation and progressive spasticity in males.2000] [MECP2 mutation in male patients with non-specific X-linked mental retardation.2000] [MECP2 is highly mutated in X-linked mental retardation.2001] [No mutations in the coding region of the Rett syndrome gene MECP2 in 59 autistic patients.2001] [In-frame deletion in MECP2 causes mild nonspecific mental retardation.2002] [Neurodevelopmental disorders in males related to the gene causing Rett syndrome in females (MECP2).2003] [Identification of MeCP2 mutations in a series of females with autistic disorder.2003] [Chromosome 2 deletion encompassing the MAP2 gene in a patient with autism and Rett-like features.2004] [MECP2 structural and 3'-UTR variants in schizophrenia, autism and other psychiatric diseases: a possible association with autism.2004] [Submicroscopic duplication in Xq28 causes increased expression of the MECP2 gene in a boy with severe mental retardation and features of Rett syndr...2005] [A novel familial MECP2 mutation in a young boy: clinical and molecular findings.2006] [A MECP2 mutation in a highly conserved aminoacid causing mental retardation in a male.2008] [Genetic modifiers of MeCP2 function in Drosophila.2008] [Deletion of Mecp2 in Sim1-expressing neurons reveals a critical role for MeCP2 in feeding behavior, aggression, and the response to stress.2008] [MECP2 genomic structure and function: insights from ENCODE.2008] [Reciprocal co-regulation of EGR2 and MECP2 is disrupted in Rett syndrome and autism.2008] [MeCP2 deficiency disrupts axonal guidance, fasciculation, and targeting by altering Semaphorin 3F function.2009] [Neuronal MeCP2 is expressed at near histone-octamer levels and globally alters the chromatin state.2010] [Dysfunction in GABA signalling mediates autism-like stereotypies and Rett syndrome phenotypes.2010] [L1 retrotransposition in neurons is modulated by MeCP2.2010] [A MECP2 missense mutation within the MBD domain in a Brazilian male with autistic disorder.2011] [Oligogenic heterozygosity in individuals with high-functioning autism spectrum disorders.2011] [Genome-wide activity-dependent MeCP2 phosphorylation regulates nervous system development and function.2011] [A partial MECP2 duplication in a mildly affected adult male: a putative role for the 3' untranslated region in the MECP2 duplication phenotype.2012] [Range of genetic mutations associated with severe non-syndromic sporadic intellectual disability: an exome sequencing study.2012] [The expanding role of MBD genes in autism: identification of a MECP2 duplication and novel alterations in MBD5, MBD6, and SETDB1.2012] [Overexpression of methyl-CpG binding protein 2 impairs T(H)1 responses.2012] [MeCP2 binds to 5hmC enriched within active genes and accessible chromatin in the nervous system.2012] [Using whole-exome sequencing to identify inherited causes of autism.2013] [Bisphenol A delays the perinatal chloride shift in cortical neurons by epigenetic effects on the Kcc2 promoter.2013] [An AT-hook domain in MeCP2 determines the clinical course of Rett syndrome and related disorders.2013] [Rett syndrome mutations abolish the interaction of MeCP2 with the NCoR/SMRT co-repressor.2013] [Activity-dependent phosphorylation of MeCP2 threonine 308 regulates interaction with NCoR.2013] [Transcriptional regulation of the MET receptor tyrosine kinase gene by MeCP2 and sex-specific expression in autism and Rett syndrome.2013] [Oligodendrocyte lineage cells contribute unique features to Rett syndrome neuropathology.2013] [Increased binding of MeCP2 to the GAD1 and RELN promoters may be mediated by an enrichment of 5-hmC in autism spectrum disorder (ASD) cerebellum.2014] [De novo mutations in schizophrenia implicate chromatin remodeling and support a genetic overlap with autism and intellectual disability.2014] [GluD1 is a common altered player in neuronal differentiation from both MECP2-mutated and CDKL5-mutated iPS cells.2014] [Preserved speech variant is allelic of classic Rett syndrome.2000] [Study of MECP2 gene in Rett syndrome variants and autistic girls.2003]4/1/2014

Increased from No data to S
Description
Mutations in MECP2 cause Rett syndrome (Amir et al., 1999), which has been recognized as an autism spectrum disorder (DSM-IV). MECP2 mutations were identified in four females and one male with a clinical diagnosis of Angelman syndrome (Watson et al., 2001). Brain samples from several related neurodevelopmental disorders, including autism, pervasive developmental disorder, Prader-Willi and Angelman syndromes showed significant differences in MECP2 expression from age-matched controls by apparently different transcriptional and post-transcriptional mechanisms (Samaco et al., 2004). Significant defects in UBE3A/E6AP and GABRB3 expression has been observed in MECP2 deficient mice and human Rett, Angelman and autism brains compared with controls (Samaco et al., 2005). A significant reduction in frontal cortex MECP2 expression compared to age-matched controls was found in autism (79%), RTT (100%), Angelman syndrome (100%), Prader-Willi syndrome (75%), Down syndrome (60%), and attention deficit hyperactivity disorder (100%) samples. As well, significantly increased MECP2 promoter methylation was seen in autistic male frontal cortex compared to controls (Nagarajan et al., 2006). Rare mutations and genetic association with MECP2 has been identified in autistic individuals (Loat et al., 2008). In addition, autism and other neuropsychiatric symptoms are prevalent in individuals with MECP2 duplication syndrome (Ramocki et al., 2009).
Krishnan Probability Score
Score 0.6106260748291
Ranking 217/25841 scored genes
[Show Scoring Methodology]
ExAC Score
Score 0.69808904772491
Ranking 4487/18225 scored genes
[Show Scoring Methodology]
Sanders TADA Score
Score 0.93461063590805
Ranking 12621/18665 scored genes
[Show Scoring Methodology]
Zhang D Score
Score 0.67938632481065
Ranking 7/20870 scored genes
[Show Scoring Methodology]
Interactome
- Protein Binding
- DNA Binding
- RNA Binding
- Protein Modification
- Direct Regulation
- ASD-Linked Genes
Interaction Table
| Interactor Symbol | Interactor Name | Interactor Organism | Interactor Type | Entrez ID | Uniprot ID |
|---|---|---|---|---|---|
| 7-Sep | septin 7 | Human | DNA Binding | 989 | A8K3D0 |
| ABCB1 | ATP-binding cassette, sub-family B (MDR/TAP), member 1 | Human | DNA Binding | 5243 | A4D1D2 |
| ABCG2 | ATP-binding cassette, sub-family G (WHITE), member 2 | Human | DNA Binding | 9429 | Q9UNQ0 |
| ANKRD2 | ankyrin repeat domain 2 (stretch responsive muscle) | Human | DNA Binding | 26287 | Q9GZV1 |
| C18ORF21 | UPF0711 protein C18orf21 | Human | Protein Binding | 83608 | Q32NC0 |
| CamKIV | Calcium/calmodulin-dependent protein kinase type IV | Mouse | Direct Regulation | P08414 | |
| Cdk10 | cyclin-dependent kinase 10 | Mouse | RNA Binding | 234854 | Q0VH02 |
| CHRFAM7A | CHRNA7 (cholinergic receptor, nicotinic, alpha 7, exons 5-10) and FAM7A (family with sequence similarity 7A, exons A-E) fusion | Human | DNA Binding | 89832 | Q494W8 |
| DDX25 | DEAD (Asp-Glu-Ala-Asp) box helicase 25 | Human | Protein Binding | 29118 | Q9UHL0 |
| Dlx4 | distal-less homeobox 4 | Mouse | DNA Binding | 1748 | Q92988 |
| DLX6 | distal-less homeobox 6 | Human | DNA Binding | 1750 | J3KR92 |
| EGR2 | early growth response 2 | Human | DNA Binding | 1959 | P11161 |
| Fam19a1 | family with sequence similarity 19, member A1 | Mouse | DNA Binding | 320265 | Q7TPG8 |
| Fam203a | family with sequence similarity 203, member A | Mouse | DNA Binding | 59053 | Q8C3I8 |
| Gadd45b | Growth arrest and DNA-damage-inducible 45 beta | Rat | Direct Regulation | 299626 | Q5U3Z2 |
| Gpaa1 | GPI anchor attachment protein 1 | Mouse | DNA Binding | 14731 | Q9WTK3 |
| gs17 | gastrula-specific protein 17 | African clawed frog | Direct Regulation | 397898 | P07733 |
| GTF2F2 | general transcription factor IIF, polypeptide 2, 30kDa | Human | DNA Binding | 2963 | P13984 |
| hes4-a | hairy and enhancer of split 4 | African clawed frog | Direct Regulation | 398579 | Q90Z12 |
| Ifng | interferon gamma | Mouse | DNA Binding | 15978 | P01580 |
| IGF2 | insulin-like growth factor 2 (somatomedin A) | Human | DNA Binding | 3481 | P01344 |
| IGFBP2 | insulin-like growth factor binding protein 2, 36kDa | Human | DNA Binding | 3485 | P18065 |
| KIF25-AS1 | KIF25 antisense RNA 1 | Human | DNA Binding | 100505879 | Q9Y6Z4 |
| Kirrel2 | kin of IRRE like 2 (Drosophila) | Mouse | DNA Binding | 243911 | Q7TSU7 |
| LOC407840 | oviduct protein p20 | African clawed frog | Protein Binding | 407840 | Q6Q2J3 |
| MAGEA2 | melanoma antigen family A, 2 | Human | DNA Binding | 4101 | P43356 |
| MAGEA3 | melanoma antigen family A, 3 | Human | DNA Binding | 4102 | P43357 |
| miR-132 | microRNA 132 | Mouse | Direct Regulation | 387150 | N/A |
| miR-212 | microRNA 212 | Mouse | Direct Regulation | 387208 | N/A |
| miR-432 | microRNA 432 | Human | RNA Binding | 574451 | N/A |
| Mir106a | microRNA 106a | Mouse | DNA Binding | 723829 | N/A |
| Mir124b | microRNA 124b | Mouse | DNA Binding | 387234 | N/A |
| Mir128-2 | microRNA 128-2 | Mouse | DNA Binding | 723815 | N/A |
| MIR132 | microRNA 132 | Human | DNA Binding | 406921 | N/A |
| Mir134 | microRNA 134 | Mouse | DNA Binding | 387152 | N/A |
| Mir135a1 | microRNA 135a-1 | Mouse | DNA Binding | 387153 | N/A |
| Mir137 | microRNA 137 | Mouse | DNA Binding | 387155 | N/A |
| Mir139 | microRNA 139 | Mouse | DNA Binding | 387157 | N/A |
| Mir143 | microRNA 143 | Mouse | DNA Binding | 387161 | N/A |
| Mir145 | microRNA 145 | Mouse | DNA Binding | 387163 | N/A |
| Mir148b | microRNA 148b | Mouse | DNA Binding | 724064 | N/A |
| Mir150 | microRNA 150 | Mouse | DNA Binding | 387168 | N/A |
| Mir151 | microRNA 151 | Mouse | DNA Binding | 387169 | N/A |
| MIR152 | microRNA 152 | Human | DNA Binding | 406943 | N/A |
| Mir154 | microRNA 154 | Mouse | DNA Binding | 387172 | N/A |
| Mir18 | microRNA 18 | Mouse | DNA Binding | 387135 | N/A |
| Mir181c | microRNA 181c | Mouse | DNA Binding | 723819 | N/A |
| Mir193b | microRNA 193b | Mouse | DNA Binding | 100124432 | N/A |
| Mir195 | microRNA 195 | Mouse | DNA Binding | 387190 | N/A |
| Mir19a | microRNA 19a | Mouse | DNA Binding | 723891 | N/A |
| Mir204 | microRNA 204 | Mouse | DNA Binding | 387200 | N/A |
| Mir205 | microRNA 205 | Mouse | DNA Binding | 387201 | N/A |
| Mir207 | microRNA 207 | Mouse | DNA Binding | 387203 | N/A |
| Mir20a | microRNA 20a | Mouse | DNA Binding | 387139 | N/A |
| Mir211 | microRNA 211 | Mouse | DNA Binding | 387207 | N/A |
| Mir25 | microRNA 25 | Mouse | DNA Binding | 723926 | N/A |
| Mir28 | microRNA 28 | Mouse | DNA Binding | 723830 | N/A |
| Mir299 | microRNA 299 | Mouse | DNA Binding | 723927 | N/A |
| Mir300 | microRNA 300 | Mouse | DNA Binding | 723833 | N/A |
| Mir302a | microRNA 302a | Mouse | DNA Binding | 723920 | N/A |
| Mir302b | microRNA 302b | Mouse | DNA Binding | 723948 | N/A |
| Mir302c | microRNA 302c | Mouse | DNA Binding | 723835 | N/A |
| Mir302d | microRNA 302d | Mouse | DNA Binding | 723928 | N/A |
| Mir30c-1 | microRNA 30c-1 | Mouse | DNA Binding | 387227 | N/A |
| Mir30e | microRNA 30e | Mouse | DNA Binding | 723836 | N/A |
| Mir323 | microRNA 323 | Mouse | DNA Binding | 723839 | N/A |
| Mir326 | microRNA 326 | Mouse | DNA Binding | 723840 | N/A |
| Mir329 | microRNA 329 | Mouse | DNA Binding | 723842 | N/A |
| Mir33 | microRNA 33 | Mouse | DNA Binding | 723897 | N/A |
| Mir330 | microRNA 330 | Mouse | DNA Binding | 724063 | N/A |
| Mir338 | microRNA 338 | Mouse | DNA Binding | 723844 | N/A |
| Mir339 | microRNA 339 | Mouse | DNA Binding | 723898 | N/A |
| Mir341 | microRNA 341 | Mouse | DNA Binding | 723846 | N/A |
| Mir345 | microRNA 345 | Mouse | DNA Binding | 723946 | N/A |
| Mir34b | microRNA 34b | Mouse | DNA Binding | 723849 | N/A |
| Mir34c | microRNA 34c | Mouse | DNA Binding | 723932 | N/A |
| Mir365-1 | microRNA 365-1 | Mouse | DNA Binding | 723899 | N/A |
| Mir367 | microRNA 367 | Mouse | DNA Binding | 723911 | N/A |
| Mir369 | microRNA 369 | Mouse | DNA Binding | 723933 | N/A |
| Mir370 | microRNA 370 | Mouse | DNA Binding | 723854 | N/A |
| Mir376a | microRNA 376a | Mouse | DNA Binding | 723855 | N/A |
| Mir376b | microRNA 376b | Mouse | DNA Binding | 723934 | N/A |
| Mir376c | microRNA 376c | Mouse | DNA Binding | 723856 | N/A |
| Mir377 | microRNA 377 | Mouse | DNA Binding | 723857 | N/A |
| Mir378 | microRNA 378 | Mouse | DNA Binding | 723889 | N/A |
| Mir379 | microRNA 379 | Mouse | DNA Binding | 723858 | N/A |
| Mir380 | microRNA 380 | Mouse | DNA Binding | 723859 | N/A |
| Mir381 | microRNA 381 | Mouse | DNA Binding | 723935 | N/A |
| Mir382 | microRNA 382 | Mouse | DNA Binding | 723912 | N/A |
| Mir409 | microRNA 409 | Mouse | DNA Binding | 723862 | N/A |
| Mir410 | microRNA 410 | Mouse | DNA Binding | 723863 | N/A |
| Mir411 | microRNA 411 | Mouse | DNA Binding | 723936 | N/A |
| Mir412 | microRNA 412 | Mouse | DNA Binding | 723913 | N/A |
| Mir449a | microRNA 449a | Mouse | DNA Binding | 723868 | N/A |
| Mir449b | microRNA 449b | Mouse | DNA Binding | 100190765 | N/A |
| Mir453 | microRNA 453 | Mouse | DNA Binding | 100124484 | N/A |
| Mir485 | microRNA 485 | Mouse | DNA Binding | 723875 | N/A |
| Mir487b | microRNA 487b | Mouse | DNA Binding | 723940 | N/A |
| Mir488 | microRNA 488 | Mouse | DNA Binding | 735253 | N/A |
| Mir494 | microRNA 494 | Mouse | DNA Binding | 723878 | N/A |
| Mir495 | microRNA 495 | Mouse | DNA Binding | 751522 | N/A |
| Mir496 | microRNA 496 | Mouse | DNA Binding | 751524 | N/A |
| Mir497 | microRNA 497 | Mouse | DNA Binding | 751537 | N/A |
| Mir539 | microRNA 539 | Mouse | DNA Binding | 723917 | N/A |
| Mir541 | microRNA 541 | Mouse | DNA Binding | 723941 | N/A |
| Mir543 | microRNA 543 | Mouse | DNA Binding | 723881 | N/A |
| Mir544 | microRNA 544 | Mouse | DNA Binding | 100124450 | N/A |
| Mir654 | microRNA 654 | Mouse | DNA Binding | 100124453 | N/A |
| Mir666 | microRNA 666 | Mouse | DNA Binding | 751521 | N/A |
| Mir671 | microRNA 671 | Mouse | DNA Binding | 735264 | N/A |
| Mir7-1 | microRNA 7-1 | Mouse | DNA Binding | 723902 | N/A |
| Mir708 | microRNA 708 | Mouse | DNA Binding | 735284 | N/A |
| Mir758 | microRNA 758 | Mouse | DNA Binding | 791071 | N/A |
| Mir802 | microRNA 802 | Mouse | DNA Binding | 791074 | N/A |
| Mir882 | microRNA 882 | Mouse | DNA Binding | 100124461 | N/A |
| Mir93 | microRNA 93 | Mouse | DNA Binding | 723885 | N/A |
| MT1A | metallothionein 1A | Human | DNA Binding | 4489 | P04731 |
| Mug1 | murinoglobulin 1 | Mouse | DNA Binding | 17836 | P28665 |
| Mug2 | murinoglobulin 2 | Mouse | DNA Binding | 17837 | P28666 |
| Myo3a | myosin IIIA | Mouse | DNA Binding | 667663 | F6QNG5 |
| Mypop | Myb-related transcription factor, partner of profilin | Mouse | DNA Binding | 232934 | Q8R4U1 |
| Nfkbiz | nuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor, zeta | Mouse | DNA Binding | 80859 | Q9EST8 |
| Nnmt | nicotinamide N-methyltransferase | Mouse | DNA Binding | 18113 | O55239 |
| Oplah | 5-oxoprolinase (ATP-hydrolysing) | Mouse | DNA Binding | 75475 | Q8K010 |
| OR4K1 | olfactory receptor, family 4, subfamily K, member 1 | Human | DNA Binding | 79544 | Q8NGD4 |
| OR4Q3 | olfactory receptor, family 4, subfamily Q, member 3 | Human | DNA Binding | 441669 | Q8NH05 |
| PCDHB1 | protocadherin beta 1 | Human | DNA Binding | 29930 | Q9Y5F3 |
| PCDHB7 | protocadherin beta 7 | Human | DNA Binding | 56129 | Q9Y5E2 |
| Pdyn | prodynorphin | Rat | DNA Binding | 29190 | F1M7S3 |
| PLA2G16 | phospholipase A2, group XVI | Human | DNA Binding | 11145 | P53816 |
| RASSF1 | Ras association (RalGDS/AF-6) domain family member 1 | Human | DNA Binding | 11186 | Q9NS23 |
| Rsph6a | radial spoke head 6 homolog A (Chlamydomonas) | Mouse | DNA Binding | 83434 | Q8CDR2 |
| SDHD | succinate dehydrogenase complex, subunit D, integral membrane protein | Human | DNA Binding | 6392 | O14521 |
| Six5 | sine oculis-related homeobox 5 | Mouse | DNA Binding | 20475 | P70178 |
| SNAT1 | solute carrier family 38, member 1 | Mouse | DNA Binding | 105727 | Q8K2P7 |
| SNURF | SNRPN upstream reading frame | Human | DNA Binding | 8926 | Q9Y675 |
| Spi1 | spleen focus forming virus (SFFV) proviral integration oncogene spi1 | Mouse | Protein Binding | 20375 | P17433 |
| Syt13 | synaptotagmin XIII | Mouse | DNA Binding | 80976 | Q9EQT6 |
| SYT3 | synaptotagmin III | Human | DNA Binding | 20981 | G3X9Y1 |
| t-a | T, brachyury homolog | African clawed frog | Direct Regulation | 399275 | P24781 |
| Tac4 | tachykinin 4 | Mouse | DNA Binding | 93670 | Q99N14 |
| TAF1C | TATA box-binding protein-associated factor RNA polymerase I subunit C | Human | Protein Binding | 9013 | Q15572-6 |
| Tsix | X (inactive)-specific transcript, antisense | Mouse | DNA Binding | 22097 | N/A |
| TSSC1 | tumor suppressing subtransferable candidate 1 | Human | DNA Binding | 7260 | Q53HC9 |
| Uba1y | ubiquitin-activating enzyme, Chr Y | Mouse | DNA Binding | 22202 | P31254 |
| WDR83OS | WD repeat domain 83 opposite strand | Human | DNA Binding | 51398 | Q9Y284 |
| ZNF593 | Zinc finger protein 593 | Human | Protein Binding | 51042 | O00488 |