Human Gene Module / Chromosome X / MECP2

MECP2Methyl CpG binding protein 2

Score
2S
Strong Candidate, Syndromic Criteria 2.1, Syndromic
Autism Reports / Total Reports
15 / 63
Rare Variants / Common Variants
128 / 0
Aliases
MECP2, RTS,  RTT,  PPMX,  MRX16,  MRX79,  AUTSX3,  DKFZp686A24160
Associated Syndromes
ASD (Asperger syndrome), Rett syndrome, X-linked intellectual disability, Rett syndrome
Genetic Category
Rare Single Gene Mutation, Syndromic, Functional
Chromosome Band
Xq28
Associated Disorders
EP, ADHD, DD/NDD, EPS, ASD, SCZ, ID
Relevance to Autism

Mutations in the MECP2 gene underlie Rett syndrome, an autism spectrum disorder. Some studies have found that rare variations in the MECP2 gene are associated with autism, while others have looked and found no variants in autistic patients. It appears that EGR2 and MECP2 can regulate each other's expression (Swanberg et al., 2009).

Molecular Function

The encoded protein has methylation-dependent transcriptional repressor activity . It is also involved in regulation of RNA splicing.

Reports related to MECP2 (63 Reports)
# Type Title Author, Year Autism Report Associated Disorders
1 Primary Rett syndrome is caused by mutations in X-linked MECP2, encoding methyl-CpG-binding protein 2. Amir RE , et al. (1999) No -
2 Support Preserved speech variant is allelic of classic Rett syndrome. De Bona C , et al. (2000) No -
3 Support A mutation in the rett syndrome gene, MECP2, causes X-linked mental retardation and progressive spasticity in males. Meloni I , et al. (2000) No -
4 Support MECP2 mutation in male patients with non-specific X-linked mental retardation. Orrico A , et al. (2000) No -
5 Support MECP2 is highly mutated in X-linked mental retardation. Couvert P , et al. (2001) No -
6 Negative Association No mutations in the coding region of the Rett syndrome gene MECP2 in 59 autistic patients. Vourc'h P , et al. (2001) No -
7 Support In-frame deletion in MECP2 causes mild nonspecific mental retardation. Yntema HG , et al. (2002) No -
8 Support Neurodevelopmental disorders in males related to the gene causing Rett syndrome in females (MECP2). Moog U , et al. (2003) No -
9 Support Study of MECP2 gene in Rett syndrome variants and autistic girls. Zappella M , et al. (2003) No ASD
10 Support Identification of MeCP2 mutations in a series of females with autistic disorder. Carney RM , et al. (2003) Yes -
11 Support Chromosome 2 deletion encompassing the MAP2 gene in a patient with autism and Rett-like features. Pescucci C , et al. (2004) Yes -
12 Positive Association MECP2 structural and 3'-UTR variants in schizophrenia, autism and other psychiatric diseases: a possible association with autism. Shibayama A , et al. (2004) Yes SCZ
13 Support Submicroscopic duplication in Xq28 causes increased expression of the MECP2 gene in a boy with severe mental retardation and features of Rett syndr... Meins M , et al. (2005) No RTT
14 Support A novel familial MECP2 mutation in a young boy: clinical and molecular findings. Ventura P , et al. (2006) No Epilepsy
15 Recent Recommendation A MECP2 mutation in a highly conserved aminoacid causing mental retardation in a male. Campos M Jr , et al. (2008) No -
16 Recent Recommendation Genetic modifiers of MeCP2 function in Drosophila. Cukier HN , et al. (2008) No -
17 Recent Recommendation Deletion of Mecp2 in Sim1-expressing neurons reveals a critical role for MeCP2 in feeding behavior, aggression, and the response to stress. Fyffe SL , et al. (2008) No -
18 Recent Recommendation MECP2 genomic structure and function: insights from ENCODE. Singh J , et al. (2008) No -
19 Recent Recommendation Reciprocal co-regulation of EGR2 and MECP2 is disrupted in Rett syndrome and autism. Swanberg SE , et al. (2008) Yes -
20 Recent Recommendation MeCP2 deficiency disrupts axonal guidance, fasciculation, and targeting by altering Semaphorin 3F function. Degano AL , et al. (2009) No -
21 Recent Recommendation Neuronal MeCP2 is expressed at near histone-octamer levels and globally alters the chromatin state. Skene PJ , et al. (2010) No -
22 Recent Recommendation Dysfunction in GABA signalling mediates autism-like stereotypies and Rett syndrome phenotypes. Chao HT , et al. (2010) No -
23 Recent Recommendation L1 retrotransposition in neurons is modulated by MeCP2. Muotri AR , et al. (2010) No -
24 Support A MECP2 missense mutation within the MBD domain in a Brazilian male with autistic disorder. Campos M Jr , et al. (2011) Yes -
25 Support Oligogenic heterozygosity in individuals with high-functioning autism spectrum disorders. Schaaf CP , et al. (2011) Yes -
26 Recent Recommendation Genome-wide activity-dependent MeCP2 phosphorylation regulates nervous system development and function. Cohen S , et al. (2011) No -
27 Support A partial MECP2 duplication in a mildly affected adult male: a putative role for the 3' untranslated region in the MECP2 duplication phenotype. Hanchard NA , et al. (2012) Yes ADHD, epilepsy
28 Support Range of genetic mutations associated with severe non-syndromic sporadic intellectual disability: an exome sequencing study. Rauch A , et al. (2012) No Epilepsy, ASD
29 Support The expanding role of MBD genes in autism: identification of a MECP2 duplication and novel alterations in MBD5, MBD6, and SETDB1. Cukier HN , et al. (2012) Yes -
30 Recent Recommendation Overexpression of methyl-CpG binding protein 2 impairs T(H)1 responses. Yang T , et al. (2012) No -
31 Recent Recommendation MeCP2 binds to 5hmC enriched within active genes and accessible chromatin in the nervous system. Melln M , et al. (2012) No -
32 Support Rare complete knockouts in humans: population distribution and significant role in autism spectrum disorders. Lim ET , et al. (2013) Yes -
33 Support Using whole-exome sequencing to identify inherited causes of autism. Yu TW , et al. (2013) Yes -
34 Recent Recommendation Bisphenol A delays the perinatal chloride shift in cortical neurons by epigenetic effects on the Kcc2 promoter. Yeo M , et al. (2013) No -
35 Recent Recommendation An AT-hook domain in MeCP2 determines the clinical course of Rett syndrome and related disorders. Baker SA , et al. (2013) No -
36 Recent Recommendation Rett syndrome mutations abolish the interaction of MeCP2 with the NCoR/SMRT co-repressor. Lyst MJ , et al. (2013) No -
37 Recent Recommendation Activity-dependent phosphorylation of MeCP2 threonine 308 regulates interaction with NCoR. Ebert DH , et al. (2013) No -
38 Recent Recommendation Transcriptional regulation of the MET receptor tyrosine kinase gene by MeCP2 and sex-specific expression in autism and Rett syndrome. Plummer JT , et al. (2013) No -
39 Recent Recommendation Oligodendrocyte lineage cells contribute unique features to Rett syndrome neuropathology. Nguyen MV , et al. (2013) No -
40 Recent Recommendation Increased binding of MeCP2 to the GAD1 and RELN promoters may be mediated by an enrichment of 5-hmC in autism spectrum disorder (ASD) cerebellum. Zhubi A , et al. (2014) No -
41 Support De novo mutations in schizophrenia implicate chromatin remodeling and support a genetic overlap with autism and intellectual disability. McCarthy SE , et al. (2014) No -
42 Recent recommendation GluD1 is a common altered player in neuronal differentiation from both MECP2-mutated and CDKL5-mutated iPS cells. Livide G , et al. (2014) No -
43 Support Efficient strategy for the molecular diagnosis of intellectual disability using targeted high-throughput sequencing. Redin C , et al. (2014) No -
44 Support Effectiveness of exome and genome sequencing guided by acuity of illness for diagnosis of neurodevelopmental disorders. Soden SE , et al. (2014) No ADHD (1 case)
45 Support Large-scale discovery of novel genetic causes of developmental disorders. Deciphering Developmental Disorders Study (2014) No Stereotypic behavior
46 Support Mutations in epilepsy and intellectual disability genes in patients with features of Rett syndrome. Olson HE , et al. (2015) No Epilepsy
47 Support MECP2 missense mutations outside the canonical MBD and TRD domains in males with intellectual disability. Bianciardi L , et al. (2015) No ASD (1 case)
48 Support Next-generation sequencing using a pre-designed gene panel for the molecular diagnosis of congenital disorders in pediatric patients. Lim EC , et al. (2015) No Developmental regression, hypotonia
49 Support Comprehensive molecular testing in patients with high functioning autism spectrum disorder. Alvarez-Mora MI , et al. (2016) Yes -
50 Support The MECP2 variant c.925C>T (p.Arg309Trp) causes intellectual disability in both males and females without classic features of Rett syndrome. Schnewolf-Greulich B , et al. (2016) No Epilepsy (3/6 cases), macrocephaly (3/6 cases)
51 Support Identification of Intellectual Disability Genes in Female Patients with A Skewed X Inactivation Pattern. Fieremans N , et al. (2016) No -
52 Support Identification of a RAI1-associated disease network through integration of exome sequencing, transcriptomics, and 3D genomics. Loviglio MN , et al. (2016) No Behavioral abnormalities (self-injurious, aggressi
53 Support De novo genic mutations among a Chinese autism spectrum disorder cohort. Wang T , et al. (2016) Yes -
54 Support Clinical exome sequencing: results from 2819 samples reflecting 1000 families. Trujillano D , et al. (2016) No DD, ID, hypotonia
55 Support Diagnostic Targeted Resequencing in 349 Patients with Drug-Resistant Pediatric Epilepsies Identifies Causative Mutations in 30 Different Genes. Parrini E , et al. (2016) No Rett syndrome (2/4 cases)
56 Support Asperger syndrome and early-onset schizophrenia associated with a novel MECP2 deleterious missense variant. Curie A , et al. (2017) Yes Schizophrenia (1/2 cases)
57 Support Whole genome sequencing resource identifies 18 new candidate genes for autism spectrum disorder. C Yuen RK , et al. (2017) Yes Rett syndrome (2 cases)
58 Support A clinical utility study of exome sequencing versus conventional genetic testing in pediatric neurology. Vissers LE , et al. (2017) No -
59 Support Familial cases and male cases with MECP2 mutations. Zhang Q , et al. (2017) No -
60 Support Mapping autosomal recessive intellectual disability: combined microarray and exome sequencing identifies 26 novel candidate genes in 192 consanguin... Harripaul R , et al. (2017) No -
61 Support Genomic diagnosis for children with intellectual disability and/or developmental delay. Bowling KM , et al. (2017) Yes -
62 Highly Cited MeCP2 is a transcriptional repressor with abundant binding sites in genomic chromatin. Nan X , et al. (1997) No -
63 Highly Cited Transcriptional repression by the methyl-CpG-binding protein MeCP2 involves a histone deacetylase complex. Nan X , et al. (1998) No -
Rare Variants   (128)
Status Allele Change Residue Change Variant Type Inheritance Pattern Parental Transmission Family Type PubMed ID Author, Year
c.397C>A p.Arg133Cys missense_variant De novo - Simplex 10508514 Amir RE , et al. (1999)
c.464T>C p.Phe155Ser missense_variant De novo - Simplex 10508514 Amir RE , et al. (1999)
c.473C>T p.Thr158Met missense_variant De novo - Simplex 10508514 Amir RE , et al. (1999)
c.837C>T - stop_gained De novo - Simplex 10508514 Amir RE , et al. (1999)
c.694insT Stop after 27 out of frame AA's frameshift_variant Unknown Not maternal Simplex 10508514 Amir RE , et al. (1999)
c.316C>T p.Arg106Trp missense_variant Unknown Not maternal Multiplex 10508514 Amir RE , et al. (1999)
c.656C>T p.(=) synonymous_variant Familial Paternal Multiplex 10508514 Amir RE , et al. (1999)
c.1307C>T p.(=) synonymous_variant Unknown Not maternal Simplex 10508514 Amir RE , et al. (1999)
c.398G>T p.Arg133Leu missense_variant De novo - Simplex 10854091 De Bona C , et al. (2000)
c.423C>G p.Tyr141Ter stop_gained De novo - Simplex 10854091 De Bona C , et al. (2000)
c.431delA p.Lys144Argfs frameshift_variant De novo - Simplex 10854091 De Bona C , et al. (2000)
c.502C>T p.Arg168Ter stop_gained De novo - Simplex 10854091 De Bona C , et al. (2000)
c.674C>G p.Pro225Arg missense_variant De novo - Simplex 10854091 De Bona C , et al. (2000)
c.763C>T p.Arg255Ter stop_gained De novo - Simplex 10854091 De Bona C , et al. (2000)
c.808C>T p.Arg270Ter stop_gained De novo - Simplex 10854091 De Bona C , et al. (2000)
c.806delG p.Gly269Alafs frameshift_variant De novo - Simplex 10854091 De Bona C , et al. (2000)
c.880C>T p.Arg294Ter stop_gained De novo - Simplex 10854091 De Bona C , et al. (2000)
c.1157del41 p.Leu386Hisfs frameshift_variant De novo - Simplex 10854091 De Bona C , et al. (2000)
c.1158_1198del41 p.Pro387fs frameshift_variant De novo - Simplex 10854091 De Bona C , et al. (2000)
c.1159del44 387del15 aa, stop at 404 frameshift_variant De novo - Simplex 10854091 De Bona C , et al. (2000)
c.1165_1233del69ins21 p.Pro389_Pro411del23ins7 frameshift_variant De novo - Simplex 10854091 De Bona C , et al. (2000)
c.1216C>T p.Glu406Ter stop_gained Familial Maternal Multi-generational 10986043 Meloni I , et al. (2000)
c.419C>T p.Ala140Val missense_variant Familial Maternal Multi-generational 11007980 Orrico A , et al. (2000)
c.502C>T p.Arg168Ter stop_gained - - - 11007980 Orrico A , et al. (2000)
c.763C>T p.Arg255Ter stop_gained - - - 11007980 Orrico A , et al. (2000)
c.608C>T p.Thr203Met missense_variant Unknown - Unknown 11007980 Orrico A , et al. (2000)
c.656C>T p.(=) synonymous_variant - - - 11007980 Orrico A , et al. (2000)
c.1145C>T p.(=) synonymous_variant - - - 11007980 Orrico A , et al. (2000)
IVS2 −61C>G N/A intron_variant - - - 11007980 Orrico A , et al. (2000)
c.410A>G p.Glu137Gly missense_variant - - - 11309367 Couvert P , et al. (2001)
c.499C>T p.Arg167Trp missense_variant Familial Maternal Multiplex 11309367 Couvert P , et al. (2001)
c.1196C>T p.Pro399Leu missense_variant - - - 11309367 Couvert P , et al. (2001)
c.1358G>A p.Arg453Gln missense_variant - - - 11309367 Couvert P , et al. (2001)
c.850A>G p.Lys284Glu missense_variant - - - 11309367 Couvert P , et al. (2001)
CT to GT N/A intron_variant - - - 11309367 Couvert P , et al. (2001)
c.849C>G p.(=) synonymous_variant - - - 11309367 Couvert P , et al. (2001)
c.897C>T p.(=) synonymous_variant - - - 11309367 Couvert P , et al. (2001)
c.1035A>G p.(=) synonymous_variant - - - 11309367 Couvert P , et al. (2001)
c.1160C>T p.(=) synonymous_variant - - - 11309367 Couvert P , et al. (2001)
c.1161_1400del240 p.Pro388_Pro467del inframe_deletion Familial Maternal - 11807877 Yntema HG , et al. (2002)
c.674C>T p.Pro225Leu missense_variant De novo - - 12615169 Moog U , et al. (2003)
c.1357C>T p.Arg453Ter stop_gained De novo - Simplex 12707946 Zappella M , et al. (2003)
c.397C>T p.Arg133Cys missense_variant De novo - Simplex 12707946 Zappella M , et al. (2003)
c.1157_1197del41 p.Leu386Hisfs frameshift_variant De novo - - 12770674 Carney RM , et al. (2003)
c.880C>T p.Arg294Ter stop_gained De novo - - 12770674 Carney RM , et al. (2003)
c.819G>T p.(=) synonymous_variant Familial Paternal - 14986829 Pescucci C , et al. (2004)
c.587C>G p.Thr196Ser missense_variant - - - 15211631 Shibayama A , et al. (2004)
c.1127C>G p.Pro376Arg missense_variant - - - 15211631 Shibayama A , et al. (2004)
c.1558insA - frameshift_variant - - - 15211631 Shibayama A , et al. (2004)
c.1127C>G p.Pro376Arg missense_variant - - - 15211631 Shibayama A , et al. (2004)
c.6809T>C - 3_prime_UTR_variant Familial Maternal - 15211631 Shibayama A , et al. (2004)
c.1638G>C - 3_prime_UTR_variant Familial Maternal - 15211631 Shibayama A , et al. (2004)
- - copy_number_gain Familial Maternal Simplex 15689435 Meins M , et al. (2005)
c.964C>T p.Pro322Ser missense_variant Familial Maternal - 16966553 Ventura P , et al. (2006)
c.1214C>T p.Pro405Leu missense_variant De novo - - 18678449 Campos M Jr , et al. (2008)
c.479C>G p.Thr160Ser missense_variant - - - 21600714 Campos M Jr , et al. (2011)
c.582C>T p.(=) synonymous_variant - - - 21600714 Campos M Jr , et al. (2011)
c.1189G>A p.Glu397Lys missense_variant - - - 21600714 Campos M Jr , et al. (2011)
c.1233C>T p.(=) synonymous_variant - - - 21600714 Campos M Jr , et al. (2011)
c.641C>G p.Ala214Gly missense_variant Familial Maternal Simplex 21624971 Schaaf CP , et al. (2011)
- - copy_number_gain Familial Paternal Multiplex 22883432 Hanchard NA , et al. (2012)
c.1200_1222del p.Pro401ArgfsTer8 frameshift_variant De novo - Simplex 23020937 Rauch A , et al. (2012)
c.719C>G p.Thr240Ser missense_variant Familial Maternal Multiplex 23055267 Cukier HN , et al. (2012)
c.719C>G p.Thr240Ser missense_variant Familial Maternal Simplex 23055267 Cukier HN , et al. (2012)
c.1108G>A p.Ala370Thr missense_variant Familial Maternal Simplex 23055267 Cukier HN , et al. (2012)
c.63-44T>C - intron_variant Unknown Unknown Unknown 23055267 Cukier HN , et al. (2012)
c.312A>G p.(=) synonymous_variant Unknown Unknown Unknown 23055267 Cukier HN , et al. (2012)
c.413+94C>T - intron_variant Unknown Unknown Unknown 23055267 Cukier HN , et al. (2012)
c.413+102A>G - intron_variant Unknown Unknown Unknown 23055267 Cukier HN , et al. (2012)
c.786C>T p.(=) synonymous_variant Unknown Unknown Unknown 23055267 Cukier HN , et al. (2012)
c.870C>T p.(=) synonymous_variant Unknown Unknown Unknown 23055267 Cukier HN , et al. (2012)
c.978C>T p.(=) synonymous_variant Unknown Unknown Unknown 23055267 Cukier HN , et al. (2012)
c.1071A>G p.(=) synonymous_variant Unknown Unknown Unknown 23055267 Cukier HN , et al. (2012)
c.1371G>A p.(=) synonymous_variant Unknown Unknown Unknown 23055267 Cukier HN , et al. (2012)
c.65T>C p.(=) synonymous_variant Unknown Unknown Unknown 23055267 Cukier HN , et al. (2012)
c.1483G>T p.Glu495Ter stop_gained Familial Maternal Multiplex 23352160 Lim ET , et al. (2013)
c.596C>G p.Pro199Arg missense_variant Familial Maternal Multiplex 23352163 Yu TW , et al. (2013)
c.1447G>T p.Glu483Ter stop_gained Familial Maternal Multiplex 23352163 Yu TW , et al. (2013)
c.604C>T p.Arg202Cys missense_variant De novo - Simplex 24776741 McCarthy SE , et al. (2014)
c.916C>T p.Arg306Cys missense_variant De novo - Simplex 25167861 Redin C , et al. (2014)
c.502C>T p.Arg168Ter stop_gained De novo - Simplex 25167861 Redin C , et al. (2014)
c.[954A>T;957_960delins4bp;1060delCins6bp;1097_1235delins50bp] p.[Glu318Asp;Val320His;Arg354_Val412delins41] complex_structural_alteration Familial Maternal Multi-generational 25167861 Redin C , et al. (2014)
c.419C>T p.Ala140Val missense_variant Familial Maternal Multiplex 25473036 Soden SE , et al. (2014)
c.763C>T (c.799C>T) p.Arg255Ter (p.Arg267Ter) stop_gained De novo - Simplex 25533962 Deciphering Developmental Disorders Study (2014)
c.473C>T (c.509C>T) p.Thr158Met (p.Thr170Met) missense_variant De novo - Simplex 25533962 Deciphering Developmental Disorders Study (2014)
c.397C>T (c.433C>T) p.Arg133Cys (p.Arg145Cys) missense_variant De novo - Simplex 25533962 Deciphering Developmental Disorders Study (2014)
c.771_814del p.Glu258GlyfsTer58 frameshift_variant De novo - - 25914188 Olson HE , et al. (2015)
c.316C>T p.Arg106Trp missense_variant De novo - - 25914188 Olson HE , et al. (2015)
c.21delC p.Ala8ArgfsTer36 frameshift_variant De novo - - 25914188 Olson HE , et al. (2015)
c.554G>T p.Gly185Val missense_variant Familial Maternal Multiplex 26490184 Bianciardi L , et al. (2015)
c.499C>T p.Arg167Trp missense_variant Familial Maternal Multiplex 26490184 Bianciardi L , et al. (2015)
c.763C>T p.Arg255Ter stop_gained Unknown - Unknown 26666243 Lim EC , et al. (2015)
c.1366G>A p.Ala456Thr missense_variant Unknown - - 26845707 Alvarez-Mora MI , et al. (2016)
c.925C>T p.Arg309Trp missense_variant De novo - - 26936630 Schnewolf-Greulich B , et al. (2016)
c.925C>T p.Arg309Trp missense_variant De novo - - 26936630 Schnewolf-Greulich B , et al. (2016)
c.925C>T p.Arg309Trp missense_variant De novo - - 26936630 Schnewolf-Greulich B , et al. (2016)
c.925C>T p.Arg309Trp missense_variant De novo - - 26936630 Schnewolf-Greulich B , et al. (2016)
c.925C>T p.Arg309Trp missense_variant De novo - - 26936630 Schnewolf-Greulich B , et al. (2016)
c.925C>T p.Arg309Trp missense_variant Familial Maternal - 26936630 Schnewolf-Greulich B , et al. (2016)
c.880C>T p.Arg294Ter stop_gained Unknown - - 27159028 Fieremans N , et al. (2016)
GGGGGGCTGGTGGGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGT>G p.Pro398fsTer frameshift_variant Familial Maternal - 27799067 Loviglio MN , et al. (2016)
c.916C>T p.Arg294Ter stop_gained De novo - - 27824329 Wang T , et al. (2016)
c.799C>T p.Arg255Ter stop_gained De novo - - 27824329 Wang T , et al. (2016)
c.538C>T p.Arg168Ter stop_gained Unknown Not maternal - 27824329 Wang T , et al. (2016)
c.916C>T p.Arg306Ter stop_gained De novo - Simplex 27848944 Trujillano D , et al. (2016)
c.916C>T p.Arg306Ter stop_gained De novo - Simplex 27848944 Trujillano D , et al. (2016)
c.763C>T p.Arg255Ter stop_gained De novo - - 27864847 Parrini E , et al. (2016)
- - copy_number_loss De novo - - 27864847 Parrini E , et al. (2016)
c.397C>T p.Arg133Cys missense_variant De novo - - 27864847 Parrini E , et al. (2016)
c.915G>T p.Lys305Asn missense_variant De novo - - 27864847 Parrini E , et al. (2016)
c.491G>T p.Ser164Ile missense_variant De novo (possible germline mosaicism) - Multiplex (dizygotic twins) 28230711 Curie A , et al. (2017)
c.1164_1207del;c.1200_1243del p.Pro388fs;p.Pro400fs frameshift_variant De novo - Multiplex 28263302 C Yuen RK , et al. (2017)
c.686dupC;c.722dupC p.Ser229fs;p.Ser241fs frameshift_variant De novo - Multiplex 28263302 C Yuen RK , et al. (2017)
c.1447G>T;c.1483G>T p.Glu483Ter;p.Glu495Ter stop_gained Familial Maternal Multiplex 28263302 C Yuen RK , et al. (2017)
c.763C>T;c.799C>T p.Arg255Ter;p.Arg267Ter stop_gained Unknown - Simplex 28263302 C Yuen RK , et al. (2017)
c.1167_1200del;c.1203_1236del p.Pro389fs;p.Pro401fs frameshift_variant Unknown - Simplex 28263302 C Yuen RK , et al. (2017)
- - copy_number_gain Familial Maternal - 28333917 Vissers LE , et al. (2017)
c.502C>T p.Arg168Ter stop_gained De novo - - 28333917 Vissers LE , et al. (2017)
c.397C>T p.Arg133Cys missense_variant Familial Maternal Multiplex 28394482 Zhang Q , et al. (2017)
c.916C>T p.Arg306Cys missense_variant Familial Maternal Multi-generational 28394482 Zhang Q , et al. (2017)
c.397C>T p.Arg133Cys missense_variant Familial Maternal Multi-generational 28394482 Zhang Q , et al. (2017)
c.[1164_1207del44;1225_1227delAGC] p.Pro389Ter stop_gained Familial Maternal Simplex 28394482 Zhang Q , et al. (2017)
c.1409G>A p.Arg470His missense_variant Familial Maternal Simplex 28394482 Zhang Q , et al. (2017)
c.441C>G p.Asp147Glu missense_variant Familial Maternal Multiplex 28394482 Zhang Q , et al. (2017)
c.569G>A p.Arg190His missense_variant Familial - Multi-generational 28397838 Harripaul R , et al. (2017)
c.27-6C>G p.Arg9fsTer24 intron_variant De novo - - 28554332 Bowling KM , et al. (2017)
c.502C>T p.Arg168Ter stop_gained De novo - - 28554332 Bowling KM , et al. (2017)
c.1157_1197del41 p.Leu386Hisfs frameshift_variant De novo - - 28554332 Bowling KM , et al. (2017)
Common Variants  

No common variants reported.

SFARI Gene score
2S

Strong Candidate, Syndromic

Mutations in MECP2 cause Rett syndrome (Amir et al., 1999), which has been recognized as an autism spectrum disorder (DSM-IV). MECP2 mutations were identified in four females and one male with a clinical diagnosis of Angelman syndrome (Watson et al., 2001). Brain samples from several related neurodevelopmental disorders, including autism, pervasive developmental disorder, Prader-Willi and Angelman syndromes showed significant differences in MECP2 expression from age-matched controls by apparently different transcriptional and post-transcriptional mechanisms (Samaco et al., 2004). Significant defects in UBE3A/E6AP and GABRB3 expression has been observed in MECP2 deficient mice and human Rett, Angelman and autism brains compared with controls (Samaco et al., 2005). A significant reduction in frontal cortex MECP2 expression compared to age-matched controls was found in autism (79%), RTT (100%), Angelman syndrome (100%), Prader-Willi syndrome (75%), Down syndrome (60%), and attention deficit hyperactivity disorder (100%) samples. As well, significantly increased MECP2 promoter methylation was seen in autistic male frontal cortex compared to controls (Nagarajan et al., 2006). Rare mutations and genetic association with MECP2 has been identified in autistic individuals (Loat et al., 2008), with de novo loss-of-function variants observed in four ASD probands (Carney et al., 2003; Wang et al., 2016). In addition, autism and other neuropsychiatric symptoms are prevalent in individuals with MECP2 duplication syndrome (Ramocki et al., 2009).

2

Strong Candidate

See all Category 2 Genes

We considered a rigorous statistical comparison between cases and controls, yielding genome-wide statistical significance, with independent replication, to be the strongest possible evidence for a gene. These criteria were relaxed slightly for category 2.

The syndromic category includes mutations that are associated with a substantial degree of increased risk and consistently linked to additional characteristics not required for an ASD diagnosis. If there is independent evidence implicating a gene in idiopathic ASD, it will be listed as "#S" (e.g., 2S, 3S, etc.). If there is no such independent evidence, the gene will be listed simply as "S."

04-01-2017
2S

Initial score established: 2S

Description

Mutations in MECP2 cause Rett syndrome (Amir et al., 1999), which has been recognized as an autism spectrum disorder (DSM-IV). MECP2 mutations were identified in four females and one male with a clinical diagnosis of Angelman syndrome (Watson et al., 2001). Brain samples from several related neurodevelopmental disorders, including autism, pervasive developmental disorder, Prader-Willi and Angelman syndromes showed significant differences in MECP2 expression from age-matched controls by apparently different transcriptional and post-transcriptional mechanisms (Samaco et al., 2004). Significant defects in UBE3A/E6AP and GABRB3 expression has been observed in MECP2 deficient mice and human Rett, Angelman and autism brains compared with controls (Samaco et al., 2005). A significant reduction in frontal cortex MECP2 expression compared to age-matched controls was found in autism (79%), RTT (100%), Angelman syndrome (100%), Prader-Willi syndrome (75%), Down syndrome (60%), and attention deficit hyperactivity disorder (100%) samples. As well, significantly increased MECP2 promoter methylation was seen in autistic male frontal cortex compared to controls (Nagarajan et al., 2006). Rare mutations and genetic association with MECP2 has been identified in autistic individuals (Loat et al., 2008), with de novo loss-of-function variants observed in four ASD probands (Carney et al., 2003; Wang et al., 2016). In addition, autism and other neuropsychiatric symptoms are prevalent in individuals with MECP2 duplication syndrome (Ramocki et al., 2009).

Reports Added
[The MECP2 variant c.925C>T (p.Arg309Trp) causes intellectual disability in both males and females without classic features of Rett syndrome.2016] [Rare complete knockouts in humans: population distribution and significant role in autism spectrum disorders.2013] [Genetic modifiers of MeCP2 function in Drosophila.2008] [Oligogenic heterozygosity in individuals with high-functioning autism spectrum disorders.2011] [Range of genetic mutations associated with severe non-syndromic sporadic intellectual disability: an exome sequencing study.2012] [Increased binding of MeCP2 to the GAD1 and RELN promoters may be mediated by an enrichment of 5-hmC in autism spectrum disorder (ASD) cerebellum.2014] [Mutations in epilepsy and intellectual disability genes in patients with features of Rett syndrome.2015] [Deletion of Mecp2 in Sim1-expressing neurons reveals a critical role for MeCP2 in feeding behavior, aggression, and the response to stress.2008] [MECP2 genomic structure and function: insights from ENCODE.2008] [Comprehensive molecular testing in patients with high functioning autism spectrum disorder.2016] [Dysfunction in GABA signalling mediates autism-like stereotypies and Rett syndrome phenotypes.2010] [L1 retrotransposition in neurons is modulated by MeCP2.2010] [A mutation in the rett syndrome gene, MECP2, causes X-linked mental retardation and progressive spasticity in males.2000] [MECP2 mutation in male patients with non-specific X-linked mental retardation.2000] [MECP2 is highly mutated in X-linked mental retardation.2001] [Whole genome sequencing resource identifies 18 new candidate genes for autism spectrum disorder.2017] [In-frame deletion in MECP2 causes mild nonspecific mental retardation.2002] [MeCP2 binds to 5hmC enriched within active genes and accessible chromatin in the nervous system.2012] [Neurodevelopmental disorders in males related to the gene causing Rett syndrome in females (MECP2).2003] [GluD1 is a common altered player in neuronal differentiation from both MECP2-mutated and CDKL5-mutated iPS cells.2014] [Submicroscopic duplication in Xq28 causes increased expression of the MECP2 gene in a boy with severe mental retardation and features of Rett syndr...2005] [Bisphenol A delays the perinatal chloride shift in cortical neurons by epigenetic effects on the Kcc2 promoter.2013] [MeCP2 is a transcriptional repressor with abundant binding sites in genomic chromatin.1997] [Overexpression of methyl-CpG binding protein 2 impairs T(H)1 responses.2012] [A novel familial MECP2 mutation in a young boy: clinical and molecular findings.2006] [De novo genic mutations among a Chinese autism spectrum disorder cohort.2016] [Mapping autosomal recessive intellectual disability: combined microarray and exome sequencing identifies 26 novel candidate genes in 192 consanguin...2017] [A MECP2 mutation in a highly conserved aminoacid causing mental retardation in a male.2008] [The expanding role of MBD genes in autism: identification of a MECP2 duplication and novel alterations in MBD5, MBD6, and SETDB1.2012] [De novo mutations in schizophrenia implicate chromatin remodeling and support a genetic overlap with autism and intellectual disability.2014] [An AT-hook domain in MeCP2 determines the clinical course of Rett syndrome and related disorders.2013] [Familial cases and male cases with MECP2 mutations.2017] [Reciprocal co-regulation of EGR2 and MECP2 is disrupted in Rett syndrome and autism.2008] [MECP2 missense mutations outside the canonical MBD and TRD domains in males with intellectual disability.2015] [Using whole-exome sequencing to identify inherited causes of autism.2013] [Genomic diagnosis for children with intellectual disability and/or developmental delay.2017] [Asperger syndrome and early-onset schizophrenia associated with a novel MECP2 deleterious missense variant.2017] [Diagnostic Targeted Resequencing in 349 Patients with Drug-Resistant Pediatric Epilepsies Identifies Causative Mutations in 30 Different Genes.2016] [Neuronal MeCP2 is expressed at near histone-octamer levels and globally alters the chromatin state.2010] [Effectiveness of exome and genome sequencing guided by acuity of illness for diagnosis of neurodevelopmental disorders.2014] [Identification of a RAI1-associated disease network through integration of exome sequencing, transcriptomics, and 3D genomics.2016] [Genome-wide activity-dependent MeCP2 phosphorylation regulates nervous system development and function.2011] [Clinical exome sequencing: results from 2819 samples reflecting 1000 families.2016] [Transcriptional repression by the methyl-CpG-binding protein MeCP2 involves a histone deacetylase complex.1998] [Efficient strategy for the molecular diagnosis of intellectual disability using targeted high-throughput sequencing.2014] [Next-generation sequencing using a pre-designed gene panel for the molecular diagnosis of congenital disorders in pediatric patients.2015] [Identification of Intellectual Disability Genes in Female Patients with A Skewed X Inactivation Pattern.2016] [Identification of MeCP2 mutations in a series of females with autistic disorder.2003] [Rett syndrome mutations abolish the interaction of MeCP2 with the NCoR/SMRT co-repressor.2013] [Activity-dependent phosphorylation of MeCP2 threonine 308 regulates interaction with NCoR.2013] [Chromosome 2 deletion encompassing the MAP2 gene in a patient with autism and Rett-like features.2004] [Large-scale discovery of novel genetic causes of developmental disorders.2014] [MECP2 structural and 3'-UTR variants in schizophrenia, autism and other psychiatric diseases: a possible association with autism.2004] [Rett syndrome is caused by mutations in X-linked MECP2, encoding methyl-CpG-binding protein 2.1999] [Preserved speech variant is allelic of classic Rett syndrome.2000] [No mutations in the coding region of the Rett syndrome gene MECP2 in 59 autistic patients.2001] [Study of MECP2 gene in Rett syndrome variants and autistic girls.2003] [Transcriptional regulation of the MET receptor tyrosine kinase gene by MeCP2 and sex-specific expression in autism and Rett syndrome.2013] [A partial MECP2 duplication in a mildly affected adult male: a putative role for the 3' untranslated region in the MECP2 duplication phenotype.2012] [A MECP2 missense mutation within the MBD domain in a Brazilian male with autistic disorder.2011] [Oligodendrocyte lineage cells contribute unique features to Rett syndrome neuropathology.2013] [MeCP2 deficiency disrupts axonal guidance, fasciculation, and targeting by altering Semaphorin 3F function.2009] [A clinical utility study of exome sequencing versus conventional genetic testing in pediatric neurology.2017]
CNVs associated with MECP2(1 CNVs)
Xq28 47 Deletion-Duplication 63  /  382
Animal Models associated with MECP2(62 Models)
MECP2_10_KO_HM Genetic
MECP2_10_KO_HM_Ampakine RESCUE-Pharmaceutical
MECP2_10_PET1_CN_KO_HM Genetic
MECP2_11_KO_HE Genetic
MECP2_12_KO_HT Genetic
MECP2_12_KO_HT_Cort_H RESCUE-Pharmaceutical
MECP2_12_KO_HT_Cort_L RESCUE-Pharmaceutical
MECP2_12_KO_HT_CYS Genetic
MECP2_12_KO_HT_RU486 RESCUE-Pharmaceutical
MECP2_13_KO_HE Genetic
MECP2_14_A140V_HE Genetic
MECP2_15_A140V_HT Genetic
MECP2_16_KO_HE Genetic
MECP2_16_KO_HE_Cort_H RESCUE-Pharmaceutical
MECP2_16_KO_HE_Cort_L RESCUE-Pharmaceutical
MECP2_16_KO_HE_RU486 RESCUE-Pharmaceutical
MECP2_17_CN_KO_HE Genetic
MECP2_18_CN_KO_HE Genetic
MECP2_19_CKO_HE Genetic
MECP2_1_KO_HM Genetic
MECP2_20_T158A_HE Genetic
MECP2_21_T158A_HT Genetic
MECP2_22_KO_HE Genetic
MECP2_23_308T_HT Genetic
MECP2_24_308T_HE Genetic
MECP2_25_308T_HT_BDE47 RESCUE-Pharmaceutical
MECP2_26_OE_HM Genetic
MECP2_27_KO_HT Genetic
MECP2_28_KO_HT Genetic
MECP2_29_KO_HT Genetic
MECP2_2_CN_KO Genetic
MECP2_30_KO_HM Genetic
MECP2_30_KO_HM_ALC RESCUE-Pharmaceutical
MECP2_31_KO_HT Genetic
MECP2_31_KO_HT_ALC RESCUE-Pharmaceutical
MECP2_32_CKO_HE_PVN Genetic
MECP2_33_CKO_HE_SOMN Genetic
MECP2_34_TG Genetic
MECP2_35_TG Genetic
MECP2_36_TG Genetic
MECP2_36_TG_ASO1 RESCUE-Pharmaceutical
MECP2_36_TG_ASO2 RESCUE-Pharmaceutical
MECP2_36_TG_ASO3 RESCUE-Pharmaceutical
MECP2_36_TG_ASO4 RESCUE-Pharmaceutical
MECP2_36_TG_ASO5 RESCUE-Pharmaceutical
MECP2_37_TG Genetic
MECP2_38_TG_Cre Genetic
MECP2_39_KI_R306C_HE Genetic
MECP2_3_CN_HM Genetic
MECP2_40_KI_STOP_HE Genetic
MECP2_40_KI_STOP_HE_Avl-cre RESCUE-Genetic
MECP2_41_CKO_HE Genetic
MECP2_42_CKO_HE Genetic
MECP2_43_CKO_HT Genetic
MECP2_44_CKO_HT Genetic
MECP2_4_308T Genetic
MECP2_5_KO_HE Genetic
MECP2_5_KO_HE_DHF RESCUE-Pharmaceutical
MECP2_6_CN_KO_HM Genetic
MECP2_7_S80A_KI_HM Genetic
MECP2_8_CN_KD_HM Genetic
MECP2_9_TH_CN_KO_HM Genetic
Interaction Table
Interactor Symbol Interactor Name Interactor Organism Interactor Type Entrez ID Uniprot ID
7-Sep septin 7 Human DNA Binding 989 A8K3D0
ABCB1 ATP-binding cassette, sub-family B (MDR/TAP), member 1 Human DNA Binding 5243 A4D1D2
ABCG2 ATP-binding cassette, sub-family G (WHITE), member 2 Human DNA Binding 9429 Q9UNQ0
ANKRD2 ankyrin repeat domain 2 (stretch responsive muscle) Human DNA Binding 26287 Q9GZV1
C18ORF21 UPF0711 protein C18orf21 Human Protein Binding 83608 Q32NC0
CamKIV Calcium/calmodulin-dependent protein kinase type IV Mouse Direct Regulation P08414
Cdk10 cyclin-dependent kinase 10 Mouse RNA Binding 234854 Q0VH02
CHRFAM7A CHRNA7 (cholinergic receptor, nicotinic, alpha 7, exons 5-10) and FAM7A (family with sequence similarity 7A, exons A-E) fusion Human DNA Binding 89832 Q494W8
DDX25 DEAD (Asp-Glu-Ala-Asp) box helicase 25 Human Protein Binding 29118 Q9UHL0
Dlx4 distal-less homeobox 4 Mouse DNA Binding 1748 Q92988
DLX6 distal-less homeobox 6 Human DNA Binding 1750 J3KR92
EGR2 early growth response 2 Human DNA Binding 1959 P11161
Fam19a1 family with sequence similarity 19, member A1 Mouse DNA Binding 320265 Q7TPG8
Fam203a family with sequence similarity 203, member A Mouse DNA Binding 59053 Q8C3I8
Gadd45b Growth arrest and DNA-damage-inducible 45 beta Rat Direct Regulation 299626 Q5U3Z2
Gpaa1 GPI anchor attachment protein 1 Mouse DNA Binding 14731 Q9WTK3
gs17 gastrula-specific protein 17 African clawed frog Direct Regulation 397898 P07733
GTF2F2 general transcription factor IIF, polypeptide 2, 30kDa Human DNA Binding 2963 P13984
hes4-a hairy and enhancer of split 4 African clawed frog Direct Regulation 398579 Q90Z12
Ifng interferon gamma Mouse DNA Binding 15978 P01580
IGF2 insulin-like growth factor 2 (somatomedin A) Human DNA Binding 3481 P01344
IGFBP2 insulin-like growth factor binding protein 2, 36kDa Human DNA Binding 3485 P18065
KIF25-AS1 KIF25 antisense RNA 1 Human DNA Binding 100505879 Q9Y6Z4
Kirrel2 kin of IRRE like 2 (Drosophila) Mouse DNA Binding 243911 Q7TSU7
LOC407840 oviduct protein p20 African clawed frog Protein Binding 407840 Q6Q2J3
MAGEA2 melanoma antigen family A, 2 Human DNA Binding 4101 P43356
MAGEA3 melanoma antigen family A, 3 Human DNA Binding 4102 P43357
miR-132 microRNA 132 Mouse Direct Regulation 387150 N/A
miR-212 microRNA 212 Mouse Direct Regulation 387208 N/A
miR-432 microRNA 432 Human RNA Binding 574451 N/A
Mir106a microRNA 106a Mouse DNA Binding 723829 N/A
Mir124b microRNA 124b Mouse DNA Binding 387234 N/A
Mir128-2 microRNA 128-2 Mouse DNA Binding 723815 N/A
MIR132 microRNA 132 Human DNA Binding 406921 N/A
Mir134 microRNA 134 Mouse DNA Binding 387152 N/A
Mir135a1 microRNA 135a-1 Mouse DNA Binding 387153 N/A
Mir137 microRNA 137 Mouse DNA Binding 387155 N/A
Mir139 microRNA 139 Mouse DNA Binding 387157 N/A
Mir143 microRNA 143 Mouse DNA Binding 387161 N/A
Mir145 microRNA 145 Mouse DNA Binding 387163 N/A
Mir148b microRNA 148b Mouse DNA Binding 724064 N/A
Mir150 microRNA 150 Mouse DNA Binding 387168 N/A
Mir151 microRNA 151 Mouse DNA Binding 387169 N/A
MIR152 microRNA 152 Human DNA Binding 406943 N/A
Mir154 microRNA 154 Mouse DNA Binding 387172 N/A
Mir18 microRNA 18 Mouse DNA Binding 387135 N/A
Mir181c microRNA 181c Mouse DNA Binding 723819 N/A
Mir193b microRNA 193b Mouse DNA Binding 100124432 N/A
Mir195 microRNA 195 Mouse DNA Binding 387190 N/A
Mir19a microRNA 19a Mouse DNA Binding 723891 N/A
Mir204 microRNA 204 Mouse DNA Binding 387200 N/A
Mir205 microRNA 205 Mouse DNA Binding 387201 N/A
Mir207 microRNA 207 Mouse DNA Binding 387203 N/A
Mir20a microRNA 20a Mouse DNA Binding 387139 N/A
Mir211 microRNA 211 Mouse DNA Binding 387207 N/A
Mir25 microRNA 25 Mouse DNA Binding 723926 N/A
Mir28 microRNA 28 Mouse DNA Binding 723830 N/A
Mir299 microRNA 299 Mouse DNA Binding 723927 N/A
Mir300 microRNA 300 Mouse DNA Binding 723833 N/A
Mir302a microRNA 302a Mouse DNA Binding 723920 N/A
Mir302b microRNA 302b Mouse DNA Binding 723948 N/A
Mir302c microRNA 302c Mouse DNA Binding 723835 N/A
Mir302d microRNA 302d Mouse DNA Binding 723928 N/A
Mir30c-1 microRNA 30c-1 Mouse DNA Binding 387227 N/A
Mir30e microRNA 30e Mouse DNA Binding 723836 N/A
Mir323 microRNA 323 Mouse DNA Binding 723839 N/A
Mir326 microRNA 326 Mouse DNA Binding 723840 N/A
Mir329 microRNA 329 Mouse DNA Binding 723842 N/A
Mir33 microRNA 33 Mouse DNA Binding 723897 N/A
Mir330 microRNA 330 Mouse DNA Binding 724063 N/A
Mir338 microRNA 338 Mouse DNA Binding 723844 N/A
Mir339 microRNA 339 Mouse DNA Binding 723898 N/A
Mir341 microRNA 341 Mouse DNA Binding 723846 N/A
Mir345 microRNA 345 Mouse DNA Binding 723946 N/A
Mir34b microRNA 34b Mouse DNA Binding 723849 N/A
Mir34c microRNA 34c Mouse DNA Binding 723932 N/A
Mir365-1 microRNA 365-1 Mouse DNA Binding 723899 N/A
Mir367 microRNA 367 Mouse DNA Binding 723911 N/A
Mir369 microRNA 369 Mouse DNA Binding 723933 N/A
Mir370 microRNA 370 Mouse DNA Binding 723854 N/A
Mir376a microRNA 376a Mouse DNA Binding 723855 N/A
Mir376b microRNA 376b Mouse DNA Binding 723934 N/A
Mir376c microRNA 376c Mouse DNA Binding 723856 N/A
Mir377 microRNA 377 Mouse DNA Binding 723857 N/A
Mir378 microRNA 378 Mouse DNA Binding 723889 N/A
Mir379 microRNA 379 Mouse DNA Binding 723858 N/A
Mir380 microRNA 380 Mouse DNA Binding 723859 N/A
Mir381 microRNA 381 Mouse DNA Binding 723935 N/A
Mir382 microRNA 382 Mouse DNA Binding 723912 N/A
Mir409 microRNA 409 Mouse DNA Binding 723862 N/A
Mir410 microRNA 410 Mouse DNA Binding 723863 N/A
Mir411 microRNA 411 Mouse DNA Binding 723936 N/A
Mir412 microRNA 412 Mouse DNA Binding 723913 N/A
Mir449a microRNA 449a Mouse DNA Binding 723868 N/A
Mir449b microRNA 449b Mouse DNA Binding 100190765 N/A
Mir453 microRNA 453 Mouse DNA Binding 100124484 N/A
Mir485 microRNA 485 Mouse DNA Binding 723875 N/A
Mir487b microRNA 487b Mouse DNA Binding 723940 N/A
Mir488 microRNA 488 Mouse DNA Binding 735253 N/A
Mir494 microRNA 494 Mouse DNA Binding 723878 N/A
Mir495 microRNA 495 Mouse DNA Binding 751522 N/A
Mir496 microRNA 496 Mouse DNA Binding 751524 N/A
Mir497 microRNA 497 Mouse DNA Binding 751537 N/A
Mir539 microRNA 539 Mouse DNA Binding 723917 N/A
Mir541 microRNA 541 Mouse DNA Binding 723941 N/A
Mir543 microRNA 543 Mouse DNA Binding 723881 N/A
Mir544 microRNA 544 Mouse DNA Binding 100124450 N/A
Mir654 microRNA 654 Mouse DNA Binding 100124453 N/A
Mir666 microRNA 666 Mouse DNA Binding 751521 N/A
Mir671 microRNA 671 Mouse DNA Binding 735264 N/A
Mir7-1 microRNA 7-1 Mouse DNA Binding 723902 N/A
Mir708 microRNA 708 Mouse DNA Binding 735284 N/A
Mir758 microRNA 758 Mouse DNA Binding 791071 N/A
Mir802 microRNA 802 Mouse DNA Binding 791074 N/A
Mir882 microRNA 882 Mouse DNA Binding 100124461 N/A
Mir93 microRNA 93 Mouse DNA Binding 723885 N/A
MT1A metallothionein 1A Human DNA Binding 4489 P04731
Mug1 murinoglobulin 1 Mouse DNA Binding 17836 P28665
Mug2 murinoglobulin 2 Mouse DNA Binding 17837 P28666
Myo3a myosin IIIA Mouse DNA Binding 667663 F6QNG5
Mypop Myb-related transcription factor, partner of profilin Mouse DNA Binding 232934 Q8R4U1
Nfkbiz nuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor, zeta Mouse DNA Binding 80859 Q9EST8
Nnmt nicotinamide N-methyltransferase Mouse DNA Binding 18113 O55239
Oplah 5-oxoprolinase (ATP-hydrolysing) Mouse DNA Binding 75475 Q8K010
OR4K1 olfactory receptor, family 4, subfamily K, member 1 Human DNA Binding 79544 Q8NGD4
OR4Q3 olfactory receptor, family 4, subfamily Q, member 3 Human DNA Binding 441669 Q8NH05
PCDHB1 protocadherin beta 1 Human DNA Binding 29930 Q9Y5F3
PCDHB7 protocadherin beta 7 Human DNA Binding 56129 Q9Y5E2
Pdyn prodynorphin Rat DNA Binding 29190 F1M7S3
PLA2G16 phospholipase A2, group XVI Human DNA Binding 11145 P53816
RASSF1 Ras association (RalGDS/AF-6) domain family member 1 Human DNA Binding 11186 Q9NS23
Rsph6a radial spoke head 6 homolog A (Chlamydomonas) Mouse DNA Binding 83434 Q8CDR2
SDHD succinate dehydrogenase complex, subunit D, integral membrane protein Human DNA Binding 6392 O14521
Six5 sine oculis-related homeobox 5 Mouse DNA Binding 20475 P70178
SNAT1 solute carrier family 38, member 1 Mouse DNA Binding 105727 Q8K2P7
SNURF SNRPN upstream reading frame Human DNA Binding 8926 Q9Y675
Spi1 spleen focus forming virus (SFFV) proviral integration oncogene spi1 Mouse Protein Binding 20375 P17433
Syt13 synaptotagmin XIII Mouse DNA Binding 80976 Q9EQT6
SYT3 synaptotagmin III Human DNA Binding 20981 G3X9Y1
t-a T, brachyury homolog African clawed frog Direct Regulation 399275 P24781
Tac4 tachykinin 4 Mouse DNA Binding 93670 Q99N14
TAF1C TATA box-binding protein-associated factor RNA polymerase I subunit C Human Protein Binding 9013 Q15572-6
Tsix X (inactive)-specific transcript, antisense Mouse DNA Binding 22097 N/A
TSSC1 tumor suppressing subtransferable candidate 1 Human DNA Binding 7260 Q53HC9
Uba1y ubiquitin-activating enzyme, Chr Y Mouse DNA Binding 22202 P31254
WDR83OS WD repeat domain 83 opposite strand Human DNA Binding 51398 Q9Y284
ZNF593 Zinc finger protein 593 Human Protein Binding 51042 O00488
Submit New Gene

Report an Error